Clinical Cancer Research Bridging the Lab and the Clinic in Cancer Medicine Infection and Cancer: Biology, Therapeutics, and Prevention
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Duvic, M.
Right arrow Articles by Nagpal, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Duvic, M.
Right arrow Articles by Nagpal, S.
Clinical Cancer Research Vol. 6, 3249-3259, August 2000
© 2000 American Association for Cancer Research

Molecular Oncology, Markers, Clinical Correlates

Expression of a Retinoid-inducible Tumor Suppressor, Tazarotene-inducible Gene-3, Is Decreased in Psoriasis and Skin Cancer1

Madeleine Duvic2, Bharati Helekar, Claudia Schulz, Mimi Cho, Dan DiSepio, Carina Hager, Dominique DiMao, Parul Hazarika, Brooke Jackson, Joan Breuer-McHam, John Young, Gary Clayman, Scott M. Lippman, Roshandra A. S. Chandraratna, Nancy A. Robinson, Anne Deucher, Richard L. Eckert and Sunil Nagpal

Section of Dermatology, Department of Internal Medical Specialties [M. D., B. H., C. S., M. C., C. H., D. DiM., P. H., B. J., J. B-M., J. Y.], Department of Head and Neck Surgery [G. C.], Division of Cancer Prevention [S. M. L.], M. D. Anderson Cancer Center, Houston, Texas 77030; Allergan Research, Irvine, California 92612 [D. DiS., R. A. S. C., S. N.]; and Department of Physiology/Biophysics, Case Western Reserve, Cleveland, Ohio 44106 [N. A. R., A. D., R. L. E.]


   ABSTRACT
Top
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Tazarotene-induced gene-3 (TIG-3), isolated from human keratinocytes treated with the retinoic acid receptor-selective retinoid Tazarotene, is homologous to H-rev, a class II tumor suppressor. TIG-3 gene localized to chromosome 11q23, a site of loss of heterozygosity in several malignancies. Retinoids influence epidermal differentiation and are used to treat and prevent skin cancer. Therefore, we studied TIG-3 mRNA expression in psoriasis and in basal and SCCs by in situ hybridization and a quantitative QT-RT-PCR assay. Psoriasis lesions had significantly lower staining (median, 3) than paired normal control skin (median, 4; P = 0.012). TIG-3 mRNA was significantly higher in normal control skin (P = 0.001), in paired adjacent skin (median, 3; P = 0.007), and in overlying epidermis (median, 3.0; P = 0.0001) than in 21 SCC specimens as a group (median, 1.5). Aggressive SCCs (median, 1.0) were lower in TIG-3 mRNA staining than nonaggressive SCCs (median, 1.5; P = 0.07). Three aggressive tumors had no TIG-3 mRNA staining. TIG-3 protein as shown by immunohistochemistry was highest in the suprabasal epidermis of normal skin, just under the stratum corneum, and was decreased in basal and squamous cell carcinomas, similar to the mRNA staining. Reduction in TIG-3 mRNA expression in psoriasis and basal carcinomas and loss in some aggressive SCCs support the hypothesis that TIG-3 may function as a tumor suppressor in both normal and malignant epidermal differentiation.


   INTRODUCTION
Top
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The protective skin barrier arises from a tightly controlled genetic differentiation program resulting in keratinocyte apoptosis and stratum corneum formation (1 , 2) . Despite the fact that most keratinocytes undergo apoptosis, malignancies of keratinocytes (basal, SCC,3 or basosquamous cell carcinomas) commonly arise and are the most common malignancies in humans (3) . The molecular basis of some squamous carcinomas is related to mutations in p53 and in H-ras, induced by UV light (4 , 5) . Mutations in genes of the sonic-hedgehog or patched pathway have been implicated recently in the formation of BCCs, although phenotypic variation is complex (6, 7, 8, 9) . Many other genes may contribute to the pathogenesis of skin cancers because of the complexity of the epidermal differentiation pathway and the need for chronic repair of DNA damage (10, 11, 12) .

Benign epidermal hyperplasia may also result in the presence of a cutaneous inflammatory reaction, such as psoriasis, in genetically susceptible individuals (13) . The genetic programs controlling epidermal differentiation, although only partially understood, are known to be regulated in part by steroid hormones, including vitamin A (retinoids) and vitamin D (deltoids; Ref. 14 ). Retinoids exert their effects in part through binding to differentially expressed RAR or retinoid X receptors (15, 16, 17) . Retinoids and their receptors also interact with specific DNA transcription factors, including AP1, AP2, CBP300, and nuclear factor-interleukin 6, thought to regulate epidermal differentiation (18, 19, 20, 21) . The cytokine-inducible nuclear transcription factor, nuclear factor-{kappa}B, has also been implicated in control of epidermal proliferation (22) . Topical retinoid treatment is known to alter the expression of epidermal keratin and other differentiation markers (23) .

Retinoids are active clinically in psoriasis (24, 25, 26) and for both chemoprevention and therapy of squamous carcinomas and oral leukoplakia (27) .). Tazarotene, a new synthetic RAR ß,{gamma}-selective retinoid, is effective topically for treatment of psoriasis and acne (28, 29, 30) . Tazarotene treatment is associated with decreased expression of epidermal genes overexpressed in psoriasis, including type I keratinocyte transglutaminase, epidermal growth factor receptor, MRP-8, and scalp/elafin (29 , 31 , 32) . In addition, Tazarotene reduces the expression of inflammatory markers including intercellular adhesion molecule-1 and HLA-DR on cells in psoriasis lesions and increases the reexpression of profilaggrin, a marker of terminal differentiation (31 , 33) . Recently, a clinical study has suggested that topical Tazarotene may induce remissions of basal cell carcinomas (34) .

To understand the mechanism of action of Tazarotene and its effect on epidermal gene expression, novel TIG cDNAs were isolated by differential display PCR from mRNA collected from treated or mock-treated human keratinocytes (35, 36, 37) . TIG-3 (RANTES-3; Ref. 38 ), a cDNA of 736 bp, was induced 4-fold in treated human keratinocyte cultures. The cDNA isolated predicted an Mr 18,000 protein of 164 amino acids with 52% homology to H-rev 107, a known class II tumor suppressor (39) . H-rev 107 is down-regulated by ras transfection into rat fibroblasts, up-regulated in fibroblasts that spontaneously revert after ras transfection, and is induced by IFN-{gamma} in astrocytes (40 , 41) . TIG-3 has been expressed with an inducible promoter causing growth retardation in EcR-293 kidney cell lines (38) . Similar studies done in a SCC line show growth inhibition by TIG-3 sense constructs in vitro.4 These studies suggest that the function of TIG-3 is as a tumor suppressor (38) . Of interest, TIG-3 maps to chromosome 11q23 that has been reported previously to show loss of heterozygosity in a number of different tumors and is suspected to contain a tumor suppressor (42 , 43) .

Cell culture studies have shown that TIG-3 is up-regulated by all RAR-selective retinoids including Tazarotene and was inducible in keratinocytes and in the spontaneously transformed keratinocytes, the HaCat cell line (38) . Psoriasis is a disease characterized by rapid epidermal proliferation in response to T-cell inflammation, which is inhibited by topical Tazarotene (28) . Thus, we hypothesized that: (a) TIG-3 expression may also be associated with growth inhibition in normal as well as inflamed epidermis; and (b) loss of TIG-3 expression could result in epidermal malignancies. We examined the level and pattern of expression of TIG-3 mRNA and protein as a putative tumor suppressor in normal skin, compared with psoriasis and BCCs and SCCs.


