Clinical Cancer Research AACR Conference on Cancer Prevention
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Grem, J. L.
Right arrow Articles by Allegra, C. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Grem, J. L.
Right arrow Articles by Allegra, C. J.
Clinical Cancer Research Vol. 7, 999-1009, April 2001
© 2001 American Association for Cancer Research

Experimental Therapeutics, Preclinical Pharmacology

Thymidine Kinase, Thymidylate Synthase, and Dihydropyrimidine Dehydrogenase Profiles of Cell Lines of the National Cancer Institute’s Anticancer Drug Screen

Jean L. Grem1, Kathleen D. Danenberg, Katherine Behan, Allyson Parr, Lauren Young, Peter V. Danenberg, Diana Nguyen, James Drake, Anne Monks and Carmen J. Allegra

Developmental Therapeutics Department, Medicine Branch, Division of Clinical Sciences, National Cancer Institute at the National Naval Medical Center, Bethesda, Maryland 20889 [J. L. G., K. B., A. P., L. Y., D. N., C. J. A.]; Norris Cancer Center, University of Southern California, Los Angeles, California 90033 [K. D. D., P. V. D.]; Developmental Therapeutics Program, Division of Cancer Treatment and Diagnosis, National Cancer Institute, Bethesda, Maryland 20852 [J. D.]; and Science Applications International Corporation-Frederick, National Cancer Institute-Frederick Cancer Research and Development Center, Frederick, Maryland 21702 [A. M.]


   ABSTRACT
Top
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Purpose: To determine the expression of three targets of 5-fluorouracil (5-FU) and 5-fluoro-2'-deoxyuridine (FdUrd) in human tumor cell lines and to compare these with the 50% growth inhibition concentrations (GI50) from the National Cancer Institute database.

Experimental Design: Thymidine kinase (TK) activity was assessed by conversion of [3H]thymidine to [3H]TMP. Thymidylate synthase (TS) protein expression was determined by Western analysis. TS and dihydropyrimidine dehydrogenase (DPD) mRNA expression were measured by quantitative reverse transcription-PCR.

Results: The median (range) for the targets were as follows: 5-FU GI50, 20.8 µM (0.8–536); FdUrd GI50, 0.75 µM (0.25–237); TK, 0.93 nmol/min/mg (0.16–5.7); in arbitrary units: TS protein, 0.41 (0.05–2.95); TS mRNA, 1.05 (0.12–6.41); and DPD mRNA, 1.09 (0.00–24.4). A moderately strong correlation was noted between 5-FU and FdUrd GI50s (r = 0.60), whereas a weak-moderate correlation was seen between TS mRNA and protein expression (r = 0.45). Neither TS expression nor TK activity correlated with 5-FU or FdUrd GI50s, whereas lines with lower DPD expression tended to be more sensitive to 5-FU. Cell lines with faster doubling times and wild-type p53 were significantly more sensitive to 5-FU and FdUrd.

Conclusions: The lack of correlation may in part be attributable to the influence of downstream factors such as p53, the observation that the more sensitive cell lines with faster doubling times also had higher TS levels, and the standard procedure of the screen that uses a relatively short (48-h) drug exposure.


   INTRODUCTION
Top
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The NCI2 has established a panel consisting of 60 human cancer cell lines to serve as a screen for drug discovery (1, 2, 3, 4, 5) . The panel represents nine histologies including leukemia, melanoma, and carcinomas arising in the lung, colon, CNS, ovary, kidney, prostate, and breast. Growth inhibition for a particular compound is summarized by the 50% growth inhibition concentration for the cell line panel. A mean graph can be generated both with and without log transformation; the relative sensitivity of each cell line is then compared with the mean for the entire cell panel (6, 7) . The COMPARE algorithm analyzes these activity patterns by searching among the database of tested compounds for similar profiles for activity, whereas the DISCOVERY software program uses additional analytical tools. Comparison of the "fingerprint" for drug sensitivity among investigational agents with those of drugs with established mechanisms of action can provide insight into potential cross-resistance between analogues and to assign unknown compounds into classes of anticancer agents with different mechanisms of action (8, 9, 10, 11) . These cell lines are currently undergoing biochemical and molecular characterization to elucidate the basis for differential chemosensitivity responses. It is hoped that matching the pattern of mRNA or protein expression with sensitivity to investigational agents may also assist in identifying novel agents that selectively target a particular phenotype (12 , 13) .

