This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Kawakami, K. Articles by Danenberg, P. V. Search for Related Content PubMed PubMed Citation Articles by Kawakami, K. Articles by Danenberg, P. V.

Different Lengths of a Polymorphic Repeat Sequence in the Thymidylate Synthase Gene Affect Translational Efficiency but Not Its Gene Expression

Department of Biochemistry and Molecular Biology, University of Southern California, School of Medicine, Norris Comprehensive Cancer Center, Los Angeles, California 90033 [K. K., D. S., J. M. P., K. D. D., H. U., J. B., P. V. D.], and the Department of Surgery, Kanazawa University School of Medicine, Kanazawa 920-8641, Japan [K. K., K. O., G. W.]

	ABSTRACT

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Purpose: Thymidylate synthase (TS) is a target enzyme of 5-fluorouracil. Recently, the TS gene has been shown to contain a polymorphic tandem repeat sequence. The aim of this study was to determine whether differences in the number of tandem repeats could affect gene expression or mRNA translation.

Experimental Design: We quantified TS mRNA isolated from 130 colorectal cancer tissues by real-time reverse transcription-PCR and TS protein in 92 available samples by the fluoro-dUMP binding assay. These values were compared with TS genotypes of the samples determined by a PCR assay.

Results: There was no relation between TS genotype and mRNA expression level. On the other hand, cancer tissues with the 3R/3R genotype had a significantly higher TS protein expression level than did those with the 2R/3R genotype. These results suggest that the efficiency of TS mRNA translation is responsible for the genotype-dependent difference in TS protein expression. Further analysis using TS 5'-untranslated region-luciferase reporter constructs showed that the RNA with the three-repeat sequence was translated three to four times more efficiently than that with two-repeat sequence.

Conclusions: From the results of both in vitro and in vivo study, we conclude that TS mRNA with a three-repeat sequence has greater translation efficiency than that with the two-repeat sequence. The results provide the rationale for comprehensive usage of TS genotyping with quantitation of TS mRNA or TS protein to predict the patient’s response to 5-fluorouracil-based chemotherapy.

	INTRODUCTION

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
TS² catalyzes the reductive methylation of dUMP by 5,10-methylenetetrahydrofolate to form dTMP and dihydrofolate. TS has been an important target for cancer chemotherapy because of its central, rate-limiting role in de novo synthesis of dTTP (1) . 5-FU, a classical TS inhibitor, is widely used in clinical cancer chemotherapy. In addition, a variety of new drugs that target TS are now under development or clinical evaluation (2) . Recent studies have shown that TS expression levels among tumors vary considerably and that the sensitivity of various tumor types to 5-FU-based chemotherapy is associated with the intratumoral level of TS (3, 4, 5, 6) . Therefore, a better understanding of the mechanism of regulation in TS expression is of substantial importance for a more effective clinical cancer chemotherapy strategy with TS inhibitors.

TS mRNA is known to have a unique tandemly repeated sequence in the 5'-UTR and is polymorphic in the number of this repeat (Fig. 1) . It was reported that TS genes with the three-repeat sequence have greater expression activity than those with the two-repeat sequence in the transient expression assay in cancer cells (7) . We observed the same trend in clinical samples of gastrointestinal cancer (8) . These studies suggest that the TS repeat sequence plays an important role in the control of TS protein expression and that the repeat length polymorphism affects that control mechanism. Quantitation of this effect is important because of the possibility that the TS polymorphism may be a novel predictor of the efficacy of TS-directed chemotherapy.

View larger version (4K): [in this window] [in a new window] [Download PPT slide]   Fig. 1. Structure of the TS 5'-flanking region with the three-repeat sequence. The translated region is indicated by a solid bar. Open bar with arrows indicates the 5'-UTR. Arrows represent tandemly repeated sequences and the complementary reverse sequence. The numbers indicate nucleotide position when the first nucleotide of the initiation codon is defined as +1.

	MATERIALS AND METHODS

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Materials.
A total of 133 cancer tissues were surgically obtained from 129 patients with primary colorectal cancer. The patients comprised 79 males and 50 females, ranging in age from 33–93 years, with a mean age of 65.4 years. About 2 g of cancer tissue were obtained and frozen in liquid nitrogen. The samples were stored at -80°C until further processing. The remaining section of the sample was fixed with formalin and used for further histological examination to confirm the diagnosis postoperatively. All histological examinations were performed after staining with H&E.