   MATERIALS AND METHODS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Patient Specimens.
Skin biopsy specimens were taken from unaffected, normal skin and from 29 psoriasis patients’ lesions at baseline prior to their use of an investigational 0.1% Tazarotene gel and at 3 and 14 days of treatment. Aggressive (n = 11) and nonaggressive (n = 10) SCCs and BCCs (n = 6) of the skin and paired normal skin specimens from overlying and/or adjacent normal skin, as available, were obtained from patients undergoing surgery in Dermatology Section and the Department of Head and Neck Surgery, M. D. Anderson Cancer Center (Table 1)Citation . Additional specimens from BCCs, SCCs, and normal adjacent skin for mRNA isolation were taken from Moh’s surgery cases and snap frozen at -70°C (Table 2)Citation . All patients signed informed consent under approved protocols.


View this table:
[in this window]
[in a new window]
  		Table 1 TIG-3 mRNA hybridization in SCC tumors compared with normal overlying or adjacent skin specimens

 

View this table:
[in this window]
[in a new window]
  		Table 2 Specimens from adjacent normal skin and tumors for QT-RT-PCR RNA measurements

 
Specimens were fixed in 4% paraformaldehyde at 4°C for 16–24 h, processed in alcohol, and embedded in paraffin as described previously (1 , 11) . Sections of 4 µm were mounted on sialinated, nuclease-free glass slides (CEL Associates, Houston, TX) for in situ hybridization.

Preparation of Riboprobes.
Plasmid (pAGN-TIG 3) containing a 600-bp 3' cDNA from TIG-3 was inserted in reverse orientation in EcoRI in a PCRII vector. One µg of cDNA template was linearized with NotI or HindIII and transcribed using either Sp6 or T7 polymerase to yield antisense and sense riboprobes, respectively. The riboprobes were transcribed in the presence of UTP-digoxigenin using a Genius 4 kit, according to the manufacturer’s instructions (Boehringer-Mannheim, Indianapolis, IN) as described previously (44) . The empirical concentration of the probes was estimated using a dot blot method involving serial dilutions with a Dig DNA labeling and detection kit (Boehringer Mannheim).

ISH and Detection of Riboprobes.
ISH was performed according to a modified procedure of Xu et al. (44) . Deparaffinized and rehydrated tissue sections were washed in PBS (pH 7.2), followed by 0.2 N HCl at room temperature for 10 min. They were treated with proteinase K in 10 mM Tris and 2 mM CaCl2 (pH 8.0) for 20 min at 37°C. After three washes in PBS, sections were postfixed with 4% paraformaldehyde for 5 min at room temperature, washed three times in PBS, and acetylated at pH 8.0. After a final PBS wash, sections were dehydrated in ethanol and air-dried.

Prehybridization was carried out in a humidification chamber in 50% deionized formamide, 2x SSC solution, 2x Denhardt’s solution (0.02% Ficoll 400, 0.02% polyvinylpyrrolidone, and 0.2% BSA), 10% dextran sulfate, 400 µg/ml yeast tRNA, 250 µg/ml salmon sperm DNA, and 20 mM DTT in diethyl pyrocarbonate-treated water. Sense or antisense riboprobes added at 400 ng/ml were hybridized for 4 h at 42°C. Posthybridization washes were in 2x SSC and 0.1% SDS at room temperature for 1 h and 40 min, followed by another wash with 0.1x SSC and 0.1% SDS for 20 min at room temperature. Probe binding was detected using a Fab fragment of anti-digoxigenin antibody and chromogen substrate solution (45 µl of nitroblue tetrazolium and 35 µl of 5-bromo-4-chloro-3-indolyl-phosphate solution in 10 ml of buffer 3 containing 10 mM Tris, 0.1 M NaCl, and 50 mM MgCl2 pH 9.5). The color reaction was for 1 h.

Analysis of in Situ Hybridization.
The sections were graded for intensity by three blinded observers using a semiquantitative scale (11 , 31) . Staining intensity was graded as 0 (no staining), 1 (light blue, faint staining), 2 (blue staining), 3 (moderate staining, purple color, 4 (strong, very deep purple), and 5 (dark black staining obscuring the architecture). The data did not fit a Poisson distribution and therefore were analyzed using nonparametric comparisons. Median scores were compared using Wilcoxon signed ranks or Mann-Whitney with an SSPS software package.

IHC.
IHC was performed on paraffin-embedded tissue sections from all tumors studied by ISH by methods described previously (11 , 31) . TIG {delta} C rabbit polyclonal antibody raised to recombinant TIG-his tag protein was used as the primary antibody at a dilution of 1:1000 and was detected with horse antirabbit secondary antibody at 1:100 using a Vector Stain ABC kit (Vector Labs, Burlingame, California). Preimmune rabbit serum (1:1000) was used as a negative control for TIG-3 antibody staining.5

QT-RT-PCR mRNA Analysis.
Total RNA was extracted from normal and tumor specimens (Table 2)Citation using Trizol reagent (Life Technologies, Inc., Gaithersburg, MD). Contaminating DNA was removed by DNase I treatment in 4 mM MgCl2 at 37°C for 30 min and then terminated at 72°C for 5 min. The PCR primers (45F-CAAGAGCCCAAACCTGGAG and 111R TATACAGGGCCCAGTGCTCAT) and fluorescent oligonucleotide probe (65T-CCTGATTGAGATTTTCCGCCTTGGC) for the TIG-3 QT-RT-PCR assay were designed from the published sequence, accession no. AR060228 (38) , using the Primer Express software (Perkin-Elmer). Primers were purchased from Integrative DNA Technologies (Coralville, IA). RNA samples (100 ng) were reverse transcribed with SuperScript reverse transcriptase (1 unit/µl; Boehringer Mannheim) in a 20-µl total volume reaction that included either Tig3 or 36B4 reverse primer (750 nM), 1x PCR buffer (Perkin-Elmer), 4 mM MgCl2, and 500 µM deoxynucleotide triphosphates. The 36B4 forward primer-AGATGCAGCAGATCCGCAT and reverse primer-ATATGAGGCAGCAGTTTCACCAG were used to amplify cDNA for 36B4 standard and detected with the probe-AGGCTGTGGTGCTGATGGGCAAGAAC. The reaction was incubated at 50°C for 30 min and then terminated by incubation at 72°C for 5 min. After reverse transcription, 1x PCR buffer, 4 mM MgCl2, 500 µM deoxynucleotide triphosphates, 300 nM forward and reverse primer, 100 nM fluorescent oligonucleotide probe, and Taq polymerase were added to make a final volume of 50 µl.

PCR was performed in an ABI 7700 Prizm Sequence Detector (Perkin-Elmer) with preheating at 95°C for 1 min, followed by 40 cycles of melting (95°C for 12 s) and annealing and extension (60°C for 60 s). Dequenching of the fluorescent hybridization probe was continuously monitored, and the Ct (PCR cycles to threshold) were calculated using Sequence Detector 1.6 software (Perkin-Elmer). Unknown RNA samples were analyzed in triplicate with a control that lacked reverse transcriptase (-RT control). Samples were run in parallel with 10-fold dilutions of mRNA from tumor line 22B HNSCC (Ref. 45 ; 600 ng to 600 pg) and assigned arbitrary number of molecules to generate a standard curve (Ct versus arbitrary RNA template molecules). The number of template molecules in the samples were calculated by interpolation of the Ct against the 22B HNSCC RNA standard curve. 36B4 mRNA was also measured by QT-RT-PCR and used to normalize as a standard, using the primers described previously (46) .