The antimetabolite 5-FU has clinically useful activity against a variety of human epithelial malignancies, and its deoxyribonucleoside metabolite, FdUrd, is primarily used for regional delivery to treat hepatic metastasis (14) . The objectives of this study were to measure several key determinants of sensitivity to fluoropyrimidines and to compare either protein or mRNA expression with the growth-inhibitory activity of 5-FU and FdUrd in the NCI database. The targets selected included TS, TK, and DPD. TS governs the de novo synthesis of TMP (thymidylate) from dUMP. In the presence of 5,10-methylenetetrahydrofolate, FdUMP forms a slowly reversible covalent complex with TS. TS inhibition leads to both depletion of TTP, which is necessary for DNA synthesis and repair, and accumulation of dUMP. Both FdUMP and dUMP can be anabolized to the triphosphate forms and then become incorporated into DNA. These "incorrect" residues are recognized and removed from DNA through the action of the uracil base excision repair complex. Uracil DNA glycosylase removes the fraudulent nucleobase, followed by excision of the base-free sugar phosphate residue by an AP endonuclease, thus creating a single strand break. TS inhibition is accompanied by elevation of dATP pools, thus accentuating the deoxynucleotide imbalance. Depending on the severity of the genotoxic stress, apoptosis pathways may be induced. TK converts FdUrd to FdUMP. DPD inactivates 5-FU by catalyzing its conversion to dihydrofluorouracil. The rationale for selecting these particular molecular targets is based on evidence that increased expression of TS and DPD is associated with insensitivity to 5-FU in both preclinical and clinical studies, whereas decreased expression of TK leads to insensitivity to FdUrd (15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30) .


   MATERIALS AND METHODS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Frozen cell pellets were provided by the cell culture facility at the Frederick Cancer Research Facility, Division of Cancer Treatment and Diagnosis, NCI for the current studies. Separate batches were supplied for the protein assays and the mRNA assays. [3H]Thymidine (25 Ci/mmol) was obtained from Moravek Biochemicals (Brea, CA). Unless otherwise stated, chemicals were obtained from Sigma Chemical Co. (St. Louis, MO).

Drug Sensitivity Testing.
The standard operating procedures used for drug sensitivity testing in the NCI cell line screen have been described previously (1) . The cell culture medium is prepared by adding 25 ml of FBS and 5 ml of 100 mM glutamine to 500 ml of RPMI 1640. The cells are grown at 37°C in a humidified atmosphere with 5% CO2. Cell lines are dispersed into a series of 96-well microtiter plates; the inoculation densities vary, depending on the growth characteristics of each particular cell line. The cells are incubated for 24 h in the absence of drug, and then serial 10-fold dilutions of drug are added. After a 48-h incubation, the protein content is determined by sulforhodamine B staining. The percentage growth inhibition is determined by the following equation: , where T0 is the absorbance of the wells at time zero prior to adding drugs, T is absorbance of the test wells after 48 h of drug exposure, and C is the absorbance of control wells after 48 h incubation. The GI50s in the Developmental Therapeutics Program database represent a median of 656 separate experiments (range, 7–687) for 5-FU and a median of 109 separate experiments (range, 1–123) for FdUrd.