PCR.
Genomic DNA was isolated by the standard method of proteinase K digestion and phenol-chloroform extraction. PCR was performed using the conditions described previously (8) . The amplified DNA fragments were analyzed by electrophoresis on a 4% agarose gel.

Quantitation of TS mRNA and Protein.
The quantitation of mRNA levels was carried out by a real-time fluorescence detection method as described previously (9) . The quantity of TS mRNA was expressed by the ratio between TS mRNA and ß-actin mRNA. The primer and probe sequences are as follows: (a) for TS, forward primer GGCCTCGGTGTGCCTTT, reverse primer GATGTGCGCAATCATGTACGT, and probe 6-carboxyfluorescein-AACATCGCCAGCTACGCCCTGC-6-carboxytetramethylrhodamine; and (b) for ß-actin, forward primer TGAGCGCGGCTACAGCTT, reverse primer TCCTTAATGTCACGCACGATTT, and probe 6-carboxyfluorescein-ACCACCACGGCCGAGCGG-6-carboxytetramethylrhodamine.

TS protein was measured by [³H]fluoro-dUMP binding assay as described previously (10) . Briefly, a cytosolic fraction from cancer tissue was incubated with an excess amount of [³H]fluoro-dUMP and methylenetetrahydrofolate, forming a ternary complex among [³H]fluoro-dUMP, methylenetetrahydrofolate, and TS. The ³H-labeled ternary complex was then counted by a scintillation counter, and the amount of TS protein was calculated. The total protein concentration in cytosolic fraction was measured using the Bio-Rad protein assay kit (Bio-Rad), and TS protein level was expressed as pmol/mg protein.

Plasmid Construction.
To create the constructs of firefly luciferase reporter gene fused downstream to 5'-UTR of TS, the TS 5'-UTR sequence was obtained by PCR using forward primer TS33 (CTCCATGGGCCGGCGCGGCAGCTCCGA) and reverse primer TS28 (TCCGAGCCGGCCACAGCCAT). The PCR fragments were digested with XhoI and NcoI and then inserted into the pGL3-Basic vector (Promega) that had been cut with the same pair of enzymes. The resulting plasmids were digested with NheI and BamHI, followed by insertion into pCI (Promega) cut with XbaI and BamHI. The fusion constructs with the two-repeat sequences and the three-repeat sequences were designated pCTS2R-FL and pCTS3R-FL, respectively.

Transfection and Luciferase Assay.
HeLa cells were grown at 37°C in DMEM supplemented with 10% fetal bovine serum in a humidified atmosphere containing 5% CO₂. The cells were seeded onto 60-mm dishes and cultured for 12 h before transfection. Plasmids (5 µg) were then transfected into HeLa cells by the calcium phosphate method using Profection Mammalian Transfection System (Promega) following the protocol recommended by manufacturer. pRL-CMV (Promega) was cotransfected for internal control of the transfection efficiency. The cells were harvested after 60 h and separated into two batches. One batch was used for cell lysis, and the other was used for RNA isolation. Cells were lysed with the lysis buffer supplied by the manufacturer (Promega), and then luciferase activity was measured by the Dual-Luciferase assay system (Promega). RNA was isolated by the single-step guanidinium isothiocyanate method (11) and subjected to the RNase protection assay as described below.

RNase Protection Assay.
RNAs from transfected HeLa cells were quantified by the RNase protection assay (12) . To make a ³²P-labeled complementary RNA probe, we created the plasmid constructs that had either the firefly luciferase or renilla luciferase gene in the opposite orientation downstream of the T7 promoter sequence. The 475-bp fragment cut with EcoO109I and XbaI from pGL3 and the 710-bp fragment cut with NheI and RsaI from pRL-CMV were inserted into pCI with opposite orientation, creating pCFL475R and pCRL710R, respectively. These plasmids were linearized and transcribed in a mixture consisting of 40 mM Tris-HCl (pH 7.9); 6 mM MgCl₂; 10 mM NaCl; 10 mM DTT; 2 mM spermidine; 20 units of RNAguard; 0.5 mM ATP, GTP, and UTP; 15 µM CTP; 80 µCi of [-³²P]CTP; 1 µg of plasmid; 20 units of T7 RNA polymerase; and water in a total volume of 20 µl. The ³²P-labeled RNA probes were then extracted by phenol-chloroform, followed by two ethanol precipitations.

