
Clinical Cancer Research Vol. 7, 918-927, April 2001
© 2001 American Association for Cancer Research
Molecular Oncology, Markers, Clinical Correlates |
Angiopoietin-1 Is Inversely Related to Thymidine Phosphorylase Expression in Human Breast Cancer, Indicating a Role in Vascular Remodeling1
Margaret J. Currie,
Sarah P. Gunningham,
Cheng Han,
Prudence A. E. Scott,
Bridget A. Robinson,
Adrian L. Harris and
Stephen B. Fox2
Anatomical Pathology [M. J. C., S. P. G., S. B. F.] and Oncology [P. A. E. S., B. A. R.], Canterbury Health, Christchurch Hospital, Christchurch, New Zealand, and Molecular Oncology, Imperial Cancer Research Fund, University of Oxford, John Radcliffe Hospital, Oxford OX3 9DS, United Kingdom [C. H., A. L. H.]
 |
ABSTRACT
|
|---|
Purpose: Angiogenesis is essential for tumor growth and metastasis. It is a complex, dynamic process that is coordinated by several classes of angiogenic factors. One candidate family is the Tie2 tyrosine kinase, whose expression is restricted largely to endothelial cells. Tie2 has three known ligands, angiopoietin (Ang)-1, Ang-2, and Ang-4, that have different functional effects but play a requisite role in embryonic vessel remodeling. Because there are only limited data on the Tie2 pathway in human breast cancer, and our previous data have suggested that breast tumors establish a blood supply by vascular remodeling, we have investigated the expression of Ang-1, Ang-2, Ang-4, and Tie2 in a series of normal and neoplastic human breast tissues.
Experimental Design: We examined mRNA expression by reverse transcription-PCR in 6 normal and 52 malignant breast tissues and correlated expression with clinicopathological and angiogenic variables. We also examined the effect of physiological levels of estrogen on Ang expression.
Results: Ang-1, Ang-2, Ang-4, and Tie2 were detected in 19%, 52%, 35%, and 65%, respectively, of tumor samples. There was a significant reduction in expression of tumor Ang-1 (P = 0.04), Ang-2 (P = 0.01), Ang-4 (P = 0.004), and Tie2 (P = 0.02) compared with that in normal breast tissues. There was a significant relationship in tumors between all Angs and between each ligand and Tie2. In a multivariate analysis, there were significant positive correlations between Ang-4 and estrogen receptor (P = 0.016) and a significant inverse correlation between Ang-1 and thymidine phosphorylase expression (P = 0.01). No significant associations were observed between the other members of the Ang/Tie2 gene family and patient age, tumor size, lymph node status, tumor grade, vascular invasion, tumor vascularity, vascular maturation, thymidine phosphorylase, or vascular endothelial growth factor A expression (P > 0.05 for all). The potential regulation of Ang-4 by estrogen was further investigated in vitro. Addition of physiological concentrations of 17ß-estradiol (1 nM) to hormone-free media caused no significant change in Ang-4 mRNA abundance (P = 0.75) in the estrogen receptor-positive cell line MCF-7 after either 2 or 18 h, despite demonstrating induction for the estrogen response gene pS2.
Conclusions: These findings suggest that the Ang/Tie2 pathway plays a significant role in human breast tumor angiogenesis but provide no initial evidence for direct regulation of the pathway by estrogen.
 |
INTRODUCTION
|
|---|
Angiogenesis is the formation of new blood vessels from the existing vasculature. Normally it is under tight regulatory control and is observed only transiently during development, the female reproductive cycle, and wound healing. Sustained angiogenesis is pathological and characteristic of malignancy, where formation of a neovasculature is essential for tumor growth and metastasis (1)
.
Tumor angiogenesis is a complex dynamic process consisting of extracellular matrix remodeling, endothelial cell proliferation, capillary differentiation, and anastomosis, processes coordinated by several classes of protein ligands acting through cognate kinase receptors. Studies over the past 5 years have identified several important pathways including the VEGF3
family (2)
and, more recently, the Ang/Tie2 receptor family (3)
.
Tie2 is a tyrosine kinase whose expression is largely restricted to endothelial cells (4, 5, 6, 7, 8, 9)
. It has three known ligands, Ang-1, Ang-2, and Ang-4 (10, 11, 12, 13)
. Ang-2 binds to Tie2 with an affinity similar to that of Ang-1 but does not induce receptor phosphorylation. Indeed, it competitively inhibits Ang-1 kinase activation (10)
, giving these ligands functionally opposing effects. The more recently identified Ang-4 (homologous to murine Ang-3), in humans at least, appears to act as an agonist akin to Ang-1 (13)
.
In vitro Ang-1 elicits a chemotactic response in endothelial cells but has no or only a weak effect on proliferation (11
, 14) . Ang-1 is a survival factor for endothelium and stabilizes vascular networks, actions that are augmented by other angiogenic factors such as VEGF (15
, 16)
. Some but not all studies have also reported that Ang-1 induces endothelial cell sprouting (15
, 17)
. These varied effects are likely mediated through several intracellular pathways (18, 19, 20, 21, 22)
, possibly via different Ang isoforms (23)
.
Knockout studies have shown the necessity of an intact Tie2 pathway for normal embryogenesis. Mice lacking Tie2 (24)
or Ang-1 (11)
die at embryonic day 10.5 and embryonic day 12.5, respectively, with a poorly formed vascular network and poor cell-cell and cell-matrix connections, an outcome that is "phenocopied" by overexpression of the antagonist Ang-2 (10)
. In addition to the importance of this pathway in normal development, the Angs and Tie2 also play a role in postnatal neovascularization (25)
. Members of the pathway are detectable in most adult tissues, whether quiescent or angiogenic (7
, 14
, 26
, 27)
, and expression patterns suggest participation in wound healing (27)
, female reproduction (27
, 28)
, and placentation (29)
.
From the above-mentioned data, a model of angiogenesis has evolved whereby Ang-1, via Tie2, maintains the integrity of the capillary by recruiting and stabilizing nonendothelial support cells such as pericytes. Angiogenic stimuli up-regulate Ang-2, resulting in the loss of periendothelial support cells and exposure of the capillary endothelium to other angiogenic factors such as VEGF that in concert complete new vessel growth. Should additional factors be absent, the endothelium undergoes cell death, and the vessels regress (10
, 30
, 31)
. However, in the correct setting, the Angs may also, either alone or with other angiogenic factors, promote neovascularization.
In earlier studies examining the mechanism of human breast cancer angiogenesis, we and others have demonstrated that endothelial cell proliferation is a relatively rare event (32
, 33)
and that breast tumors establish a blood supply predominantly by remodeling of existing vessels (34)
. Because the Ang/Tie2 pathway may regulate the switch between vessel stabilization and remodeling, we hypothesized that the Ang/Tie2 pathway assumes a significant role in the regulation of breast tumor neovascularization. We therefore investigated the role of the Ang/Tie2 pathway in a series of characterized human breast tumors and compared expression to other measures of angiogenesis.
 |
MATERIALS AND METHODS
|
|---|
Tumors and Patients.