   RESULTS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
TIG-3 mRNA and Protein Is Expressed Highly in the Suprabasalar Epidermis and Adnexa of Normal Skin.
If TIG-3 acts as a tumor suppressor and controls normal epithelial differentiation, then it would be expressed in normal epidermis. The intensity of the antisense riboprobe staining was strongest by in situ hybridization throughout the epidermis, hair follicles, and sebaceous glands of normal control skin (Fig. 1Citation , A and B). In thinner epidermis of normal skin (Fig. 1Citation , A and G), all layers stained strongly with the antisense probe. The sense probe showed only faint background staining intensity (Fig. 1Citation C). Where the epidermis was thicker, staining intensity was more pronounced in the suprabasal layers than in the basal layers in normal skin (Fig. 1Citation B) and in hyperproliferative psoriatic epidermis (Fig. 1Citation , H and I).



View larger version (84K):
[in this window]
[in a new window]
  		Fig. 1. TIG-3 mRNA and protein levels are high in normal skin and reduced in psoriasis lesions. TIG-3 mRNA was detected in paraffin-embedded specimens of skin by ISH, using digoxigenin-labeled cRNA probes (Boehringer Mannheim) and antibody to digoxigenin (35 , 44) . TIG-3 immunoreactivity was assayed using a rabbit polyclonal antibody raised to recombinant TIG-3 protein at a dilution of 1:1000 and was detected by horse antirabbit secondary antibody with a Vector Stain ABC kit (Vector Laboratories, Burlingame, CA). A, normal skin specimen shows dense purple signal in epidermis, hair follicles, and sebaceous glands with antisense probe (x40). B, high power view of epidermis from normal skin specimen adjacent to tumor with ISH signal to antisense probe (x400). C, normal skin specimen by in situ hybridization to sense riboprobe as negative control (x100). D, normal skin from patient without skin cancer stained with antibody to TIG-3 protein (1:1000) detected with horse antirabbit IgG (1:100; x40). E, specimen in D at high magnification (x100). F, specimen in D stained with preimmune rabbit serum (1:1000) and detected with horse antirabbit secondary antibody (1:100) as negative control (x100). G, ISH of normal unaffected skin from a psoriasis patient before treatment with antisense riboprobe probe (x100). H, same patient’s psoriasis lesion at baseline, antisense probe (x100). I, psoriasis lesion from G at day 3 of Tazarotene application, antisense probe (x100).

 
Immunoreactive TIG-3 protein staining in the upper layers of normal skin (Fig. 1Citation , D and E) was similar to the pattern of the mRNA seen by in situ hybridization (Fig. 1Citation , A and B). TIG-3 protein was more restricted than the mRNA because it was most intense in the most well-differentiated layers of the normal suprabasal epidermis, just under the stratum corneum (Fig. 1Citation , D and E). The hair follicles, sebaceous glands, and small blood vessels of the dermis also stained prominently with TIG-3 antibody. The immunoreactivity was cytoplasmic in appearance in keratinocytes. Preimmune rabbit serum gave only background reactivity in normal skin (Fig. 1Citation F).

TIG-3 mRNA Expression Is Significantly Decreased in Psoriatic Epidermis Compared with Paired Normal, Uninvolved Skin.
Normal, uninvolved skin from psoriasis patients was similar in intensity and pattern of mRNA staining to normal controls without skin cancer in mRNA in situ hybridization intensity (Fig. 1Citation G). Psoriasis lesions prior to treatment (Fig. 1Citation H) were severalfold thicker than normal skin because of epidermal acanthosis and increased numbers of suprabasalar keratinocytes. The intensity of staining for TIG-3 antisense probe was reduced in the basal layers of psoriasis lesions (Fig. 1Citation H) compared with normal control skin (Fig. 1Citation G). As shown in Fig. 2Citation , normal, uninvolved paired skin from 30 psoriasis patients (median, 4.0) had significantly more intense TIG-3 antisense staining than the basal and suprabasal layers of psoriasis lesions (median, 3.0; P = 0.012, Wilcoxon signed ranks test). Suprabasal TIG-3 staining was more intense in paired, uninvolved normal skin specimens compared with baseline psoriasis lesions in 16 of 30 patients’ lesions examined, was less intense in 4, and did not differ by more than 1 degree in 10 patients.



View larger version (18K):
[in this window]
[in a new window]
  		Fig. 2. Median values of staining intensity of ISH antisense TIG-3 riborobes; normal skin is higher than psoriasis lesions and SCCs. Paired normal skin, psoriasis lesions, and tumors mRNA staining intensities were graded in the suprabasal epidermis or in the tumor using a semiquantitative scale of 0–5 with 0.5 increments: 0, no staining; 1, faint; 2, light; 3, moderate; 4, dark; and 5, most intense, black dense staining. Wilcoxon signed ranks of related or independent variables were performed on nonparametric data from each group. Comparisons are shown as standard box plots of each group: psoriasis patients’ normal skin (black hatch), and lesions at baseline (PsL0), after 3 days of Tazarotene (PsL3), and at day 14 of therapy (PsL14, white boxes) are at the left side. Skin cancer specimens of normal overlying skin (nl_over) and nonaggressive SCC (nl_nonaggr) are shown by gray hatched boxes in middle. All SCCs (Scc_all), aggressive SCCs (SCC_agg), and nonaggressive SCCs (SCC_nagg) are indicated at the right side with gray boxes. The black horizontal bars within the boxes represent the median values for ISH staining intensities. The X axis shows the number of specimens analyzed in each group. The Y-axis shows the intensity of mRNA staining intensity from 0 to 5. The boxes surrounding the medians indicate the values falling between the 25th and 75th percentiles. Ranges are shown by the vertical bars. Outliers, shown by circles, are included in calculation of the medians.

 
Pooled mRNA had been analyzed previously from lesions in this clinical study from the 15 responding patients who had >50% decrease in plaque elevation by 8 weeks (38) . In the responders, topical Tazarotene gel application was associated with increased levels of total TIG-3 mRNA transcripts as compared with untreated lesions by a quantitative assay (38) . In the analysis done by considering responding and nonresponding patients together, the median staining intensities after Tazarotene treatment for 3 or 14 days, as judged by ISH, were not significantly different from baseline (Fig. 2)Citation .

TIG-3 Expression Is Significantly Decreased in Both Basal and SCCs Compared with Adjacent and Overlying Normal Skin.
BCCs and SCCs studied by ISH were derived from sun-exposed areas (except one case) from subjects between 50 and 80 years of age (Table 1)Citation . All except 2 patients were males. SCCs of the skin were defined as aggressive if they were >2 cm in size, had neural invasion, and/or were metastatic to regional lymph nodes. Aggressive tumors studied extended into deeper structures including auricle, periauricular soft tissues, parotid glands, intraorbital nerves, scalp, nose, and intraparotid lymph nodes. As indicated in Table 1Citation , some tumors did not have paired overlying or adjacent skin available to study. Nonaggressive tumors were restricted to scalp and superficial facial tissues and were <2 cm in size.