The mixture of two probes, each with an activity of 5 x 10⁵ dpm, was incubated overnight with RNA at 45°C, followed by digestion with RNase A. ³²P-labeled RNA probes protected by hybridization were separated by a 4% urea-denatured polyacrylamide gel. The dried gels were exposed to phosphor screen, and the signals were analyzed by ImageQuant (Molecular Dynamics).

Statistical Analysis.
The results are expressed as the means ± SD. Comparisons of values were made by ANOVA. P < 0.05 was considered to indicate significance.

	RESULTS

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Polymorphism in the Number of TS Repeat Sequences in Human Colorectal Cancer.
We analyzed the TS genotype in 133 samples of DNA isolated from colorectal cancer tissues using the PCR assay described above. We obtained PCR fragments with estimated lengths of 210 and 240 bp from 130 samples (Fig. 2A) . The 210- and 240-bp fragments represent the two- and three-repeat sequences, respectively. In addition, we observed PCR fragments longer than 240 bp from three other samples (data not shown). These samples apparently contain TS repeat sequences longer than three repeats. Because repeat sequences longer than 3 were rare in incidence, these samples were excluded from further analysis. The TS genotypes were classified into 2R-homozygote, 3R-homozygote, and 2R/3R-heterozygote. The frequency of each genotype in the 130 colorectal cancer tissues is shown in Fig. 2B . The incidence of each genotype was similar to the results in our previous study (8) .

View larger version (37K): [in this window] [in a new window] [Download PPT slide]   Fig. 2. The TS polymorphisms in colorectal cancer. A, PCR assay for determination of the TS genotype. Two types of amplified fragments, double-repeat (2R) and triple-repeat (3R) fragments, are indicated on the right. The TS genotypes are as follows: Lane 2, 2R/2R; Lane 3, 3R/3R; and Lane 4, 2R/3R. Lane 1 contains the molecular weight marker (a 100-bp ladder), and the length is indicated on the left. B, the frequency of each TS genotype in 130 colorectal cancer tissues. Three samples were excluded because the PCR assay suggested that these samples have a TS repeat sequence longer than 3 repeats.

View larger version (25K): [in this window] [in a new window] [Download PPT slide]   Fig. 3. The association of TS genotype with (A) TS mRNA expression level, (B) TS protein expression level, and (C) the ratio between TS protein and TS mRNA. The data shown are the means ± SD. Comparisons of values were made by ANOVA.

View larger version (38K): [in this window] [in a new window] [Download PPT slide]   Fig. 4. Reporter assay using TS 5'-UTR-luciferase fusion constructs. A, sequence structure of two constructs, pCTS2R-FL and pCTS3R-FL. Open arrow with CMV indicates the CMV promoter sequence. Open bar with 2R or 3R indicates the TS 5'-UTR with the two- or three-repeat sequence, respectively. B, RNase protection assay for the quantitation of RNAs from HeLa cells transfected with pCTS2R-FL or pCTS3R-FL. Lanes 2 and 3 are the results of experiments with pCTS2R-FL. Lanes 4 and 5 are the results of experiments with pCTS3R-FL. Renilla luciferase RNA was quantified as an internal control for transfection efficiency. Undigested probe for renilla luciferase RNA or firefly luciferase RNA was electrophoresed in Lanes 1 and 6, respectively, and the position of the probe was indicated on each side. Both pCTS2R-FL and pCTS3R-FL showed the same level of RNA expression. C, firefly luciferase activity of pCTS2R-FL and pCTS3R-FL, both of which are normalized by RNA quantity determined by RNase protection assay. The ratio between luciferase activity and RNA content, which is expressed as Luc/RNA in the figure, indicates the translational efficiency. The translational efficiency of pCTS3R-FL was three to four times greater than that of pCTS2R-FL. The result was based on four independent experiments, and the value of pCTS2R-FL was set as 1 in each experiment.

	DISCUSSION

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

The mechanism of differential efficiency of translation between the two-repeat sequence and the three-repeat sequence is unclear at present. TS mRNA also has a sequence complementary but opposite in orientation to one repeat component of the polymorphic repeat sequence (Fig. 1) . This complementary reverse sequence is located 15 bases upstream of the repeat sequence. These unique sequences have been thought to make a hairpin-loop structure upstream of the ATG initiation codon and to influence translation of TS mRNA (13) . Repeat length polymorphism might affect translational efficiency by making a difference among the structures of this hairpin-loop. Although the polymorphism was not yet known, Kaneda et al. (14) analyzed the effect of a tandemly repeated sequence of TS on translation using mutant cDNA clones in which part of the three-repeat sequence was deleted. They observed inhibitory effects of the repeat sequence on TS translation. However, no difference in translational efficiency was seen between the three-repeat sequence and the first-repeat-deleted, i.e., two-repeat, sequence. This inconsistency with our results may be due to the fact that their TS cDNA is missing the complementary reverse sequence. Additional studies on translational regulation of TS in context with repeat sequence and the complementary reverse sequence may elucidate the mechanism of differential efficiency in translation between the two-repeat sequence and the three-repeat sequence.