Breast carcinomas and normal tissue were collected from patients undergoing surgery at the John Radcliffe Hospital (Oxford, United Kingdom) and Christchurch Hospital (Christchurch, New Zealand). Tumors were treated by simple mastectomy (n = 33) or wide local excision (n = 6) with axillary node sampling. Normal tissues were taken in breast tissues distant from the primary tumor. All but three had axillary node status confirmed histologically (specimen data are unavailable for 13 patients). Histological types included 42 ductal carcinomas not otherwise specified, 4 lobular carcinomas, and 6 others. Grading of ductal carcinomas was performed by pathologists trained at a single institution (John Radcliffe Hospital) according to the modified Bloom and Richardson method (35)
. The clinicopathological characteristics of the series are presented in Table 1
. In patients <50 years old, adjuvant cyclophosphamide, methotrexate, and 5-fluorouracil treatment was administered if tumors were node positive or ER negative and/or
3 cm. Patients older than 50 years with ER-negative, node-positive tumors also received cyclophosphamide, methotrexate, and 5-fluorouracil. Clinical data were unavailable for 13 cases.
View this table:
[in this window]
[in a new window]
|
Table 1 Contingency table comparing the Angs and Tie2 expression with clinicopathological and angiogenic indicesa
|
|
Isolation of RNA.
Tissue was snap frozen, and total RNA was prepared by either the guanidinium thiocyanate lysis and cesium chloride gradient method or using Trizol (Life Technologies, Inc., Gaithersburg, MD) according to manufacturers instructions.
RT-PCR in Human Tissues.
Total RNA was pretreated with DNase I (PCR grade; Life Technologies, Inc.) and converted into first-strand cDNA using a reverse transcriptase preamplification kit (SuperScript II; Life Technologies, Inc.). RT was performed by heating a 12 µl reaction mixture containing DNase I-pretreated total RNA and either 0.5 µg of oligo(dT) (RT-PCR) or 100 ng of random hexamers (relative RT-PCR using 18S internal standard) at 70°C for 10 min. After cooling, 200 units of SuperScript II RNase H- reverse transcriptase (Life Technologies, Inc.) were added in a final 20 µl reaction mixture containing 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 2.5 mM MgCl2, 0.5 mM each deoxynucleotide triphosphate, and 10 mM DTT. The reaction was incubated at 42°C for 50 min and then terminated by heating at 70°C for 15 min. After cooling, 2 units of Escherichia coli RNase H were added and incubated at 37°C for 20 min.
For the PCR, a 50 µl reaction containing 2 µl of first-strand cDNA, 20 mM Tris-HCl (pH 8.4) 2.5 mM MgCl2 (2.0 mM MgCl2 for GAPDH primers), 200 µM deoxynucleotide triphosphate (Boehringer Mannheim), 1 µM each oligonucleotide primer, and 1.25 units of Taq polymerase (Boehringer Mannheim) was subjected to the following temperature cycles: 3-min initial denaturation at 95°C; 30-s denaturing at 95°C; 30-s annealing at the primer-specific temperatures listed below; 30-s extension at 72°C; and a final extension at 72°C for 10 min. The annealing temperature for each primer pair was 60°C for Ang-1, Ang-2, Ang-4, and GAPDH and 54°C for Tie2. The number of cycles used for RT-PCR was 40 for Ang-1, Ang-2, Ang-4, and Tie2, and 30 for GAPDH.
Table 2
lists the sense and antisense primers used (14)
, the RT-PCR product length, and the GenBank accession number for each gene studied. PCR products (10 µl) were resolved with 1.5% agarose gels and visualized by ethidium bromide staining (0.5 µg/µl). The presence of unequivocal bands was used to classify tumors as negative or positive for Ang-1, Ang-2, Ang-4, and Tie2.
View this table:
[in this window]
[in a new window]
|
Table 2 Sense and antisense primers, RT-PCR product length, and GenBank accession numbers for Ang-1, Ang-2, Ang-4, Tie2, and GAPDH (14, 38)
|
|
Chemiluminescent Detection of RT-PCR Products.
After Southern transfer by vacuum blotting to nylon membrane (Zeta-probe; Bio-Rad), internal oligonucleotide primers were used to check the specificity of RT-PCR products. Oligonucleotide primers were 3'-end-labeled with terminal transferase and DIG-11-dideoxy-UTP according to the manufacturers instructions (DIG 3'-End labeling kit; Boehringer Mannheim). Membranes were prehybridized (DIG Easy hyb; Boehringer Mannheim) at 42°C for 1 h and then hybridized with 3'-end DIG-labeled probes (12 pmol/ml) overnight at 42°C. After hybridization, membranes were washed (6x SSC/0.1% SDS at room temperature for 2 x 5 min and then at 62°C for 2 x 20 min) and equilibrated in DIG wash buffer [0.1 M maleic acid, 0.15 M NaCl, and 0.3% Tween 20 (pH 7.5)] for 2 min at room temperature. Nonspecific binding was prevented by incubation in blocking buffer [1% blocking reagent in 0.1 M maleic acid and 0.15 M NaCl (pH 7.5)] for 30 min at room temperature. After centrifugation (5 min), an anti-digoxigenin antibody-alkaline phosphatase conjugate was diluted 1:20,000 in blocking buffer, and the membrane was incubated in this antibody solution for 30 min at room temperature. Antibody solution was removed, and the membrane was washed twice in wash buffer [0.1 M maleic acid, 0.15 M NaCl, and 0.3% Tween 20 (pH 7.5)] for 20 min at room temperature. The membrane was equilibrated in detection buffer [0.1 M Tris-HCl ( pH 9.5) and 0.1 M NaCl) for 3 min at room temperature and then incubated with the chemiluminescent substrate CDP-Star diluted 1:100 in detection buffer for 5 min at room temperature. The membrane was exposed to Kodak X-Omat K XK-1 film (Eastman Kodak Co., Rochester, NY) for 130 min.
Oligonucleotide primers designed for DIG detection of PCR products were as follows: (a) Ang-1, CAGCAATCAGCGCCGAAGTC; (b) Ang-2, ATTGACGGACCCAGCCATGG; (c) Ang-4, CGCGCTGTTTTGGCCCTGAA; (d) Tie2 CTCTTCACCTCGGCCTTCAC; and (e) GAPDH TTTGACGCTGGGGCTGGCAT.
The Effect of Estrogen on Ang-4 Gene Expression in MCF-7 Cells.