We examined the median intensity of TIG-3 mRNA in situ staining comparing normal skin from psoriasis patients as well as overlying and adjacent paired normal skin from skin cancer patients to their tumors (Fig. 2)Citation . As shown in Figs. 2Citation 3Citation 4Citation , the median staining intensity of the TIG-3 antisense probe was decreased in BCCs, basosquamous carcinomas, and SCCss when compared with normal skin from psoriasis patients and from paired tumor patients. Psoriasis control normal skin and paired adjacent normal suprabasalar layers of skin had similar staining (median, 4.0). Both were significantly higher in TIG-3 mRNA staining than basal cell carcinomas (median, 1.33; P = 0.045, Mann-Whitney; n = 6). BCCs studied by ISH showed reduction in TIG-3 mRNA staining in the tumor that was similar to the normal overlying basal cell layer (Fig. 3Citation A). IHC staining intensity in the suprabasal layer of adjacent skin (Fig. 3Citation B) was higher than in the basal layer of normal skin and in basal cell carcinomas shown in Fig. 3Citation , D and E. Normal skin showed no specific reactivity with preimmune serum and secondary antibody (Fig. 3Citation C).



View larger version (163K):
[in this window]
[in a new window]
  		Fig. 3. TIG-3 staining is higher in suprabasalar normal skin than in BCCs. A, BCC with overlying skin studied by ISH, as described in Fig. 1Citation , using antisense riboprobe (x100). B, normal skin adjacent to BCE showing TIG-3 protein by IHC, as in A, in epidermis and dermal vessels (x40). C, same section as B, with preimmune serum as negative control (x40). D, diffuse BCC in dermis stained with antibody to TIG-3 (x100). E, well-demarcated nodule of BCE with adjacent normal skin stained with TIG-3 antibody (x100).

 


View larger version (97K):
[in this window]
[in a new window]
  		Fig. 4. Expression of TIG-3 mRNA by ISH and protein by IHC is reduced in paired adjacent and overlying normal skin compared with SCCs. Specimens were studied as in Fig. 1Citation by either ISH or IHC. A, moderately well-differentiated, aggressive SCC in dermis with normal overlying skin by ISH (x40). B, moderately well-differentiated, aggressive SCC (34065) in dermis with normal overlying skin by ISH (x40). C, same tumor B by IHC with normal epidermis to left, perpendicular to the base of photo and tumor nodules to the left (x40). D, moderately well-differentiated aggressive SCC (38303) from face studied by ISH. Tumor is throughout the dermis with pseudoepithelomatous hyperplasia in overlying normal skin (x40). E, poorly differentiated aggressive SCC (38787) of the infraorbital area studied by ISH. Overlying skin shows decreased TIG-3 and pseudoepithelomatous hyperplasia (x40). F, same tumor as in E by IHC (x40). G, moderately well-differentiated aggressive SCC (412288) by ISH shows normal adjacent skin to left, take off point to tumor (middle) and tumor mass (left; x40). H, same patient, SCC in dermis by ISH. Keratin pearls are present in dermis (x40). I, same patient with BCC next to normal epidermis and hair follicle (left) by ISH (x40). J, same section by IHC with TIG-3 antibody (x40). K, ISH of normal adjacent skin with hair follicle in patient with tumor (39845) that is shown in L–N (x40). L, ISH of normal overlying skin and moderately well-differentiated SCC (39845; x40). M, same tumor by ISH (x40) showing normal adjacent skin (left) and point of tumor origin middle (x40). N, same tumor section as M, by IHC (x40).

 
The staining intensity of the TIG-3 antisense riboprobe by ISH was also significantly higher in normal skin specimens from all sources, compared with all SCCs as a group. As shown in Fig. 2Citation , TIG-3 mRNA staining was stronger in normal skin from psoriasis controls (median, 4.0; P = 0.001), in normal skin overlying SCCs (median, 3.0; P = 0.0001), and in the adjacent skin to SCCs (median, 3.0; P = 0.007) compared with staining intensity in 21 aggressive and nonaggressive SCC specimens as a group (median, 1.5). Examples of aggressive SCCs shown in Fig. 4Citation had either overlying or adjacent normal skin. Aggressive SCCs were >2 cm and had neural invasion or metastasis to parotid gland or regional lymph nodes. For this reason, they were not always available with normal adjacent or overlying skin (Table 1)Citation .

All SCC specimens were studied both by ISH and by IHC. There is reduced TIG-3 mRNA signal in SCC tumors compared with overlying normal skin with higher expression in adjacent skin. All tumors showed correlation in the levels of mRNA staining and TIG-3 protein reactivity. (Examples of specimens studied by both techniques are found in Fig. 4Citation , B and C, E and F, I and J, M and N). We did not quantitate the IHC staining but found it to be at least 2-fold or greater in the suprabasal epidermis than in tumor specimens. The most highly differentiated areas of keratin pearls were highest in both TIG-3 mRNA and protein (Fig. 4Citation , H, M, and N).

The variation in staining intensities found in normal skin overlying both aggressive and nonaggressive SCC tumors, from which the tumors arose, was greater than the variation seen in normal control skin as well as in adjacent skin (Fig. 2)Citation . Fig. 4Citation shows examples of overlying normal skin with high TIG-3 (B and D), moderate TIG-3 (A), and low TIG-3 (E, L) mRNA staining. Pseudoepitheliomatous hyperplasia found in two tumors (D and E) could be either high or low in staining intensity. Adjacent skin at a distance from tumors (Fig. 4Citation , G, I, and K) showed very strong TIG-3 mRNA and protein staining as a rule, but the intensity was decreased at the site where tumors arose (Fig. 4Citation , G–J and K–N). The mRNA and protein staining patterns were similar, as shown.

TIG-3 Expression Is Less in Aggressive SCCs Compared with Nonaggressive SCC Tumors.
The median staining intensity in 11 aggressive SCCs (median, 1.0) was also decreased compared with 10 nonaggressive SCCs (median, 1.5; P = 0.038, Mann-Whitney; Fig. 2Citation ). Ten of 11 aggressive SCC versus 7 of 10 nonaggressive SCCs showed decreased TIG-3 mRNA ISH signals compared with paired normal skin. All tumors studied showed reduced TIG-3 mRNA and protein staining compared with normal control donor skin specimens. Three aggressive SCCs and a metastatic SCC lesion to the lymph node had no staining present for TIG-3 mRNA, suggesting that complete loss of gene expression may have occurred. In three nonaggressive SCCs, overlying skin and tumor were similarly both reduced (compared with normal skin). Two of these three tumors were interpreted by the pathologist as well-differentiated, and the third was poorly differentiated.

Development of QT-RT-PCR Assay to Measure TIG-3 mRNA Transcripts.
A quantitative fluorescent real time QT-RT-PCR assay (47) was developed to measure TIG-3 mRNA transcripts in paired patient specimens (Table 2)Citation . The cDNA for 36B4, encoding a ribosomal protein, was used to normalize levels of TIG-3 mRNA, expressed as a ratio. Levels of TIG-3 mRNA transcripts were determined from two samples of normal, non-sun-exposed abdominal skin from patients without cancer and from 7 skin tumors with paired adjacent skin specimens taken at the time of Moh’s surgery (Table 2Citation ; Fig. 5Citation ).TIG-3 mRNA levels from triplicate samples of reverse-transcribed mRNA were normalized to 36B4. Two specimens from normal abdomen skin of patients without skin cancer (Fig. 5Citation , A and B) were similar and showed highest TIG-3 mRNA levels, similar to the levels measured in HaCat keratinocytes (not shown). High levels of TIG-3 mRNA were also found in one very well-differentiated SCC (patient 2) and in a lichenoid actinic keratosis with epidermal acanthosis (patient 4). A small, well-localized BCE on the infraorbital cheek had reduced TIG-3 transcripts compared with the normal adjacent skin specimen (patient 5). Similar to the in situ findings, three patients had low TIG-3 levels in both tumor and adjacent normal skin. Patient 7, with lowest TIG-3 in normal adjacent skin, also had multiple facial basal cell carcinoma occurring in the setting of severe, extensive photodamage over the whole area.