The association between the number of tandem repeats in the TS gene and TS protein expression suggests that TS genotype information may be a useful predictor of the efficacy of TS-directed chemotherapy. The principle that greater levels of TS translation could protect cells from the cytotoxic effect of 5-FU has been explored in many previous studies. It has been shown that the translation of TS mRNA in in vitro translation systems can be suppressed by its own product TS and that TS inhibitor induces the translation by releasing TS mRNA from this suppression (15 , 16) . The induction of TS protein expression through this autoregulation after 5-FU exposure was proposed as one mechanism for tumor resistance to this drug. In addition to these studies, TS protein induction with no change of TS mRNA expression shortly after 5-FU exposure has been observed in many cell lines and clinical samples (10 , 17, 18, 19) .

The first clinical evidence suggesting the above-mentioned idea was reported by Villafranca et al. (20) . These workers found a correlation between TS polymorphisms and downstaging after preoperative chemoradiation in rectal cancer and proposed TS genotyping as a good alternative to quantitation of TS mRNA by RT-PCR methodology. However, the quantitative RT-PCR method has been well established in our laboratory (21, 22, 23) , and the correlation of the level of TS mRNA with clinical response has been consistently observed (24, 25, 26) . Therefore, the TS genotype has less benefit in a clinical setting if it is only related to TS mRNA expression and just an alternative to that quantitation. Rather, we propose TS genotyping as additive information to TS mRNA expression in cancer tissue because the genotype is independent of the mRNA expression level.

In addition to its potential significance in combination with TS mRNA expression, TS genotype might also be supplemental information to TS protein expression in the prediction of response to TS-targeted chemotherapy. As we mentioned above, translational regulation of TS can be critical with regard to whether or not cancer cells survive after 5-FU exposure. Moreover, translational regulation has been thought to play an important role in cell growth, differentiation, and apoptosis, in which the rapid response to changing extracellular environments is essential (27 , 28) . Translational activity cannot be assessed from the protein expression level because the latter is affected by a number of variables including mRNA expression, translation, and protein degradation. Therefore, translation-associated TS genotype could be a predictor for a dynamic status of TS regulation after 5-FU exposure. In this sense, TS genotyping has potential clinical significance independent of TS mRNA and TS protein levels, which reflect rather static parts of TS regulation. The clinical role of the TS genotype in combination with TS mRNA or TS protein quantitation should be evaluated by large-scale clinical study.

In conclusion, we report here that the TS mRNA with a three-repeat sequence is more effectively translated than that with a two-repeat sequence, both in vivo and in vitro. The results suggest that the comprehensive usage of TS genotyping with the quantitation of TS mRNA or TS protein might more precisely predict patient response to 5-FU-based chemotherapy. Further study is needed to evaluate the usefulness of TS polymorphism in the clinical design of therapy for cancer patients.

	FOOTNOTES

 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ To whom requests for reprints should be addressed, at Department of Surgery, Kanazawa University School of Medicine, Takaramachi 13-1, Kanazawa 920-8641, Japan. Phone: 81-76-265-2357; Fax: 81-76-222-6833; E-mail: kawakami{at}med.kanazawa-u.ac.jp

² The abbreviations used are: TS, thymidylate synthase; 5-FU, 5-fluorouracil; UTR, untranslated region; CMV, cytomegalovirus; RT-PCR, reverse transcription-PCR.

Received 6/28/01; revised 9/21/01; accepted 9/25/01.