To further investigate the potential association between ER and Ang-4, a series of ER-positive (MCF-7 and T47D) and ER-negative (MDA-MD-231, MDA-MD-453, MDA-MD-435, MDA-MD-468, BT20, and SKBR3) breast cancer cell lines (all from American Type Culture Collection) were screened for Ang-4 gene expression using RT-PCR (Fig. 1)
. Because elevated levels of Ang-4 were detectable in the estrogen-responsive cell line MCF-7, this was selected to assess the effects of physiological doses of 17ß-estradiol (36)
. MCF-7 cells (1 x 106) were grown to 30% confluence in RPMI 1640 (Life Technologies, Inc.) supplemented with 10% heat-inactivated FCS, 2 mM L-glutamine, 100 µg/ml streptomycin (Life Technologies, Inc.), and 60 µg/ml benzylpenicillin (CSL Ltd., Victoria, Australia) at 37°C in a humidified atmosphere of 95% air and 5% CO2. After 24 h, cells were washed with PBS, and media were replaced with phenol red-free RPMI 1640 (Life Technologies, Inc.) supplemented with 10% DC-FCS (37)
, 2 mM L-glutamine, 100 µg/ml streptomycin (Life Technologies, Inc.), and 60 µg/ml benzylpenicillin (CSL Ltd.). The cells were then cultured for an additional 3 days until confluent in DC-FCS hormone-free media before adding 17ß-estradiol to a concentration of 1 nM (36)
. Cells were harvested at 2 or 18 h together with control cells grown in parallel in DC-FCS media without 17ß-estradiol. Radioimmuno assay (Endolab; Christchurch Hospital, Christchurch, New Zealand) was used to confirm the absence of 17ß-estradiol in DC-FCS media (<0.004 nM/liter) and measure the concentration of 17ß-estradiol achieved in the experimental media (0.7 nM/liter). MCF-7 cell total RNA was prepared using Trizol (Life Technologies, Inc.), and the experiment was repeated in triplicate.

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 1. DIG chemiluminescence-labeled Ang-4 RTPCR using total RNA (2 µg) from a panel of ER-positive (MCF-7 and T47D) and ER-negative (MDA-MD-231, MDA-MD-435, MDA-MD-453, MDA-MD-468, BT20, and SKBR3) human breast cancer cell lines with lung RT+, lung RT-, and H2O controls.
|
|
Relative RT-PCR.
Relative RT-PCR was used to provide an estimate of the changes in Ang-4 gene expression in MCF-7 cells with or without the addition of 1 nM 17ß-estradiol. Pilot experiments determined that a ratio of 0.5:9.5 (18S primers:18S Competimer primers) was required to coamplify Ang-4 and 18S. Thirty PCR cycles were required to maintain the PCR reactions in midlinear range (data not shown). For relative RT-PCR, cDNAs were reverse transcribed from 2 µg of DNase I (Life Technologies, Inc.)-pretreated total RNA using random hexamer primers and Superscript II RNase H- reverse transcriptase (Life Technologies, Inc.) as described above. For the multiplex PCR, 50 µl reactions were performed as described for Ang-4 RT-PCR, with the addition of 2 µl of a 0.5:9.5 mix of 18S rRNA primers:18S Competimer primers (Ambion, Inc.). PCR reactions were labeled with [
-32P]dCTP (0.5 µl of 3000 Ci/mmol per 50 µl PCR reaction), size separated using 6% polyacrylamide gel, and visualized by autoradiography. Ang-4 signal intensity was quantified by densitometry (Fluor-S MultiImager; Bio-Rad) and standardized against the 18S signal.
As a positive control, expression of the estrogen-regulated gene pS2 was determined (38)
. Pilot experiments determined that a ratio of 5:5 (18S primers:18S Competimer primers) was required to coamplify pS2 and 18S. PCR conditions were as described above, with a 55°C annealing temperature and 30 PCR cycles (data not shown).
Immunohistochemistry.
Immunohistochemistry to highlight endothelium and detect the angiogenic factors TP and VEGF-A was performed on 5 µm formalin-fixed paraffin-embedded sections cut onto coated slides. The antibodies used were PG44c to identify TP (39)
, JC70 (anti-CD31) or QBEND10 (anti-CD34; Dako) to highlight endothelium, and VG1 (40)
to identify VEGF-A. These primary reagents were followed by a standard streptavidin-biotin-peroxidase 3,3'-diaminobenzidine immunohistochemical technique. Predigestion with 12.5 mg of protease type XXIV (Sigma Chemical Co., Poole, United Kingdom) per 100 ml of PBS for 20 min at 37°C was required for optimal JC70 immunostaining, and microwaving pretreatment for 10 min in Tris/EDTA buffer for VG-1. No pretreatment was required when using anti-PG44c (TP) antibody.
Assessment of Tumor Vascularity.
Tumor vascularity blinded for clinicopathological data was assessed using two equivalent methods. The Oxford series was counted by scanning at low power (x40100) for the three areas of highest vascularity before using a 25-point Chalkley point eyepiece graticule (41)
at x250 (0.155 mm2) over these hot spots. The graticule was oriented so that the maximum number of points were on or within areas of highlighted vessels. The mean of three graticule counts for each tumor was used in the statistical analysis with the upper third used as a cut point for categorical analysis as determined previously (42)
. The Christchurch tumors were semiquantitatively placed into high and low/medium groups. Tumors, blinded for clinicopathological data, were again scanned at low power (x40100) for the three areas of highest vascularity and then examined at high power (x250400) and placed into the above-mentioned categories using semiquantitative subjective score. This method of vascular assessment has been shown to be equivalent to the Chalkley method (41
, 43)
.
Assessment of Immunohistochemical VEGF-A and TP Expression.
VEGF-A was assessed by estimating the percentage of tumor cells with positive staining and placing tumors into three groups: (a) low (<30%); (b) intermediate (3070%); and (c) high (>70%; Ref. 44
). Tumors were considered positive when more than 30% of tumor cells stained positively for the antibody as determined previously (44)
. For TP, tumors were assessed for the proportion and intensity of cell staining. Tumors were placed into <25%, 25%74%, and >75% groups and further assessed for weak, moderate, and strong staining. Tumors were considered positive for TP when more than 25% of the tumor cells demonstrated moderate staining (45
, 46)
.
Assessment of Vascular Remodeling.
A subset of 22 tumors was also assessed for the number of vessels actively undergoing remodeling. Cryostat sections were double stained with anti-CD31 antibody (JC70; Dako) and for LH39 (supernatant; Prof. I. Leigh; Royal London Hospital, London, United Kingdom). An avidin-biotin peroxidase complex technique with diaminobenzidine (brown product) was performed using LH39 before an alkaline phosphatase anti-alkaline phosphatase staining procedure and new fuschin (red product) with JC70 was performed. The former antibody recognizes a basement membrane epitope that is only present on those capillaries that are mature, i.e., not undergoing active remodeling (47
, 48)
; the corollary is that absence is indicative of active remodeling (34
, 49)
. A vascular maturation index, defined as the ratio of LH39-positive vessels:CD31-positive vessels, was calculated for each tumor. Counting of both types of vessels [i.e., LH39- and CD31-positive (mature) vessels and CD31 only-positive (remodeling) vessels] was performed independently by two observers at x250 magnification with the Chalkley graticule maintained in one position. A high index reflects a mature phenotype, whereas a low maturation index indicates active remodeling. A cut point of >13% (the upper tertile) defined previously for breast cancers (50)
was used in the categorical analysis to stratify low and high vascular remodeling.
Statistical Analysis.
Spearman rank correlation coefficients were used to study the association between continuous variables. Tests of hypotheses on the location parameter (median) were done using rank statistics (Mann-Whitney, Kruskall-Wallis, and adjusted Kruskall-Wallis for ordered groups). The
2 test was used to test for independence of categorical variables including categorized continuous variables, and for positive relationships, a multivariate analysis was also performed to determine independence. All tests were performed using the Stata package release 5.0 (Stata Corp., College Station, TX).
 |
RESULTS
|
|---|
Ang-1, Ang-2, Ang-4, and Tie2 Receptor mRNA Expression by RT-PCR.