Measurement of TK Activity.
TK activity was determined by measuring the rate of conversion of radiolabeled thymidine to thymidine nucleotides (31) . The frozen cell pellets were brought up in a solution containing 50 mM Tris (pH 7.4), 1 mM EDTA (pH 7.4), 10% glycerol, and 5 mM ß-mercaptoethanol, and a cellular lysate was prepared by sonication on ice. An aliquot of the lysate containing 200–300 µg of protein was incubated in a 1.5-ml microcentrifuge tube that contained the following (final concentrations): 0.1 mM thymidine, 220,000 dpm [3H]thymidine, 10 mM ATP, 50 mM Tris-HCl (pH 8.0), 5 mM MgCl2, and 10 mM sodium fluoride. The samples were incubated in a shaking water bath at 37°C for 15 min. The reaction was stopped by placing the tubes in boiling water for 1 min. A aliquot of the sample (50 µl) was spotted on each of two 25-mm Whatman DE81 filters labeled in pencil with a sample identifier. After drying, the discs were washed three times with distilled water, and then each was then placed in a scintillation vial, following which 1 ml 0.2 N HCl/0.4 M KCl was added. The vials were gently agitated for 15 min on an orbital shaker, and then scintillation fluid was added; radioactivity was determined in a liquid scintillation counter. The activity was calculated by the following equation: . The amount of protein in the cellular lysate was determined by the Bio-Rad protein dye (Hercules, CA) using a standard curve of BSA, fraction V.

Determination of TS Protein Content.
TS protein content was determined by semiquantitative Western blot analysis as described previously (32) . Equal amounts of protein from a cellular lysate were loaded onto a 12.5% polyacrylamide gel. TS106 monoclonal antibody was the primary antibody, and horseradish peroxidase goat antimouse IgG was the secondary antibody. The antigen/antibody complexes were visualized using the Enhanced Chemiluminescence kit (ECL Amersham, Evanston, IL). Each gel included a reference cell line (NCI-H630 colon cancer cells) to permit assessment of relative protein content across gels. The blots were stripped and reprobed with antibody to {alpha}-tubulin to correct for possible differences in protein loading.

mRNA Extraction, cDNA Synthesis, and PCR Quantitation of TS and DPD mRNA.
mRNA was isolated using the QuickPrep micro-mRNA isolation kit (Amersham Pharmacia Biotech, Inc., Piscataway, NJ) according to the manufacturer’s instructions. The mRNA was immediately reverse transcribed using random hexamers as described previously (33) . Real-time quantitative PCR amplification was performed using specific target, doubly labeled fluorogenic probes with the ABI Prism 7700 Sequence Detection System (PE Applied Biosystems, Foster City, CA). Primers and probes were selected with Primer Express software version 1.0 (PE Applied Biosystems). The specificity of the chosen sequences was confirmed by conducting BlastN searches (GenBank). The expression of the ß-actin gene was used as an internal standard. The TaqMan probes were labeled with 6-carboxy-fluorescein (5'-end) and 6-carboxy-tetramethylrhodamine (3'-end). The sequences were as follows: TS, forward primer (p763) = GGCCTCGGTGTGCCTTT, reverse primer (p 825) = GATGTGCGCAATCATGTACGT, and TaqMan probe (p 781), AACATCGCCAGCTACGCCCTGC; DPD, forward primer (p 70) = TCACTGGCAGACTCGAGACTGT, reverse primer (p 201) = TGGCCGAAGTGGAACACA, and TaqMan Probe (p 108) = CCGCCGAGTCCTTACTGAGCACAGG; and ß-actin, forward primer (p 592) = TGAGCGCGGCTACAGCTT, reverse primer (p 651) = TCCTTAATGTCACGCACGATTT, and TaqMan probe (p 611) = ACCACCACGGCCGAGCGG.

Serial dilutions of the cDNA were prepared. During the PCR reaction, the reporter signal is normalized to an internal passive reference dye (ROX) to correct for any non-PCR-related fluctuations in fluorescence signal. The cycle number at which the normalized fluorescent signal exceeds the threshold (CT) is inversely proportional to the log of the quantity of input cDNA (set at 10 times the background fluorescence). Each 96-well plate contained a control cDNA sample to allow correction for plate-to-plate variability. By assigning relative mRNA values to wells containing the calibrator, the CT for each well is converted to a quantity of mRNA. A graph was constructed with input cDNA on the X axis and mRNA quantity on the Y axis. Relative mRNA expression was determined by dividing the slope of the regression line for the target of interest by the slope of the regression line for ß-actin. TS mRNA was normalized to NCI-H630 cells, and DPD mRNA was normalized to SK-1, a human hepatocellular line.