	REFERENCES

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1. Danenberg P. V. Thymidylate synthetase: a target enzyme in cancer chemotherapy. Biochim. Biophys. Acta, 473: 73-92, 1977.[Medline]
2. Danenberg P. V., Malli H., Swenson S. Thymidylate synthase inhibitors. Semin. Oncol., 26: 621-631, 1999.[Medline]
3. Huang C. L., Yokomise H., Kobayashi S., Fukushima M., Hitomi S., Wada H. Intratumoral expression of thymidylate synthase and dihydropyrimidine dehydrogenase in non-small cell lung cancer patients treated with 5-FU-based chemotherapy. Int. J. Oncol., 17: 47-54, 2000.[Medline]
4. Nishimura R., Nagao K., Miyayama H., Matsuda M., Baba K., Matsuoka Y., Yamashita H., Fukuda M., Higuchi A., Satoh A., Mizumoto T., Hamamoto R. Thymidylate synthase levels as a therapeutic and prognostic predictor in breast cancer. Anticancer Res., 19: 5621-5626, 1999.[Medline]
5. Salonga D., Danenberg K. D., Johnson M., Metzger R., Groshen S., Tsao-Wei D. D., Lenz H. J., Leichman C. G., Leichman L., Diasio R. B., Danenberg P. V. Colorectal tumors responding to 5-fluorouracil have low gene expression levels of dihydropyrimidine dehydrogenase, thymidylate synthase, and thymidine phosphorylase. Clin. Cancer Res., 6: 1322-1327, 2000.[Abstract/Free Full Text]
6. Yeh K. H., Shun C. T., Chen C. L., Lin J. T., Lee W. J., Lee P. H., Chen Y. C., Cheng A. L. High expression of thymidylate synthase is associated with the drug resistance of gastric carcinoma to high dose 5-fluorouracil-based systemic chemotherapy. Cancer (Phila.), 82: 1626-1631, 1998.[CrossRef][Medline]
7. Horie N., Aiba H., Oguro K., Hojo H., Takeishi K. Functional analysis and DNA polymorphism of the tandemly repeated sequences in the 5'-terminal regulatory region of the human gene for thymidylate synthase. Cell Struct. Funct., 20: 191-197, 1995.[Medline]
8. Kawakami K., Omura K., Kanehira E., Watanabe Y. Polymorphic tandem repeats in the thymidylate synthase gene is associated with its protein expression in human gastrointestinal cancers. Anticancer Res., 19: 3249-3252, 1999.[Medline]
9. Eads C. A., Danenberg K. D., Kawakami K., Saltz L. B., Danenberg P. V., Laird P. W. CpG island hypermethylation in human colorectal tumors is not associated with DNA methyltransferase overexpression. Cancer Res., 59: 2302-2306, 1999.[Abstract/Free Full Text]
10. Omura K., Kawakami K., Kanehira E., Nagasato A., Kawashima S., Tawaraya K., Watanabe S., Hirano K., Shirasaka T., Watanabe Y. The number of 5-fluoro-2'-deoxyuridine-5'-monophosphate binding sites and reduced folate pool in human colorectal carcinoma tissues: changes after tegafur and uracil treatment. Cancer Res., 55: 3897-3901, 1995.[Abstract/Free Full Text]
11. Chomczynski P., Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol- chloroform extraction. Anal. Biochem., 162: 156-159, 1987.[Medline]
12. Goodall G. J., Filipowicz W. The AU-rich sequences present in the introns of plant nuclear pre-mRNAs are required for splicing. Cell, 58: 473-483, 1989.[CrossRef][Medline]
13. Kaneda S., Nalbantoglu J., Takeishi K., Shimizu K., Gotoh O., Seno T., Ayusawa D. Structural and functional analysis of the human thymidylate synthase gene. J. Biol. Chem., 265: 20277-20284, 1990.[Abstract/Free Full Text]
14. Kaneda S., Takeishi K., Ayusawa D., Shimizu K., Seno T., Altman S. Role in translation of a triple tandemly repeated sequence in the 5'-untranslated region of human thymidylate synthase mRNA. Nucleic Acids Res., 15: 1259-1270, 1987.[Abstract/Free Full Text]
15. Chu E., Koeller D. M., Casey J. L., Drake J. C., Chabner B. A., Elwood P. C., Zinn S., Allegra C. J. Autoregulation of human thymidylate synthase messenger RNA translation by thymidylate synthase. Proc. Natl. Acad. Sci. USA, 88: 8977-8981, 1991.[Abstract/Free Full Text]