The numbers of positive and negative normal and tumor samples for Ang-1, Ang-2, Ang-4, and Tie2 are shown in Table 3
(Fig. 2)
. There was a significant reduction in expression of tumor Ang-1 (P = 0.04), Ang-2 (P = 0.01), Ang-4 (P = 0.004), and Tie2 (P = 0.02) compared with normal samples. There was also a significant relationship between all Angs and between the Angs and Tie2 in tumor samples (Table 4)
.
View this table:
[in this window]
[in a new window]
|
Table 3 Number of tumors and percentage (in parentheses) of Ang-1, Ang-4, Ang-2, and Tie2 mRNA expression in normal breast (N; n = 6) and breast tumors (T; n = 52).
|
|

View larger version (71K):
[in this window]
[in a new window]
|
Fig. 2. Ethidium bromide-stained gel (top panel) and corresponding DIG chemiluminescence (bottom panel) of Ang-1, Ang-2, Ang-4, and Tie2 RT-PCR products together with GAPDH in a range of tumor breast samples [Lanes 18; RT+, RT-, H2O, and positive control (+ve) lanes].
|
|
Immunohistochemistry.
Tumors were positive for TP in 22 of 34 (65%) cases of breast cancer (Table 1
; Fig. 3
). The usual pattern of immunoreactivity was both nuclear and cytoplasmic, but occasionally only one of these was present. Immunoreactivity was heterogeneous, occasionally focal, and often up-regulated at the infiltrating tumor edge. Immunostaining was also present in the stroma and tumor-associated macrophages. Normal breast epithelial elements surrounding or entrapped by tumor demonstrated weak to moderate immunoreactivity of the inner ductal epithelial cells; the myoepithelial cells were negative.

View larger version (107K):
[in this window]
[in a new window]
|
Fig. 3. Immunohistochemistry demonstrating (A) TP expression in nuclei and cytoplasm of tumor cells, (B) VEGF-A expression in an invasive breast carcinoma with up-regulation adjacent to an area of necrosis in ductal carcinoma in situ (asterisk), and (C) double immunostaining for LH39 (brown, 3,3'-diaminobenzidine) and CD31 (red, new fuschin) showing a breast tumor with a high vascular remodeling [i.e., vessels are LH39 negative; note the positive LH39 brown staining of basement membrane around entrapped normal duct acting as an internal positive control (around the asterisk)].
|
|
Tumors were positive for VEGF-A in 21 of 38 (55%) breast cancers. Staining of tumor cells was usually weak to moderate, but occasionally focal and strong immunoreactivity was present (Table 1
; Fig. 3
). Up-regulation of VEGF-A was present adjacent to areas of necrosis, and endothelial cell staining was also prominent in some cases.
A total of 7 of 15 (32%) breast tumor cases had high vascular remodeling (Table 1
; Fig. 3
). Remodeling vessels were identified throughout the tumor body and approaching its periphery, but at the invasive edge of the tumor, adjacent to normal breast, the proportion of remodeling vessels appeared lower. No morphological difference was identified between remodeling and nonremodeling vessels.
Associations between Ang-1, Ang-2, Ang-4, and Tie2 Receptor mRNA Expression and Clinicopathological and Angiogenic Indices.
There was a significant inverse correlation between Ang-1 and TP expression (P = 0.01), a finding that was confirmed in a multivariate analysis (P = 0.01). There were also significant positive correlations between ER and both Ang-4 (P = 0.016) and Tie2 (P = 0.03) expression (Table 1)
. However, because Ang-4 and Tie2 are significantly positively associated (Table 4)
, a multivariate analysis was performed to test for independence. In the model, Ang-4 (P = 0.016) retained its association with ER, but Tie2 lost (P = 0.17) its association with ER. Similarly, although there was a significant correlation between Ang-4 and tumor vascularity in the
2 analysis (P = 0.05), the relationship was lost when placed in a multivariate model (P = 0.10; Table 1
). In the other categorical analyses, no significant associations were observed between Ang-1, Ang-2, Ang-4, or Tie2 and other clinicopathological or angiogenic indices including patient age (P = 1.0, P = 0.48, P = 0.67, and P = 0.78, respectively), tumor size (P = 0.32, P = 1.0, P = 0.4, and P = 0.68, respectively), lymph node status (P = 0.45, P = 0.51, P = 0.76, and P = 0.84, respectively), tumor grade (P = 0.86, P = 0.59, P = 0.56, and P = 1.0, respectively), vascular invasion (P = 1.0, P = 1.0, P = 0.64, and P = 1.0, respectively), vascular maturation (all P = 1.0), or VEGF-A (P = 0.68, P = 0.54, P = 0.73, and P = 0.25, respectively; Table 1
). No significant correlation was present between Ang-2, Ang-4, or Tie-2 and TP (P = 0.3, P = 0.86, and P = 0.25, respectively) or between Ang-1, Ang-2, or Tie-2 and tumor vascularity (P = 1.0, P = 0.28, and P = 0.73, respectively).
The Effect of Estrogen on Ang-4 Gene Expression in MCF-7 Cells.
Although there was a slight rise in expression of Ang-4, no significant differences were observed in MCF-7 cell Ang-4 gene expression at 0, 2, or 18 h after the addition of 1 nM 17ß-estradiol (P = 0.75; Fig. 4
), despite demonstrating significant gene induction of pS2 after 2 and 18 h (P = 0.008; data not shown).

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 4. Top panel, gene expression in MCF-7 cells after exposure to 1 nM 17ß-estradiol. Gene expression was measured in arbitrary densitometry units, standardized to 18S signal, and expressed as mean percentage units ± SE (n = 3 experiments/group). No significant differences were observed in Ang-4 gene expression at 2 (P = 0.8) or 18 h (P = 0.5) after exposure to 1 nM 17ß-estradiol. Bottom panel, 6% polyacrylamide gel demonstrating the relative abundance of 32P-labeled Ang-4 (368 bp) and 18S rRNA (488 bp) in ER-positive MCF-7 cells. Positive (+ve) controls with MCF-7 cells with (E+) or without (E-) 1 nM 17ß-estradiol at 2 h or 18 h (Lanes 15).