View larger version (14K):
[in this window]
[in a new window]
  		Fig. 5. QT-RT-PCR measurement of TIG-3 mRNA transcripts in normal skin and tumor specimens. Total RNA was prepared from fresh skin samples from tumor and paired normal skin taken from surgery cases (Table 2)Citation . One hundred ng of mRNA were reverse transcribed with reverse transcriptase. Triplicates were subjected to PCR using forward and reverse primers with a fluorogenic primer. The release of the fluorescence by 5' nuclease activity was measured in real time using an ABI 7700 prism sequence detector. TIG-3 signals were normalized against the standard 36B4, and the graphs represent the ratios. Columns A and B, TIG-3 mRNA levels from normal abdominal skin taken from surgery in two older patients without skin cancer. Paired normal and tumor samples were compared from seven patients undergoing surgery in Table 2Citation . Normalized values for TIG-3: {blacksquare}, in normal skin; and in tumors.

 

   DISCUSSION
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
TIG-3 (RANTES-3) is a newly described, retinoid-inducible putative tumor suppressor that was isolated from Tazarotene-treated keratinocytes. TIG-3 has been shown to inhibit cellular proliferation when expressed and is associated with retinoid responsiveness in malignant cell lines in vitro (38) . This study shows for the first time that TIG-3 mRNA and protein expression are significantly reduced in basal and SCCs arising from sun-exposed skin, compared with normal skin. Lower TIG-3 mRNA and loss of expression are seen in aggressive SCCs compared with nonaggressive SCCs in this study.

The highest levels of TIG-3 mRNA by ISH and TIG-3 protein by IHC are found within the normal suprabasal epidermis, hair follicles, and sebaceous glands. TIG-3 in normal skin may be, therefore, associated with terminal keratinocyte differentiation and growth arrest occurring in the suprabasal layers. In hyperproliferative epidermis, as in psoriasis lesions and overlying SCCs, TIG-3 mRNA by ISH and protein by IHC are reduced relative to skin of normal thickness.

Treatment of hyperproliferative psoriasis lesions with topical Tazarotene gel induces 4-fold increased expression of TIG-3 mRNA in epidermis of responding patients compared with pretreatment levels (38) . In psoriasis lesions, inflammation is present that affects epidermal differentiation, and the skin is able to normalize after topical retinoid therapy (28 , 33) . Up-regulation of TIG-3 expression may be part of the normalization process, and low TIG-3 expression may contribute to the increased rate of epidermal proliferation that characterizes psoriasis (48) .

Recently, topical Tazarotene gel treatment has also been shown to induce clinical remission of 47% of basal cell carcinomas treated over a period of months (34) . Whereas loss of TIG-3 may be an important event leading to skin cancer, expression of TIG-3 in suprabasalar epidermis may help to regulate normal terminal differentiation. TIG-3 mRNA levels are highest in normal skin and differed significantly between nonaggressive and aggressive SCCs. Therefore, with further investigation, TIG-3 may become the first molecular marker of aggressiveness and of retinoid action during treatment or chemoprevention studies. These new data support the rational of using retinoids for both prevention and treatment of skin cancer.

TIG-3 is homologous to a class II tumor suppressor found in H-ras revertant lines, H-rev 107 (40 , 49) . TIG-3 mapped to chromosome 11q23, which has long been hypothesized to contain a tumor suppressor (38) . This region has shown loss of heterozygosity and poor prognosis in cancers of the head and neck, melanoma, cervix, breast, lung, and ovarian malignancies and also leukemias, lymphomas, and rhabdomyosarcomas (38 , 42 , 43 , 50, 51, 52, 53, 54) . With respect to head and neck tumors, 25% showed loss of heterozygosity at 11q23 with a significant association with persistent or recurrent disease after radiation (55) . The expression of TIG-3 mRNA in most aggressive SCC tumors is reduced by at least 50% compared with paired specimens of adjacent or overlying normal skin by in situ hybridization studies, suggesting that loss of heterozygosity may be present. All 11 aggressive SCC tumors have markedly reduced TIG-3 expression levels compared with overlying or adjacent normal skin. In three aggressive skin tumors, one a metastasis to node, TIG-3 mRNA expression is absent. Loss of TIG-3 protein in aggressive SCC is also confirmed by IHC. Analysis of the TIG-3 promoter, coding sequences, and gene sequences will be required to understand the basis of this finding.

Loss of heterozygosity in tumors reflects deletion of a large portion of the genomic DNA containing one allele and should be associated with a 50% reduction of the mRNA transcripts. Complete inactivation of a tumor suppressor requires that the second allele also acquire a second mutation within the tumor tissue. It is possible that inactivation of both copies of TIG-3 may be associated with the development of more aggressive skin cancers, and this would agree with studies demonstrating loss of chromosome 11q23 in head and neck SCCs (55) . In contrast, mutations may be subtle and may arise without consistently altering mRNA levels (56) . Loss of TIG-3 expression may also result from mutations or small deletions in the retinoid response elements (38) or hypermethylation of the gene’s promoter. More direct measures of mRNA levels, such as the QT-RT-PCR assay we report, and sequence information are ultimately required to understand the importance of tumor suppressors in carcinogenesis. ISH localized mRNA expression within tumor specimens, but it is only semiquantitative.

Basal cell carcinomas, generally nonaggressive, localized tumors arising from differentiated hair follicle keratinocytes, express levels of TIG-3 similar to the basal layer of normal epidermis. In keeping with the hypothesis that TIG-3 is a tumor suppressor, basal layers have less TIG-3 mRNA and protein than more differentiated epidermal layers. A quantitative, sensitive QT-RT-PCR assay was developed to measure TIG-3 transcripts within specimens. By this assay, normalized TIG-3 mRNA levels are 2–4-fold higher in normal non-sun-exposed skin from controls without cancer than in normal skin adjacent to three basal cell carcinomas and one SCC. One BCE and one SCC showed only slightly lower levels, and one very well-differentiated, nonaggressive SCC was 3-fold increased in tumor compared with normal skin. In these studies, there was no opportunity to study mRNA transcripts in aggressive SCCs and no mechanism to control for the relative amount of tumor and normal skin contributing material to total mRNA transcript pools. Microdissection may be required to dissociate tumor specimen from normal skin. Increased TIG-3 mRNA levels may be measured from a large tumor mass, even if the relative levels are low, in comparison with normal skin.

Overlying normal skin has more variable expression of TIG-3 compared with adjacent skin specimens; therefore, we also used normal skin specimens from psoriasis patients as controls. Skin overlying tumors may have low TIG-3 mRNA by ISH and low protein by IHC. In some SCCs where the point of tumor origin was present, the normal skin at the tumor origin has low TIG-3 staining. These observations, although preliminary, do suggest that loss of TIG-3 in normal skin may be associated with the development of SCC tumors. The QT-RT-PCR assay showed that TIG-3 mRNA transcripts are low in both the perilesional photodamaged skin and in several basal cell carcinomas. One patient with SCC had low TIG-3 mRNA both in normal skin and tumor by QT-RT-PCR. If TIG-3 is lost or reduced in overlying normal skin, there could be a field effect, as reported for loss of p53 both in sun-damaged skin and resulting tumors (57 , 58) . Mutations in p53 are reported in 90% of SCCs and 50% of basal cell carcinomas and result from UV light-induced pyrimidine-cytosine photoproducts (57) . Whether these types of changes and this kind of frequency will also be found in skin cancers with respect to TIG-3 is not yet determined.