16. Chu E., Voeller D., Koeller D. M., Drake J. C., Takimoto C. H., Maley G. F., Maley F., Allegra C. J. Identification of an RNA binding site for human thymidylate synthase. Proc. Natl. Acad. Sci. USA, 90: 517-521, 1993.[Abstract/Free Full Text]
17. Parr A. L., Drake J. C., Gress R. E., Schwartz G., Steinberg S. M., Allegra C. J. 5-Fluorouracil-mediated thymidylate synthase induction in malignant and nonmalignant human cells. Biochem. Pharmacol., 56: 231-235, 1998.[CrossRef][Medline]
18. Peters G. J., van Triest B., Backus H. H., Kuiper C. M., van der Wilt C. L., Pinedo H. M. Molecular downstream events and induction of thymidylate synthase in mutant and wild-type p53 colon cancer cell lines after treatment with 5-fluorouracil and the thymidylate synthase inhibitor raltitrexed. Eur. J. Cancer, 36: 916-924, 2000.
19. Welsh S. J., Titley J., Brunton L., Valenti M., Monaghan P., Jackman A. L., Aherne G. W. Comparison of thymidylate synthase (TS) protein up-regulation after exposure to TS inhibitors in normal and tumor cell lines and tissues. Clin. Cancer Res., 6: 2538-2546, 2000.[Abstract/Free Full Text]
20. Villafranca E., Okruzhnov Y., Dominguez M. A., Garcia-Foncillas J., Azinovic I., Martinez E., Illarramendi J. J., Arias F., Martinez Monge R., Salgado E., Angeletti S., Brugarolas A. Polymorphisms of the repeated sequences in the enhancer region of the thymidylate synthase gene promoter may predict downstaging after preoperative chemoradiation in rectal cancer. J. Clin. Oncol., 19: 1779-1786, 2001.[Abstract/Free Full Text]
21. Horikoshi T., Danenberg K. D., Stadlbauer T. H., Volkenandt M., Shea L. C., Aigner K., Gustavsson B., Leichman L., Frosing R., Ray M., Gibson N. W., Spears C. P., Danenberg P. V. Quantitation of thymidylate synthase, dihydrofolate reductase, and DT- diaphorase gene expression in human tumors using the polymerase chain reaction. Cancer Res., 52: 108-116, 1992.[Abstract/Free Full Text]
22. Johnston P. G., Lenz H. J., Leichman C. G., Danenberg K. D., Allegra C. J., Danenberg P. V., Leichman L. Thymidylate synthase gene and protein expression correlate and are associated with response to 5-fluorouracil in human colorectal and gastric tumors. Cancer Res., 55: 1407-1412, 1995.[Abstract/Free Full Text]
23. Banerjee D., Gorlick R., Liefshitz A., Danenberg K., Danenberg P. C., Danenberg P. V., Klimstra D., Jhanwar S., Cordon-Cardo C., Fong Y., Kemeny N., Bertino J. R. Levels of E2F-1 expression are higher in lung metastasis of colon cancer as compared with hepatic metastasis and correlate with levels of thymidylate synthase. Cancer Res., 60: 2365-2367, 2000.[Abstract/Free Full Text]
24. Lenz H. J., Leichman C. G., Danenberg K. D., Danenberg P. V., Groshen S., Cohen H., Laine L., Crookes P., Silberman H., Baranda J., Garcia Y., Li J., Leichman L. Thymidylate synthase mRNA level in adenocarcinoma of the stomach: a predictor for primary tumor response and overall survival. J. Clin. Oncol., 14: 176-182, 1996.[Abstract]
25. Leichman C. G., Lenz H. J., Leichman L., Danenberg K., Baranda J., Groshen S., Boswell W., Metzger R., Tan M., Danenberg P. V. Quantitation of intratumoral thymidylate synthase expression predicts for disseminated colorectal cancer response and resistance to protracted-infusion fluorouracil and weekly leucovorin. J. Clin. Oncol., 15: 3223-3229, 1997.[Abstract]
26. Kornmann M., Link K. H., Lenz H. J., Pillasch J., Metzger R., Butzer U., Leder G. H., Weindel M., Safi F., Danenberg K. D., Beger H. G., Danenberg P. V. Thymidylate synthase is a predictor for response and resistance in hepatic artery infusion chemotherapy. Cancer Lett., 118: 29-35, 1997.[CrossRef][Medline]
27. Pain V. M. Initiation of protein synthesis in eukaryotic cells. Eur. J. Biochem., 236: 747-771, 1996.[Medline]
28. Clemens M. J., Bommer U. A. Translational control: the cancer connection. Int. J. Biochem. Cell Biol., 31: 1-23, 1999.[CrossRef][Medline]