|
|
 |
DISCUSSION
|
|---|
Despite numerous studies examining a variety of angiogenic factors in breast tumors, to the best of our knowledge this is the first investigation reporting the mRNA expression of the Tie2 and all three Angs in human breast tissues. Using RT-PCR, we established the presence of all three Angs and Tie2 in both normal and neoplastic human breast tissues. Specificity for each factor was ensured by chemiluminescence of PCR products. Our results support a role for this pathway in the normal breast as part of the general tissue alterations that occur during normal cyclical hormonal release and in tumors through vascular remodeling. The alteration in the ratio of agonist (Ang-1 and Ang-4) to antagonists (Ang-2) would result in pericyte-endothelial cell contact destabilization, enabling additional factors such as VEGF and/or TP to continue the angiogenic program. This is supported by the significant inverse relationship between the expression of the angiogenic factor TP and Ang-1. TP is a chemotactic but nonmitogenic angiogenic factor (51)
and is preferentially expressed early in breast tumor development (46)
when initial coopting of host vessels has been described (52)
. The loss of Ang-1 and resulting vessel destabilization associated with tumor expression of TP would thus enable this growth factor to act on the primed capillary. Although TP levels have been reported to significantly correlate with microvessel density (53)
and prognosis (54)
, in this series of tumors no such relationship was observed (46)
The findings observed in this study are also in agreement with the limited data on this pathway in breast tumors, where infrequent expression of Ang-1 (14%; n = 21 tumors) and common expression of Tie2 have been reported previously (55
, 56)
. However, breast cancers, which appear to alter the ratios of all three ligands together with modulation of receptor, contrast to brain (57
, 58) and hepatocellular (59)
cancers, where up-regulation of Ang-1, Ang-2, and Tie2 (57
, 58)
and alteration of Ang-2 (59)
, respectively, occurs. This variety suggests that different tumor types use different mechanisms to regulate this pathway and is likely to reflect individual tumors use of the different functions that Tie2 signaling may have beyond its effect on vessel stabilization such as endothelial survival (15
, 16)
and promotion of new vessel growth (17
, 25)
. Moreover, these other and possibly dominant activities in some tumor types would also explain the profound antitumor efficacy seen in animal models when targeting the Tie2 receptor (60
, 61)
.
Previously, we have demonstrated that breast tumors establish a blood supply predominantly by remodeling of existing vessels (34
, 50)
. Because targeted gene deletion studies established a role for the Ang/Tie2 pathway in vessel remodeling in embryonic angiogenesis, we hypothesized that this pathway might mediate this process in tumors. However, we observed no correlation between vascular remodeling as assessed by LH39 and the Ang/Tie2 pathway. It is possible that this is due to the requisite use of different tumor areas for each assay, but it is more likely that in established tumors, the Angs are fulfilling several roles, as outlined above. It is also probable that other pathways such as the Eph-ephrins are also involved in the cell-cell and cell-matrix interactions necessary for vascular remodeling (62)
. Nevertheless, the reduction in tumor growth observed in Ang-1 breast transfectants suggests that in breast cancers, Tie2 may have a major role in vessel stabilization (55)
.
As with the only previous study of Tie2 in breast tumors (56)
, we observed no correlation between Tie2 (or the Angs) with most clinicopathological indices; however, we did demonstrate a significant correlation between ER status and both Tie2 and Ang-4. A multivariate analysis demonstrated the former association was due to its strong relationship with Ang-4 but that the latter was independent, suggesting Ang-4 may be estrogen regulated. Indeed, there is increasing evidence that estrogen affects several steps of the angiogenic process through a variety of mechanisms (63, 64, 65, 66, 67)
. We therefore assessed the expression of Ang-4 in a series of mammary carcinoma cell lines of both ER-negative and ER-positive phenotype to further investigate this correlation. There was no association between breast cell line ER phenotype and Ang-4 expression, and although we observed an increase in Ang-4 in the ER-positive MCF-7 cell line, this did not reach statistical significance. This may be due to constitutive high Ang-4 expression, and it is still possible that Ang-4 might be estrogen regulated in other cell lines such as T47D, where baseline expression is lower and has the potential to be increased. Furthermore, it is also feasible that such regulation occurs in vivo. Nevertheless, the observed association between Ang-4 and ER in breast tumors also may not be causal and some other factor(s) related to ER may be regulating Ang-4. Further work in different ER-positive cell lines may help clarify the complex role of this pathway in vessel remodeling/angiogenesis.
In summary, this study has demonstrated the expression of the Ang/Tie2 pathway in human breast cell lines and human tissue samples. Furthermore, it has shown a relationship between Ang-1 and TP, suggesting that this angiogenic factor, which is involved in the remodeling process, may partly mediate Angs and thereby Tie2 activity. It has raised the possibility that the pathway, like other angiogenic factors, may be regulated by estrogen, but further work will be required to delineate the various functions of the different Angs to determine whether tumors at different stages of development, as early data suggest (52
, 68)
, or of different types preferentially use the pathway for the same function. Furthermore, although this pathway may not provide a clear cut prognostic indicator because of its complex roles in vessel remodeling, its measurement may be useful to determine the likely response to conventional therapies or antiangiogenic treatments as suggested by data in animal models (69)
.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Dr. G. D. Yancopoulos (Regeneron Pharmaceuticals, Inc., Tarrytown, NY) for the Tie2 and Ang cDNAs, the staff of the Anatomical Pathology Laboratory (Christchurch Hospital, Christchurch, New Zealand) for cutting archival material and performing immunohistochemistry, and Julie Vincent for technical support.
 |
FOOTNOTES
|
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 Supported by grants from the Health Research Council of New Zealand, the McClelland Trust, and Canterbury Health Ltd., Christchurch, New Zealand. 
2 To whom requests for reprints should be addressed, at Anatomical Pathology Department, Canterbury Health, Christchurch Hospital, Christchurch, New Zealand. Phone: 64-3-364-0592; Fax: 64-3-364-0593; E-mail: stephen.fox{at}chmeds.ac.nz 
3 The abbreviations used are: VEGF, vascular endothelial growth factor; Ang, angiopoietin; RT, reverse transcription; ER, estrogen receptor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; DC-FCS, dextran-charcoal-stripped FCS; TP, thymidine phosphorylase; DIG, digoxigenin. 
Received 11/27/00;
revised 1/19/01;
accepted 1/25/01.