Measurement of Thymidine Levels in FBS.
Because the standard operating procedure of the NCI cell line screen uses 5% FBS that is nondialyzed, the thymidine concentration was measured. The cell line screen currently is using FBS from BioWhittaker (Lot 0So83F); prior to that, FBS from Life Technologies, Inc. (Lot 100863) was used. A standard curve was constructed using dialyzed FBS; 1-ml aliquots of dialyzed FBS were spiked with thymidine ranging from 0.2 to 50 nmol, and each sample was spiked with 50 nmol FdUrd (the internal standard). Four 1-ml aliquots of the current lot of FBS from BioWhittaker and from a random lot of FBS from Life Technologies, Inc. were spiked with 50 nmol of FdUrd only. Glacial acetic acid, 50 µl, was added to decrease protein binding of the nucleosides. The samples were vortex mixed and then deproteinized with 2 ml of acetonitrile. After centrifugation (2000 x g for 20 min at 4°C), the supernatant was collected and concentrated to dryness under a stream of filtered, compressed air. The samples were resuspended in 500 µl of water and filtered through a 0.2 µm syringe filter; 200 µl from each sample were placed in a autosampler vial. The samples were analyzed by reversed-phase HPLC using a 4.6 x 250 mm Aqua column (Phenomenex, Torres, CA). The mobile phase was 1% glacial acetic acid/1.4% acetonitrile run at 1 ml/min for 40 min; the column was washed with 70% acetonitrile for 2 min and equilibrated at initial conditions for 6 min prior to the next run. FdUrd and thymidine were monitored at 268 nm, and the retention times were 16.17 ± 0.43 min and 28.53 ± 0.72 min (mean ± SD), respectively. A standard curve was constructed by plotting the total nmol thymidine per ml versus the ratio of the areas of thymidine/FdUrd. The recovery of the nucleosides was determined by comparison with a standard curve prepared in water that was not subjected to the extraction procedure. The recovery of FdUrd and thymidine were 88.5 ± 4.1% and 88.0 ± 10.6%, respectively. The within-run coefficients of variation averaged 12.8 ± 0.92%, and the between-run coefficients of variation were 2.22 ± 1.25%. Quality control samples included with each HPLC run were within 1.3% of the predicted value.

Statistical and Graphical Analysis.
Graphical analysis was performed with SigmaPlot 2000 for Windows (SPSS, Inc., Chicago, IL), and statistical analysis was performed with SigmaStat for Windows version 2.03 (SPSS, Inc.). The strength of linear association between pairs of variables was determined by the Pearson product moment correlation coefficient: r = 0.70, strong correlation; 0.5 < r < 0.7, moderately strong correlation; and r = 0.3–0.5, weak to moderate correlation. The Wilcoxon rank sum test was used to test whether values of continuous variables differed between groups separated into two subsets with respect to values falling above or below the median for the group.


   RESULTS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Sensitivity to 5-FU and FdUrd by Histological Groups.
The parameters of interest by individual cell line are shown in Table 1Citation Citation , whereas the median values for each histological group are presented in Table 2Citation . Mean graph representations for log-transformed target data and GI50s are shown in Fig. 1Citation Citation . A striking degree of variability was seen for the GI50s for a 48-h drug exposure to 5-FU (653-fold) and FdUrd (946-fold). Overall, the colon cancer panel was the most sensitive to 5-FU, whereas the CNS, ovary, and breast cancer panels had median GI50s >45 µM. Five of the nine histological panels had a median FdUrd GI50 <1 µM, whereas the ovarian panel was the least sensitive.


View this table:
[in this window]
[in a new window]
  		Table 1 Summary of target expression

 

View this table:
[in this window]
[in a new window]
  		Table 1A Continued

 

View this table:
[in this window]
[in a new window]
  		Table 2 Median values for each histological group

 


View larger version (59K):
[in this window]
[in a new window]
  		Fig. 1. Mean plot representations of the targets, 5-FU and FdUrd. The expression of each target was log transformed, and the mean was then calculated. To generate the mean plot, the mean value was subtracted from that of each individual cell line. A, TK activity. B, TS protein content. C, TS mRNA expression. D, DPD mRNA expression. E, 5-FU. F, FdUrd.