This article has been cited by other articles:

				G. Lurje, P. C. Manegold, Y. Ning, A. Pohl, W. Zhang, and H.-J. Lenz Thymidylate synthase gene variations: predictive and prognostic markers Mol. Cancer Ther., May 1, 2009; 8(5): 1000 - 1007. [Abstract] [Full Text] [PDF]

				S. Dulucq, G. St-Onge, V. Gagne, M. Ansari, D. Sinnett, D. Labuda, A. Moghrabi, and M. Krajinovic DNA variants in the dihydrofolate reductase gene and outcome in childhood ALL Blood, April 1, 2008; 111(7): 3692 - 3700. [Abstract] [Full Text] [PDF]

				A. Gomez-Martinez, P. Garcia-Morales, A. Carrato, M. D. Castro-Galache, J. L. Soto, E. Carrasco-Garcia, M. Garcia-Bautista, P. Guaraz, J. A. Ferragut, and M. Saceda Post-transcriptional Regulation of P-Glycoprotein Expression in Cancer Cell Lines Mol. Cancer Res., June 1, 2007; 5(6): 641 - 653. [Abstract] [Full Text] [PDF]

				U. Lim, S. S. Wang, P. Hartge, W. Cozen, L. E. Kelemen, S. Chanock, S. Davis, A. Blair, M. Schenk, N. Rothman, et al. Gene-nutrient interactions among determinants of folate and one-carbon metabolism on the risk of non-Hodgkin lymphoma: NCI-SEER Case-Control Study Blood, April 1, 2007; 109(7): 3050 - 3059. [Abstract] [Full Text] [PDF]

				M Gusella, G Crepaldi, C Barile, A Bononi, D Menon, S Toso, D Scapoli, L Stievano, E Ferrazzi, F Grigoletto, et al. Pharmacokinetic and demographic markers of 5-fluorouracil toxicity in 181 patients on adjuvant therapy for colorectal cancer Ann. Onc., November 1, 2006; 17(11): 1656 - 1660. [Abstract] [Full Text] [PDF]

				J. R. Brody, T. Hucl, E. Gallmeier, J. M. Winter, S. E. Kern, and K. M. Murphy Genomic Copy Number Changes Affecting the Thymidylate Synthase (TYMS) Gene in Cancer: A Model for Patient Classification to Aid Fluoropyrimidine Therapy Cancer Res., October 1, 2006; 66(19): 9369 - 9373. [Abstract] [Full Text] [PDF]

				E. Dotor, M. Cuatrecases, M. Martinez-Iniesta, M. Navarro, F. Vilardell, E. Guino, L. Pareja, A. Figueras, D. G. Mollevi, T. Serrano, et al. Tumor Thymidylate Synthase 1494del6 Genotype As a Prognostic Factor in Colorectal Cancer Patients Receiving Fluorouracil-Based Adjuvant Treatment J. Clin. Oncol., April 1, 2006; 24(10): 1603 - 1611. [Abstract] [Full Text] [PDF]

				M. A. Wright, G. Morrison, P. Lin, G. D. Leonard, D. Nguyen, X. Guo, E. Szabo, J. L. Hopkins, J. P. Leguizamo, N. Harold, et al. A Phase I Pharmacologic and Pharmacogenetic Trial of Sequential 24-Hour Infusion of Irinotecan Followed by Leucovorin and a 48-Hour Infusion of Fluorouracil in Adult Patients with Solid Tumors Clin. Cancer Res., June 1, 2005; 11(11): 4144 - 4150. [Abstract] [Full Text] [PDF]

				K. Kawakami, F. Graziano, G. Watanabe, A. Ruzzo, D. Santini, V. Catalano, R. Bisonni, F. Arduini, I. Bearzi, S. Cascinu, et al. Prognostic Role of Thymidylate Synthase Polymorphisms in Gastric Cancer Patients Treated with Surgery and Adjuvant Chemotherapy Clin. Cancer Res., May 15, 2005; 11(10): 3778 - 3783. [Abstract] [Full Text] [PDF]

				S. Popat, R. Wort, and R. S. Houlston Relationship Between Thymidylate Synthase (TS) Genotype and TS Expression: A Tissue Microarray Analysis of Colorectal Cancers International Journal of Surgical Pathology, April 1, 2005; 13(2): 127 - 133. [Abstract] [PDF]