 |
REFERENCES
|
|---|
-
Folkman J. What is the evidence that tumors are angiogenesis dependent. J. Natl. Cancer Inst. (Bethesda), 82: 4-6, 1990.[Free Full Text]
-
Nicosia R. F. What is the role of vascular endothelial growth factor-related molecules in tumor angiogenesis?. Am. J. Pathol., 153: 11-16, 1998.[Free Full Text]
-
Lauren J., Gunji Y., Alitalo K. Is angiopoietin-2 necessary for the initiation of tumor angiogenesis?. Am. J. Pathol., 153: 1333-1339, 1998.[Free Full Text]
-
Armstrong E., Korhonen J., Silvennoinen O., Cleveland J. L., Lieberman M. A., Alitalo R. Expression of tie receptor tyrosine kinase in leukemia cell lines. Leukemia (Baltimore), 7: 1585-1591, 1993.[Medline]
-
Batard P., Sansilvestri P., Scheinecker C., Knapp W., Debili N., Vainchenker W., Buhring H. J., Monier M. N., Kukk E., Partanen J., Matikainen M. T., Alitalo R., Hatzfeld J., Alitalo K. The Tie receptor tyrosine kinase is expressed by human hematopoietic progenitor cells and by a subset of megakaryocytic cells. Blood, 87: 2212-2220, 1996.[Abstract/Free Full Text]
-
Dumont D. J., Fong G. H., Puri M. C., Gradwohl G., Alitalo K., Breitman M. L. Vascularization of the mouse embryo: a study of flk-1, tek, tie, and vascular endothelial growth factor expression during development. Dev. Dyn., 203: 80-92, 1995.[Medline]
-
Schnurch H., Risau W. Expression of tie-2, a member of a novel family of receptor tyrosine kinases, in the endothelial cell lineage. Development (Camb.), 119: 957-968, 1993.[Abstract]
-
Sato T. N., Qin Y., Kozak C. A., Audus K. L. Tie-1 and tie-2 define another class of putative receptor tyrosine kinase genes expressed in early embryonic vascular system(erratum appears in Proc. Natl. Acad. Sci. USA, 90: 12056, 1993). Proc. Natl. Acad. Sci. USA, 90: 9355-9358, 1993.[Abstract/Free Full Text]
-
Iwama A., Hamaguchi I., Hashiyama M., Murayama Y., Yasunaga K., Suda T. Molecular cloning and characterization of mouse TIE and TEK receptor tyrosine kinase genes and their expression in hematopoietic stem cells. Biochem. Biophys. Res. Commun., 195: 301-309, 1993.[CrossRef][Medline]
-
Maisonpierre P. C., Suri C., Jones P. F., Bartunkova S., Wiegand S. J., Radziejewski C., Compton D., McClain J., Aldrich T. H., Papadopoulos N., Daly T. J., Davis S., Sato T. N., Yancopoulos G. D. Angiopoietin-2, a natural antagonist for Tie2 that disrupts in vivo angiogenesis. Science (Washington DC), 277: 55-60, 1997.[Abstract/Free Full Text]
-
Suri C., Jones P. F., Patan S., Bartunkova S., Maisonpierre P. C., Davis S., Sato T. N., Yancopoulos G. D. Requisite role of angiopoietin-1, a ligand for the TIE2 receptor, during embryonic angiogenesis. Cell, 87: 1171-1180, 1996.[CrossRef][Medline]
-
Davis S., Aldrich T. H., Jones P. F., Acheson A., Compton D. L., Jain V., Ryan T. E., Bruno J., Radziejewski C., Maisonpierre P. C., Yancopoulos G. D. Isolation of angiopoietin-1, a ligand for the TIE2 receptor, by secretion-trap expression cloning. Cell, 87: 1161-1169, 1996.[CrossRef][Medline]
-
Valenzuela D. M., Griffiths J. A., Rojas J., Aldrich T. H., Jones P. F., Zhou H., McClain J., Copeland N. G., Gilbert D. J., Jenkins N. A., Huang T., Papadopoulos N., Maisonpierre P. C., Davis S., Yancopoulos G. D. Angiopoietins 3 and 4: diverging gene counterparts in mice and humans. Proc. Natl. Acad. Sci. USA, 96: 1904-1909, 1999.[Abstract/Free Full Text]
-
Witzenbichler B., Maisonpierre P. C., Jones P., Yancopoulos G. D., Isner J. M. Chemotactic properties of angiopoietin-1 and -2, ligands for the endothelial-specific receptor tyrosine kinase Tie2. J. Biol. Chem., 273: 18514-18521, 1998.[Abstract/Free Full Text]
-
Papapetropoulos A., Garcia-Cardena G., Dengler T. J., Maisonpierre P. C., Yancopoulos G. D., Sessa W. C. Direct actions of angiopoietin-1 on human endothelium: evidence for network stabilization, cell survival, and interaction with other angiogenic growth factors. Lab. Investig., 79: 213-223, 1999.[Medline]
-
Kwak H. J., So J. N., Lee S. J., Kim I., Koh G. Y. Angiopoietin-1 is an apoptosis survival factor for endothelial cells. FEBS Lett., 448: 249-253, 1999.[CrossRef][Medline]
-
Koblizek T. I., Weiss C., Yancopoulos G. D., Deutsch U., Risau W. Angiopoietin-1 induces sprouting angiogenesis in vitro. Curr. Biol., 8: 529-532, 1998.[CrossRef][Medline]
-
Huang L., Turck C., Rao P., Peters K. GRB2 and SH-PTP2: potentially important endothelial signalling molecules downstream of the TEK/TIE2 receptor tyrosine kinase. Oncogene, 11: 2097-2103, 1995.[Medline]
-
Kontos C. D., Stauffer T. P., Yang W. P., York J. D., Huang L., Blanar M. A., Meyer T., Peters K. G. Tyrosine 1101 of Tie2 is the major site of association of p85 and is required for activation of phosphatidylinositol 3-kinase and Akt. Mol. Cell. Biol., 18: 4131-4140, 1998.[Abstract/Free Full Text]
-
Korpelainen E. I., Karkkainen M., Gunji Y., Vikkula M., Alitalo K. Endothelial receptor tyrosine kinases activate the STAT signaling pathway: mutant Tie-2 causing venous malformations signals a distinct STAT activation response. Oncogene, 18: 1-8, 1999.[CrossRef][Medline]
-
Fujikawa K., de Aos Scherpenseel I., Jain S. K., Presman E., Varticovski L. Role of PI 3-kinase in angiopoietin-1-mediated migration and attachment-dependent survival of endothelial cells. Cell Res., 253: 663-672, 1999.
-
Jones N., Master Z., Jones J., Bouchard D., Gunji Y., Sasaki H., Daly R., Alitalo K., Dumont D. J. Identification of Tek/Tie2 binding partners: binding to a multifunctional docking site mediates cell survival and migration. J. Biol. Chem., 274: 30896-30905, 1999.[Abstract/Free Full Text]
-
Huang Y. Q., Li J. J., Karpatkin S. Identification of a family of alternatively spliced mRNA species of angiopoietin-1. Blood, 95: 1993-1999, 2000.[Abstract/Free Full Text]
-
Sato T. N., Tozawa Y., Deutsch U., Wolburg B. K., Fujiwara Y., Gendron M. M., Gridley T., Wolburg H., Risau W., Qin Y. Distinct roles of the receptor tyrosine kinases Tie-1 and Tie-2 in blood vessel formation. Nature (Lond.), 376: 70-74, 1995.[CrossRef][Medline]
-
Asahara T., Chen D., Takahashi T., Fujikawa K., Kearney M., Magner M., Yancopoulos G. D., Isner J. M. Tie2 receptor ligands, angiopoietin-1 and angiopoietin-2, modulate VEGF-induced postnatal neovascularization. Circ. Res., 83: 233-240, 1998.[Abstract/Free Full Text]
-
Maisonpierre P. C., Goldfarb M., Yancopoulos G. D., Gao G. Distinct rat genes with related profiles of expression define a TIE receptor tyrosine kinase family. Oncogene, 8: 1631-1637, 1993.[Medline]
-
Wong A. L., Haroon Z. A., Werner S., Dewhirst M. W., Greenberg C. S., Peters K. G. Tie2 expression and phosphorylation in angiogenic and quiescent adult tissues. Circ. Res., 81: 567-574, 1997.[Abstract/Free Full Text]
-
Goede V., Schmidt T., Kimmina S., Kozian D., Augustin H. G. Analysis of blood vessel maturation es during cyclic ovarian angiogenesis. Lab. Invest., 78: 1385-1394, 1998.[Medline]
-
Goldman-Wohl D. S., Ariel I., Greenfield C., Lavy Y., Yagel S. Tie-2 and angiopoietin-2 expression at the fetal-maternal interface: a receptor ligand model for vascular remodelling. Mol. Hum. Reprod., 6: 81-87, 2000.[Abstract/Free Full Text]
-
Hanahan D., Folkman J. Patterns and emerging mechanisms of the angiogenic switch during tumorigenesis. Cell, 86: 353-364, 1996.[CrossRef][Medline]
-
Folkman J., Pa D. A. Blood vessel formation: what is its molecular basis?. Cell, 87: 1153-1155, 1996.[CrossRef][Medline]
-
Fox S. B., Gatter K., Bicknell R., Going J., Stanton P., Cooke T., Harris A. Relationship of endothelial cell proliferation to tumor vascularity in human breast cancer. Cancer Res., 53: 9161-9163, 1993.