Heterogeneity of mRNA expression is present in some tumors, especially when there was mixed differentiation. This was confirmed using IHC showing high TIG-3 within areas of keratinization (keratin pearl formation). Heterogeneity in TIG-3 expression and ability to be induced by retinoid treatment might help to explain the clinical heterogeneity in response to retinoids.

It is well known that retinoids may prevent or retard the growth of some SCCs, although the mechanisms are not well established (27 , 59 , 60) . Whereas loss of heterozygosity at the chromosome 11q23 region has been found in 25% of recurrent SCCs of the head and neck, no specific gene has been implicated until now (55) . On the basis of these new data, TIG-3 is a lead candidate tumor suppressor explaining loss of heterozygosity at this locus. Irreversible loss or decrease in TIG-3 mRNA and protein in SCCs may be associated with more aggressive tumors, loss of retinoid response, and ultimately tumor progression or invasion. Mutations in TIG-3 that alter its function could also occur without influencing the mRNA levels. It should be noted that the expression of TIG-3 is significantly lower in aggressive compared with nonaggressive SCCs, unlike DNA repair or p53 mutations (58 , 61) . TIG-3 is thus a possible biomarker for distinguishing between nonaggressive and aggressive biological behavior. Further studies involving the regulation of TIG-3 by retinoids and elucidating the structure of the TIG-3 protein and the identification of key functional mutations will be important to understand the role of TIG-3 in squamous carcinogenesis and epidermal differentiation.


   ACKNOWLEDGMENTS
 
We acknowledge the participation of Dr. Margaret Kripke, Dr. Sarah Strom Lori Buschman, Dr. Adan El-Nagaar, Dr. Stephen Mays, Dr. Kendra Woods, and Annette Basey in obtaining and/or processing the clinic specimens and lines for analysis. Dr. Peter Davies, Department of Integrative Biology, University of Texas Medical School, was responsible for the creation of the QT-RT-PCR assay.


   FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported in part by a clinical research grant from Allergan, by the Dermatology Foundation as a Fellowship sponsored by Ortho Dermatological (to C. S.), and an American Society for Dermatologic Surgery Dermatology Foundation Grant (to B. J.); by the NIH Grants PO1-CA16672-22 (to M. D., G. C., S. L.), R21-CA74117 (to B. H. and M. D.), the M. D. Anderson Cancer Center Core Grant CA16672, and The M. D. Anderson Skin Cancer Research Fund. This work was presented in part at the SID Meeting, Chicago, Illinois, May 5–8, 1999. Back

2 To whom requests for reprints should be addressed, at Section of Dermatology, Box 28, M. D. Anderson Cancer Center, Houston, Texas 77030. Phone: (713) 745-1113; Fax: (713) 745-3597; E-mail: mduvic{at}mdanderson.org Back

3 The abbreviations used are: SCC, squamous cell carcinoma; RAR, retinoic acid receptor; BCC, basal cell carcinoma; ISH, in situ hybridization; TIG, Tazarotene-induced gene; QT-RT-PCR, quantitative real-time PCR; BCE, basal cell epithelioma; IHC, immunohistochemistry. Back

4 C. Schulz et al., manuscript in preparation. Back

5 R. L. Eckert, N. A. Robinson, and A. Deucher, manuscript in preparation. Back

Received 9/ 3/99; revised 4/25/00; accepted 5/ 4/00.