				A. Jakobsen, J. N. Nielsen, N. Gyldenkerne, and J. Lindeberg Thymidylate Synthase and Methylenetetrahydrofolate Reductase Gene Polymorphism in Normal Tissue As Predictors of Fluorouracil Sensitivity J. Clin. Oncol., March 1, 2005; 23(7): 1365 - 1369. [Abstract] [Full Text] [PDF]

				T. Lecomte, J.-M. Ferraz, F. Zinzindohoue, M.-A. Loriot, D.-A. Tregouet, B. Landi, A. Berger, P.-H. Cugnenc, R. Jian, P. Beaune, et al. Thymidylate Synthase Gene Polymorphism Predicts Toxicity in Colorectal Cancer Patients Receiving 5-Fluorouracil-based Chemotherapy Clin. Cancer Res., September 1, 2004; 10(17): 5880 - 5888. [Abstract] [Full Text] [PDF]

				K. Uchida, K. Hayashi, K. Kawakami, S. Schneider, J. M. Yochim, H. Kuramochi, K. Takasaki, K. D. Danenberg, and P. V. Danenberg Loss of Heterozygosity at the Thymidylate Synthase (TS) Locus on Chromosome 18 Affects Tumor Response and Survival in Individuals Heterozygous for a 28-bp Polymorphism in the TS Gene Clin. Cancer Res., January 15, 2004; 10(2): 433 - 439. [Abstract] [Full Text] [PDF]

				K. Kawakami and G. Watanabe Identification and Functional Analysis of Single Nucleotide Polymorphism in the Tandem Repeat Sequence of Thymidylate Synthase Gene Cancer Res., September 15, 2003; 63(18): 6004 - 6007. [Abstract] [Full Text] [PDF]

				T. Tsuji, S. Hidaka, T. Sawai, T. Nakagoe, H. Yano, M. Haseba, H. Komatsu, H. Shindou, H. Fukuoka, M. Yoshinaga, et al. Polymorphism in the Thymidylate Synthase Promoter Enhancer Region Is Not an Efficacious Marker for Tumor Sensitivity to 5-Fluorouracil-based Oral Adjuvant Chemotherapy in Colorectal Cancer Clin. Cancer Res., September 1, 2003; 9(10): 3700 - 3704. [Abstract] [Full Text] [PDF]

				M. V. Mandola, J. Stoehlmacher, S. Muller-Weeks, G. Cesarone, M. C. Yu, H.-J. Lenz, and R. D. Ladner A Novel Single Nucleotide Polymorphism within the 5' Tandem Repeat Polymorphism of the Thymidylate Synthase Gene Abolishes USF-1 Binding and Alters Transcriptional Activity Cancer Res., June 1, 2003; 63(11): 2898 - 2904. [Abstract] [Full Text] [PDF]

				J. R. Bertino and D. Banerjee Is the Measurement of Thymidylate Synthase to Determine Suitability for Treatment with 5-Fluoropyrimidines Ready for Prime Time? Clin. Cancer Res., April 1, 2003; 9(4): 1235 - 1239. [Full Text] [PDF]

				M. Derenzini, L. Montanaro, A. Chilla, E. Tosti, C. Ceccarelli, F. Dall'Olio, D. Ofner, and D. Trere Evaluation of Thymidylate Synthase Protein Expression by Western Blotting and Immunohistochemistry on Human Colon Carcinoma Xenografts in Nude Mice J. Histochem. Cytochem., December 1, 2002; 50(12): 1633 - 1640. [Abstract] [Full Text] [PDF]

				G. Gribaudo, L. Riera, T. L. Rudge, P. Caposio, L. F. Johnson, and S. Landolfo Human cytomegalovirus infection induces cellular thymidylate synthase gene expression in quiescent fibroblasts J. Gen. Virol., December 1, 2002; 83(12): 2983 - 2993. [Abstract] [Full Text] [PDF]

				M.-C. Etienne, M. Chazal, P. Laurent-Puig, N. Magne, C. Rosty, J.-L. Formento, M. Francoual, P. Formento, N. Renee, E. Chamorey, et al. Prognostic Value of Tumoral Thymidylate Synthase and p53 in Metastatic Colorectal Cancer Patients Receiving Fluorouracil-Based Chemotherapy: Phenotypic and Genotypic Analyses J. Clin. Oncol., June 15, 2002; 20(12): 2832 - 2843. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Kawakami, K. Articles by Danenberg, P. V. Search for Related Content PubMed PubMed Citation Articles by Kawakami, K. Articles by Danenberg, P. V.