-
Vartanian R. K., Weidner N. Correlation of intratumoral endothelial-cell proliferation with microvessel density (tumor angiogenesis) and tumor-cell proliferation in breast-carcinoma. Am. J. Pathol., 144: 1188-1194, 1994.[Abstract]
-
Kakolyris S., Giatromanolaki A., Koukourakis M., Leigh I. M., Georgoulias V., Kanavaros P., Sivridis E., Gatter K. C., Harris A. L. Assessment of vascular maturation in non-small cell lung cancer using a novel basement membrane component, LH39: correlation with p53 and angiogenic factor expression. Cancer Res., 59: 5602-5607, 1999.[Abstract/Free Full Text]
-
Elston C. Grading of invasive carcinoma of the breast Page D. Anderson T. eds. . Diagnostic Histopathology of the Breast, : 300-311, Churchill Livingstone Edinburgh 1987.
-
Ruohola J. K., Valve E. M., Karkkainen M. J., Joukov V., Alitalo K., Härkönen P. L. Vascular endothelial growth factors are differentially regulated by steroid hormones and antiestrogens in breast cancer cells. Mol. Cell. Endocrinol., 149: 29-40, 1999.[CrossRef][Medline]
-
Darbre P., Yates J., Curtis S., King R. J. Effect of estradiol on human breast cancer cells in culture. Cancer Res., 43: 349-354, 1983.[Abstract/Free Full Text]
-
Knowlden J. M., Gee J. M., Bryant S., McClelland R. A., Manning D. L., Mansel R., Ellis I. O., Blamey R. W., Robertson J. F., Nicholson R. I. Use of reverse transcription-polymerase chain reaction methodology to detect estrogen-regulated gene expression in small breast cancer specimens. Clin. Cancer Res., 3: 2165-2172, 1997.[Abstract]
-
Fox S. B., Mogghaddam A., Westwood M., Turley H., Bicknell R., Gatter K. C., Harris A. L. Platelet-derived endothelial cell growth factor/thymidine phosphorylase expression in normal tissues: an immunohistochemical study. J. Pathol., 176: 183-190, 1995.[CrossRef][Medline]
-
Turley H., Scott P. A., Watts V. M., Bicknell R., Harris A. L., Gatter K. C. Expression of VEGF in routinely fixed material using a new monoclonal antibody VG1. J. Pathol., 186: 313-318, 1998.[CrossRef][Medline]
-
Fox S. B., Leek R. D., Weekes M. P., Whitehouse R. M., Gatter K. C., Harris A. L. Quantitation and prognostic value of breast cancer angiogenesis: comparison of microvessel density, Chalkley count, and computer image analysis. J. Pathol., 177: 275-283, 1995.[CrossRef][Medline]
-
Fox S. B., Leek R. D., Smith K., Hollyer J., Greenall M., Harris A. L. Tumor angiogenesis in node-negative breast carcinomas: relationship with epidermal growth factor receptor, estrogen receptor, and survival. Breast Cancer Res. Treat., 29: 109-116, 1994.[CrossRef][Medline]
-
Fox S. B., Leek R. D., Bliss J., Mansi J. L., Gusterson B., Gatter K. C., Harris A. L. Association of tumor angiogenesis with bone marrow micrometastases in breast cancer patients. J. Natl. Cancer Inst. (Bethesda), 89: 1044-1049, 1997.[Abstract/Free Full Text]
-
Giatromanolaki A., Koukourakis M. I., Kakolyris S., Turley H., OByrne K., Scott P. A., Pezzella F., Georgoulias V., Harris A. L., Gatter K. C. Vascular endothelial growth factor, wild-type p53, and angiogenesis in early operable non-small cell lung cancer. Clin. Cancer Res., 4: 3017-3024, 1998.[Abstract]
-
Fox S. B., Engels K., Comley M., Whitehouse R., Turley H., Gatter K., Harris A. Relationship of elevated tumour thymidine phosphorylase in node positive breast carcinomas to the effects of adjuvant CMF. Ann. Oncol., 8: 271-275, 1997.[Abstract/Free Full Text]
-
Fox S. B., Westwood M., Moghaddam A., Comley M., Turley H., Whitehouse R. M., Bicknell R., Gatter K. C., Harris A. L. The angiogenic factor platelet-derived endothelial cell growth factor/thymidine phosphorylase is up-regulated in breast cancer epithelium and endothelium. Br. J. Cancer, 73: 275-280, 1996.[Medline]
-
Almeida B. M., Challacombe S. J., Eveson J. W., Morgan P. R., Purkis P. E., Leigh I. M. The distribution of LH39 basement membrane epitope in the tumour stroma of oral squamous cell carcinomas. J. Pathol., 166: 369-374, 1992.[CrossRef][Medline]
-
Almeida B. M., Challacombe S. J., Eveson J. W., Smith C. G., Leigh I. M. A novel lamina lucida component of epithelial and endothelial basement membranes detected by LH39 monoclonal antibody. J. Pathol., 166: 243-253, 1992.[CrossRef][Medline]
-
Fox S. B., Kakolyris S., Taylor M., Gatter K., Harris A. L. Vascular remodeling in breast cancer angiogenesis assessed by LH39 basement membrane antigen and CD31. Proc. Am. Assoc. Cancer Res., 38: 54 1997.