   REFERENCES
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Stoler A., Kopan R., Duvic M., Fuchs E. The use of monospecific antisera and cRNA probes to localize the major changes in keratin expression during normal and abnormal epidermal differentiation. J. Cell Biol., 107: 427-446, 1988.[Abstract/Free Full Text]
  2. Eckert R. L., Crish J. F., Banks E. B., Welter J. F. The epidermis: genes on, genes off. J. Investig. Dermatol., 109: 501-509, 1997.[CrossRef][Medline]
  3. Kanjali, S., and Duvic, M. Cutaneous carcinogenesis: molecular model of cancer development. In: S. Miller (ed.), Cutaneous Oncology. Cambridge: Blackwell Scientific Publications, Inc., 1998.
  4. Ziegler A., Leffel D. F., Kunala S., Sharma H., Gailani M., Simon J. A., Halperin A. J., Baden H. P., Shapiro P. E., Bale A. E., Brash D. E. Mutation hotspots due to sunlight in the p53 gene of non-melanoma skin cancer. Proc. Natl. Acad. Sci. USA, 90: 4216-4220, 1993.[Abstract/Free Full Text]
  5. Glick A. B., Sporn M. B., Yuspa S. H. Altered regulation of TGF-B1 and TGF-{alpha} in primary keratinocytes and papillomas expressing v-Ha-ras. Mol. Carcinog., 4: 210-219, 1991.[Medline]
  6. Gailini M. R., Bale S. J., Leffell D. J., DiGiovanna J. J., Peck G. L., Poliak S., Drum M. A., Pastakia B., McBride O. W., Kase R., et al Developmental defects in Gorlin syndrome related to a putative tumor suppressor gene on chromosome 9. Cell, 69: 111-117, 1992.[CrossRef][Medline]
  7. Ananthaswamy H. N., Loughlin S. M., Cox P., Evans R. L., Ullrich S. E., Kripke M. L. Sunlight and skin cancer: inhibition of p53 mutations in UV-irradiated mouse skin by sunscreens. Nat. Med., 3: 510-514, 1997.[CrossRef][Medline]
  8. Quinn A. G., Campbell C., Healy E., Rees J. L. Chromosome 9 allele loss occurs in both basal and squamous cell carcinomas of the skin. J. Investig. Dermatol., 102: 300-303, 1994.[CrossRef][Medline]
  9. Wiching C., Shanley S., Smyth I., Gillies S., Negus K., Graham S., Suthers G., Haites N., Edwards M., Wainwright B., Chenevix-Trench G. Most germ-line mutations in the nevoid basal cell carcinoma syndrome lead to a premature termination of the PATCHED protein, and no genotype-phenotype correlations are evident. Am. J. Hum. Genet., 60: 21-26, 1997.[Medline]
  10. Scott R. E., Wilke M. S., Wille J. J., Pittelkow M. R., Hsu B. M., Kasperbauer J. L. Human squamous carcinoma cells express complex defects in the control of proliferation and differentiation. Am. J. Pathol., 133: 374-380, 1988.[Abstract]
  11. Duvic M., Chema D., Annarella M., Cho M., Esgleyes-Ribot T., Remenyik E., Ulmer R., Rapini R., Sacks P. G., Clayman G. L., Davies P. J. A., Thacher S. Keratinocyte transglutaminase expression varies in squamous cell carcinomas. J. Investig. Dermatol., 102: 462-469, 1994.[CrossRef][Medline]
  12. Alkemade H. A. C., Molhuizen H. O. F., Vlijmen-Wilems M. J. J., Haelst U. J. G. M., Schalkwijk J. Differential expression of SKALP/elafin in human epidermal tumors. Am. J. Pathol., 143: 1679-1687, 1993.[Abstract]
  13. Baker B. S., Fry L. The immunology of psoriasis. Br. J. Dermatol., 126: 1-9, 1992.[CrossRef]
  14. Aneskievich B. J., Fuchs E. Terminal differentiation in keratinocytes involves positive and negative regulation by retinoic acid receptors and retinoid X receptors at retinoid response elements. Mol. Cell. Biol., 12: 4862-4871, 1992.[Abstract/Free Full Text]
  15. Kliewer S. A., Umesono K., Mangelsdorf D. J., Evans R. M. Retinoid receptor X interacts with nuclear receptors in retinoic acid, thyroid hormone, and vitamin D3 signalling. Nature (Lond.), 355: 446-449, 1992.[CrossRef][Medline]
  16. Chambon P. The molecular and genetic dissection of the retinoid signaling pathway. Recent Prog. Horm. Res., 50: 317-332, 1995.
  17. Elder J. T., Astrom A., Pettersson U., Tavakkol A., Griffiths C. E. M., Krust A., Kastner P., Chambon P., Voorhees J. J. Differential regulation of retinoic acid receptors and binding proteins in human skin. J. Investig. Dermatol., 98: 673-679, 1992.[CrossRef][Medline]
  18. Chakravarti D., LaMorte V. J., Nelson M. C., Nakajima T., Schulman I. G., Juguilon H., Montminy M., Evans R. M. Role of CBP/P300 in nuclear receptor signalling. Nature (Lond.), 383: 99-102, 1996.[CrossRef][Medline]
  19. Nagpal S., Athanikar J., Chandraratna R. A. S. Separation of transactivation and AP1 antagonism functions of retinoic acid receptor {alpha}. J. Biol. Chem., 270: 923-927, 1995.[Abstract/Free Full Text]
  20. Saiki R. K., Scharf S., Faloona F., Mullis K. B., Horn G. T., Erlich H. A., Arnheim N. Enzymatic amplification of ß-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science (Washington DC), 230: 1350-1354, 1985.[Abstract/Free Full Text]
  21. DiSepio D., Malhotra M., Chandraratna R. A. S., Nagpal S. Retinoic acid receptor nuclear-factor interleukin 6 antagonism: a novel mechanism of retinoid dependent inhibition of a keratinocyte hyperproliferative differentiation marker. J. Biol. Chem., 272: 25555-25559, 1997.[Abstract/Free Full Text]
  22. Seitz C. S., Lin Q., Deng H., Khavari P. A. Alterations in NF-{kappa}B function in transgenic epithelial tissue demonstrate a growth inhibitory role for NF-{kappa}B. Proc. Natl. Acad. Sci. USA, 95: 2307-2313, 1998.[Abstract/Free Full Text]
  23. Eichner R., Kahn M., Capetola R. J., Gendimenico G. J., Mezick J. A. Effects of topical retinoids on cytoskeletal proteins: implications for retinoid effects on epidermal differentiation. J. Investig. Dermatol., 98: 154-161, 1992.[CrossRef][Medline]
  24. Gunther S. The therapeutic value of retinoic acid in chronic, acute, guttate, and erythrodermic psoriasis. Dermatology, 89: 515-517, 1973.
  25. Ellis C. N., Voorhees J. J. Etretinate therapy. J. Am. Acad. Dermatol., 16: 267-291, 1987.[Medline]
  26. Ranki A., Lauharanta J., Keanerva L. Effect of etretinate on the distribution of Langerhans cells and T lymphocytes in psoriatic skin. Arch. Dermatol. Res., 276: 102-104, 1984.[CrossRef][Medline]
  27. Lippman S. M., Lotan R., Clayman G. L. Systemic prevention and treatment of skin cancer Weber R. S. Miller M. J. Goepfert H. eds. . Basal and Squamous Skin Cancers of the Head and Neck, : 351-355, Williams and Wilkins Baltimore 1996.
  28. Duvic M., Nagpal S., Asano A., Chandraratna R. A. S. Molecular mechanisms of Tazarotene action. J. Am. Acad. Dermatol., 37: 85-92, 1997.[CrossRef][Medline]
  29. Weinstein G., Krueger G. G., Lowe N. J., Duvic M., Friedman D. J., Jegasothy B. V., Shmunes E., Tschen E. H., Lew-Kaya D., Lue J. C., Sefton J., Gibson J. R., Chandraratna R. A. S. Tazarotene gel, a new retinoid, for topical therapy of psoriasis. Vehicle-controlled study of safety, efficacy, and duration of therapeutic effect. J. Am. Acad. Dermatol., 37: 85-92, 1997.
  30. Duvic M. The pharmacologic profile of Tazarotene. Cutis, 61: 22-26, 1998.[Medline]
  31. Esgleyes-Ribot T., Chandraratna R. A., Lew-Kaya D. A., Sefton J., Duvic M. Response of psoriasis to a new topical retinoid, AGN 190168. J. Am. Acad. Dermatol., 30: 581-590, 1994.[Medline]
  32. Thacher S. M., Krasinski G., Malhotra M., Duvic M., Nagpal S., Chandraratna R. A. S. Coordinate regulation of keratinocyte differentiation markers by retinoids in cell culture and in psoriasis. J. Investig. Dermatol., 106: 819, 82 1996.
  33. Duvic M., Asano A. T., Hager C., Mays S. The pathogenesis of psoriasis and mechanism of action of Tazarotene. J. Am. Acad. Dermatol., 39: S126-S129, 1998.
  34. Peris K., Fargnoli M. C., Chimenti S. Preliminary observations on the use of topical Tazarotene to treat basal-cell carcinoma. N. Engl. J. Med., 341: 1767-1768, 1999.[Free Full Text]
  35. Nagpal S., Patel S., Asano A. T., Johnson A. T., Duvic M., Chandraratna R. A. S. Tazarotene-induced gene 1 (TIG1), a novel retinoic acid receptor-responsive gene in skin. J. Investig. Dermatol., 106: 269-274, 1996.[CrossRef][Medline]
  36. Nagpal S., Patel S., Jacobe H., DiSepio D., Ghosn C., Malhotra M., Teng M., Duvic M., Chandraratna R. A. S. Tazarotene-induced gene 2 (TIG-2), a novel retinoid responsive gene in skin. J. Investig. Dermatol., 109: 91-95, 1997.[CrossRef][Medline]
  37. Nagpal S., Thacher S. M., Patel S., Friant S., Malhotra M., Shafer J., Krasinski G., Asano R. T., Teng M., Duvic M., Chandraratna R. A. S. Negative regulation of two hyperproliferative keratinocyte differentiation markers by an RAR-selective retinoid: insight into the mechanism of retinoid action in psoriasis. Cell Growth Differentiation, 7: 1783-1791, 1996.[Abstract]
  38. DiSepio D., Ghosn C., Eckert R. L., Deucher A., Robinson N., Duvic M., Chandraratna R. A. S., Nagpal S. Identification and characterization of a retinoid-inducible class II tumor suppressor/anti-proliferative gene. Proc. Natl. Acad. Sci. USA, 95: 14811-14815, 1998.[Abstract/Free Full Text]
  39. Hajnal A., Klemenz R., Schafer R. Subtraction cloning of H-rev107, a gene specifically expressed in H-ras resistant fibroblasts. Oncogene, 9: 419-490, 1994.
  40. Szpiere C., Szpiere J., Riviere M., Hajnal A., Kiess M., Scharm B., Schafer R. Chromosomal assignment of three rat and human H-rev genes, putative tumor suppressors, down-regulated in malignantly HRAS-transformed cells. Mamm. Genome, 7: 701-793, 1996.[CrossRef][Medline]
  41. Kuchinke W., Hart R. P., Jonakait G. M. Identification of mRNAs regulated by interferon-{gamma} in cultured rat astrocytes by PCR differential display. Neuroimmunomodulation, 2: 347-355, 1995.[Medline]
  42. di Iasio M. G., Calin G., Tibiltti M. G., Vorchovsky I., Benediktsson K. P., Taramelli R., Barbanti-Brodano G., Negrini M. Refinement of the LOH region 1 at 11q23.1 deleted in human breast carcinomas and sublocalization of 11 expressed sequence tags within the refined region. Oncogene, 18: 1635-1638, 1999.[CrossRef][Medline]
  43. Murakami Y., Nobukuni T., Tamura K., Maruyama T., Sekiya T., Arai Y., Gomyou H., Tanigami A., Ohki M., Cabin D., Frischmyer P., Hunt P., Reeves R. H. Localization of tumor suppressor activity important in non-small cell lung carcinoma on chromosome 11q. Proc. Natl. Acad. Sci. USA, 95: 8153-8157, 1998.[Abstract/Free Full Text]
  44. Xu X. C., Clifford J. L., Hong W. K., Lotan J. R. Detection of nuclear retinoic acid receptor mRNAs in histological tissue sections using non-radioactive in situ hybridization histochemistry. Diagn. Mol. Pathol., 3: 122-131, 1994.[Medline]
  45. Carey, T. Head and neck tumor cell lines. In: Atlas of Human Tumor Cell Lines, pp. 79–120. New York: Academic Press, Inc., 1994.
  46. Ritter S. J., Davies P. J. A. Identification of a TGF-B1/BMP4 response element within the mouse tissue transglutaminase gene promoter. J. Biol. Chem., 273: 12798-12806, 1998.[Abstract/Free Full Text]
  47. Gibson U. E. M., Heid C. A., Williams P. M. A novel method for real time quantitative RT-PCR. Genome Res., 6: 995-1001, 1996.[Abstract/Free Full Text]
  48. Greaves M. W., Weinstein G. D. Treatment of psoriasis. N. Engl. J. Med., 332: 581-588, 1995.[Free Full Text]
  49. Husman K., Sers C., Fietze E., Mincheva A., Lichter P., Schafer R. Transcription and translational down-regulation of H-Rev-107, a class II tumour suppressor gene located on human chromosome 11q11–12. Oncogene, 17: 1305-1312, 1998.[CrossRef][Medline]
  50. Herbst R. A., Gutzmer R., Matiaske F., Mommert S., Casper U., Kapp A., Weiss J. Identification of two distinct deletion targets at 11q23 in cutaneous malignant melanoma. Int. J. Cancer, 80: 205-209, 1999.[CrossRef][Medline]
  51. Hampton G. M., Mannerman A., Winquist R., Alavaikko M., Blanco G., Taskinen P. J., Kiviniemi H., Newsham I., Cavenee W. K., Evans G. A. Loss of heterozygosity in sporadic human breast carcinoma: a common region between 11q22 and 11q23.3. Cancer Res., 54: 4586-4589, 1994.[Abstract/Free Full Text]
  52. Gabra H., Watson J. E., Taylor K. J., Mackay J., Leonard R. C., Steel C. M., Porteous D. J., Smyth J. F. Definition and refinement of a region of loss of heterozygosity at 11q23.3-q24.3 in epithelial ovarian cancer associated with poor prognosis. Cancer Res., 56: 950-954, 1996.[Abstract/Free Full Text]
  53. Bethwaite P. B., Koreth J., Herrington C. S., McGee J. O. Loss of heterozygosity occurs at the D11S29 locus on chromosome 11q23 in invasive cervical carcinoma. Br. J. Cancer, 71: 814-818, 1995.[Medline]
  54. Launonen V., Stenboack F., Pusitola U., Bloigu R., Huusko P., Kytola S., Kauppila A., Winquist R. Chromosome 11q22.3–q25 LOH in ovarian cancer: association with a more aggressive disease course and involved subregions. Gynecol. Oncol., 71: 299-304, 1998.[CrossRef][Medline]
  55. Lazar A. D., Winter M. R., Nogueira C. P., Larson P. S., Finnemore E. N., Dolan R. W., Fulcihan N., Chakravarti A., Zietman A., Rosenberg C. L. Loss of heterogeneity at 11q23 in squamous cell carcinoma of the head and neck is associated with recurrent disease. Clin. Cancer Res., 4: 2787-2793, 1998.[Abstract]
  56. Weinberg R. A. Tumor suppressor genes. Science (Washington DC), 254: 1138-1146, 1991.[Abstract/Free Full Text]
  57. Brash D. E., Ziegler A., Jonason A. S., Simon J. A., Kunala S., Leffell D. J. Sunlight and sunburn in human skin cancer: p53, apoptosis, and tumor promotion. J. Investig. Dermatol. Symp. Proc., 1: 136-142, 1996.[Medline]
  58. Kanjilal S., Strom S., Clayman G. L., Weber R. S., El-Naggar A. K., Kapur V., Cummings K. K., Hill L. A., Spitz M. R., Kripke M. L., Ananthaswamy H. N. p53 mutations in non-melanoma skin cancer of the head and neck: molecular evidence for field cancerization. Cancer Res., 55: 3604-3609, 1995.[Abstract/Free Full Text]
  59. Kraemer K. H., DiGiovanna J. J., Moshell A. N., Tarone R. E., Peck G. L. Prevention of skin cancer in xeroderma pigmentosum with the use of oral isotretinoin. N. Engl. J. Med., 318: 1633-1637, 1988.[Abstract]
  60. Lippman S. M., Meyskens F. L. Results of the use of vitamin A and retinoids in cutaneous malignancies. Pharmacol. Ther., 40: 107-122, 1989.[CrossRef][Medline]
  61. Wei A., Cheng L., Wang L., Guo Z., Strom S. S., Spitz M. R., Lippman S. M., Duvic M., Kripke M. L. Role of DNA repair for UV damage in non-melanoma skin cancer progression. Proc. Am. Assoc. Cancer Res., 39: 477 1998.