-
Fox S. B., Kakolyris S., Koukourakis M., Giatromanolaki A., Brown N., Leek R. D., Taylor M., Leigh I. M., Gatter K. C., Harris A. L. Relationship of vascular maturation in breast cancer blood vessels to vascular density and metastasis, assessed by expression of a novel basement membrane component, LH39. Br. J. Cancer, 82: 844-851, 2000.[CrossRef][Medline]
-
Moghaddam A., Zhang H. T., Fan T. P., Hu D. E., Lees V. C., Turley H., Fox S. B., Gatter K. C., Harris A. L., Bicknell R. Thymidine phosphorylase is angiogenic and promotes tumor growth. Proc. Natl. Acad. Sci. USA, 92: 998-1002, 1995.[Abstract/Free Full Text]
-
Holash J., Maisonpierre P. C., Compton D., Boland P., Alexander C. R., Zagzag D., Yancopoulos G. D., Wiegand S. J. Vessel cooption, regression, and growth in tumors mediated by angiopoietins and VEGF. Science (Washington DC), 284: 1994-1998, 1999.[Abstract/Free Full Text]
-
Toi M., Hoshina S., Taniguchi T., Yamamoto Y., Ishitsuka H., Tominaga T. Expression of platelet-derived endothelial cell growth factor/thymidine phosphorylase in human breast cancer. Int. J. Cancer, 64: 79-82, 1995.[Medline]
-
Toi M., Ueno T., Matsumoto H., Saji H., Funata N., Koike M., Tominaga T. Significance of thymidine phosphorylase as a marker of protumor monocytes in breast cancer. Clin. Cancer Res., 5: 1131-1137, 1999.[Abstract/Free Full Text]
-
Hayes A. J., Huang W. Q., Yu J., Maisonpierre P. C., Liu A., Kern F. G., Lippman M. E., McLeskey S. W., Li L. Y. Expression and function of angiopoietin-1 in breast cancer. Br. J. Cancer, 83: 1154-1160, 2000.[CrossRef][Medline]
-
Peters K., Coogan A., Berry D., Marks J., Iglehart J., Kontos C., Rao P., Sankar S., Trogan E. Expression of Tie2/Tek in breast tumour vasculature provides a new marker for evaluation of tumour angiogenesis. Br. J. Cancer, 77: 51-56, 1998.[Medline]
-
Stratmann A., Risau W., Plate K. H. Cell type-specific expression of angiopoietin-1 and angiopoietin-2 suggests a role in glioblastoma angiogenesis. Am. J. Pathol., 153: 1459-1466, 1998.[Abstract/Free Full Text]
-
Zagzag D., Hooper A., Friedlander D. R., Chan W., Holash J., Wiegand S. J., Yancopoulos G. D., Grumet M. In situ expression of angiopoietins in astrocytomas identifies angiopoietin-2 as an early marker of tumor angiogenesis. Exp. Neurol., 159: 391-400, 1999.[CrossRef][Medline]
-
Tanaka S., Mori M., Sakamoto Y., Makuuchi M., Sugimachi K., Wands J. R. Biologic significance of angiopoietin-2 expression in human hepatocellular carcinoma. J. Clin. Invest., 103: 341-345, 1999.[Medline]
-
Lin P., Buxton J. A., Acheson A., Radziejewski C., Maisonpierre P. C., Yancopoulos G. D., Channon K. M., Hale L. P., Dewhirst M. W., George S. E., Peters K. G. Antiangiogenic gene therapy targeting the endothelium-specific receptor tyrosine kinase Tie2. Proc. Natl. Acad. Sci. USA, 95: 8829-8834, 1998.[Abstract/Free Full Text]
-
Lin P., Sankar S., Shan S., Dewhirst M. W., Polverini P. J., Quinn T. Q., Peters K. G. Inhibition of tumor growth by targeting tumor endothelium using a soluble vascular endothelial growth factor receptor. Cell Growth Differ., 9: 49-58, 1998.[Abstract]
-
Peters K. G. Vascular endothelial growth factor and the angiopoietins: working together to build a better blood vessel. Circ. Res., 83: 342-343, 1998.[Free Full Text]
-
Schnaper H., McGowan K., Kim-Schulze S., Cid M. Oestrogen and endothelial cell angiogenic activity. Clin. Exp. Pharmacol. Physiol., 23: 247-250, 1996.[Medline]
-
Caulin-Glaser T., Watson C., Pardi R., Bender J. Efects of 17ß-estradiol on cytokine induced endothelial cell adhesion molecule expression. J. Clin. Invest., 98: 26-42, 1996.
-
Morales D. E., McGowan K. A., Grant D. S., Maheshwari S., Bhartiya D., Cid M. C., Kleinman H. K., Schnaper H. W. Estrogen promotes angiogenic activity in human umbilical vein endothelial cells in vitro and in a murine model. Circulation, 91: 755-763, 1995.[Abstract/Free Full Text]
-
Fotsis T., Zhang Y., Pepper M. S., Adlercreutz H., Montesano R., Nawroth P. P., Schweigerer L. The endogenous oestrogen metabolite 2-methoxyoestradiol inhibits angiogenesis and suppresses tumour growth. Nature (Lond.), 368: 237-239, 1994.[CrossRef][Medline]
-
Tsukamoto A., Kaneko Y., Yoshida T., Han K., Ichinose M., Kimura S. 2-Methoxyestradiol, an endogenous metabolite of estrogen, enhances apoptosis and ß-galactosidase expression in vascular endothelial cells. Biochem. Biophys. Res. Commun., 248: 9-12, 1998.[CrossRef][Medline]
-
Holash J., Wiegand S. J., Yancopoulos G. D. New model of tumor angiogenesis: dynamic balance between vessel regression and growth mediated by angiopoietins and VEGF. Oncogene, 18: 5356-5362, 1999.[CrossRef][Medline]
-
Siemeister G., Schirner M., Weindel K., Reusch P., Menrad A., Marmé D., Martiny-Baron G. Two independent mechanisms essential for tumor angiogenesis: inhibition of human melanoma xenograft growth by interfering with either the vascular endothelial growth factor receptor pathway or the Tie-2 pathway. Cancer Res., 59: 3185-3191, 1999.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
N. Sugino, T. Suzuki, A. Sakata, I. Miwa, H. Asada, T. Taketani, Y. Yamagata, and H. Tamura
Angiogenesis in the Human Corpus Luteum: Changes in Expression of Angiopoietins in the Corpus Luteum throughout the Menstrual Cycle and in Early Pregnancy
J. Clin. Endocrinol. Metab.,
November 1, 2005;
90(11):
6141 - 6148.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. J. LEE, C.-H. CHO, S.-J. HWANG, H.-H. CHOI, K.-T. KIM, S. Y. AHN, J.-H. KIM, J.-L. OH, G. M. LEE, and G. Y. KOH
Biological characterization of angiopoietin-3 and angiopoietin-4
FASEB J,
August 1, 2004;
18(11):
1200 - 1208.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M J Currie, V Hanrahan, S P Gunningham, H R Morrin, C Frampton, C Han, B A Robinson, and S B Fox
Expression of vascular endothelial growth factor D is associated with hypoxia inducible factor (HIF-1{alpha}) and the HIF-1{alpha} target gene DEC1, but not lymph node metastasis in primary human breast carcinomas
J. Clin. Pathol.,
August 1, 2004;
57(8):
829 - 834.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Tangkeangsirisin, J. Hayashi, and G. Serrero
PC Cell-Derived Growth Factor Mediates Tamoxifen Resistance and Promotes Tumor Growth of Human Breast Cancer Cells
Cancer Res.,
March 1, 2004;
64(5):
1737 - 1743.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Seeliger, M. Guba, G. E. Koehl, A. Doenecke, M. Steinbauer, C. J. Bruns, C. Wagner, E. Frank, K.-W. Jauch, and E. K. Geissler
Blockage of 2-Deoxy-D-Ribose-Induced Angiogenesis with Rapamycin Counteracts a Thymidine Phosphorylase-Based Escape Mechanism Available for Colon Cancer under 5-Fluorouracil Therapy
Clin. Cancer Res.,
March 1, 2004;
10(5):
1843 - 1852.
[Abstract]
[Full Text]
[PDF]
|
 |
|