This article has been cited by other articles:


Home page
 CarcinogenesisHome page
C.-C. Ou, S.-C. Hsu, Y.-H. Hsieh, W.-L. Tsou, T.-C. Chuang, J.-Y. Liu, and M.-C. Kao
Downregulation of HER2 by RIG1 involves the PI3K/Akt pathway in ovarian cancer cells
Carcinogenesis, February 1, 2008; 29(2): 299 - 306.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
I. Nazarenko, R. Schafer, and C. Sers
Mechanisms of the HRSL3 tumor suppressor function in ovarian carcinoma cells
J. Cell Sci., April 15, 2007; 120(8): 1393 - 1404.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J. A. Mack, L. Li, N. Sato, V. C. Hascall, and E. V. Maytin
Hoxb13 Up-regulates Transglutaminase Activity and Drives Terminal Differentiation in an Epidermal Organotypic Model
J. Biol. Chem., August 19, 2005; 280(33): 29904 - 29911.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
P. Hazarika, M. F. McCarty, V. G. Prieto, S. George, D. Babu, D. Koul, M. Bar-Eli, and M. Duvic
Up-regulation of Flotillin-2 Is Associated with Melanoma Progression and Modulates Expression of the Thrombin Receptor Protease Activated Receptor 1
Cancer Res., October 15, 2004; 64(20): 7361 - 7369.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
P.-L. So, K. Lee, J. Hebert, P. Walker, Y. Lu, J. Hwang, L. Kopelovich, M. Athar, D. Bickers, M. Aszterbaum, et al.
Topical Tazarotene Chemoprevention Reduces Basal Cell Carcinoma Number and Size in Ptch1+/- Mice Exposed to Ultraviolet or Ionizing Radiation
Cancer Res., July 1, 2004; 64(13): 4385 - 4389.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. T. Sturniolo, S. R. Dashti, A. Deucher, E. A. Rorke, A.-M. Broome, R. A. S. Chandraratna, T. Keepers, and R. L. Eckert
A Novel Tumor Suppressor Protein Promotes Keratin