 


View larger version (56K):
[in this window]
[in a new window]
  		Fig. 1A. Continued.

 
FdUrd is predominantly metabolized to FdUMP and is a more selective inhibitor of TS. 5-FU can be metabolized to both FdUMP and to FUTP; the subsequent incorporation of the latter into RNA interferes with normal RNA processing and function. Because the mechanism of action with 5-FU is broader than that of FdUrd, we compared the cytotoxicity of these two drugs. The GI50s for FdUrd were 34-fold lower than those of 5-FU (median, 0.82 versus 20.75 µM; P < 0.001, paired rank sum test). Because of the wide range of GI50s, a comparison between 5-FU and FdUrd values was performed after log transformation. A moderately strong correlation was seen among 63 cell lines (Fig. 2)Citation .



View larger version (13K):
[in this window]
[in a new window]
  		Fig. 2. Correlation between GI50s for 5-FU and fluorodeoxyuridine. The 50% growth inhibitory concentrations (log transformation of the GI50 in molar units) after a 48-h drug exposure for 5-FU and FdUrd for 63 cell lines are shown. The Pearson correlation coefficient and P are shown. The tendency for both GI50s to increase in concert was highly significant.

 
TK Activity.
TK activity, determined in 54 cell lines, varied by 37-fold. The median values were highest in the breast cancer and leukemia panels. Although a correlation between TK activity and sensitivity to FdUrd was expected, no such relation was seen with either FdUrd or 5-FU (data not shown).

TS Protein Content and mRNA Expression.
TS protein content varied 59-fold among the 55 cell lines tested. The leukemia panel had the highest median TS protein level, whereas the median values for the other histologies were similar. TS mRNA expression varied by a similar magnitude (53-fold). Because TS expression is regulated at both the transcriptional and translational level, an important question is how closely the TS mRNA and protein levels match. A weak to moderate correlation was noted (Fig. 3)Citation .



View larger version (15K):
[in this window]
[in a new window]
  		Fig. 3. Relationship between TS mRNA expression and protein content. Both TS protein content and TS mRNA expression were normalized versus NCI-H630 cells and thus have arbitrary units. The Pearson correlation coefficient and P are shown. TS protein content tended to increase in parallel with TS mRNA expression (n = 46), and P indicates that the slope was significantly different from zero.

 
Although we expected that TS expression would influence sensitivity to 5-FU and FdUrd, no such correlation was seen (data not shown). If the data were sorted by TS protein content, no appreciable differences in the 5-FU GI50s were evident among the cell lines with TS protein below the median versus those with higher values (22.4 and 16.8 µM), or for FdUrd (1.02 and 0.54 µM). Similarly, the distribution of 5-FU and FdUrd GI50s overlapped in cell lines with lower versus higher TS mRNA expression: 5-FU, 24.1 versus 13.7 µM; FdUrd, 0.58 versus 0.75 µM, respectively.

DPD mRNA Expression.
DPD expression showed a tremendous degree of variability. Two of the 50 cell lines tested (melanoma line UACC257 and leukemia line K562) had no detectable DPD mRNA expression. Five other lines (colon lines COLO 205, HCC 2998, SW620, and melanoma lines MALME 3M and SK MEL-5) had extremely low levels. Thus, the colon cancer and melanoma panels had the lowest median DPD values, whereas the CNS panel had the highest value. When TS and DPD were normalized to ß-actin, on average, DPD mRNA expression was 42-fold lower than TS mRNA expression (data not shown). The cell lines with DPD values below the median tended to be more sensitive to 5-FU than the lines with higher DPD expression (12.9 versus 36.2 µM), whereas sensitivity to FdUrd was not affected by DPD expression (0.77 versus 0.58 µM, respectively; Fig. 4Citation ).



View larger version (23K):
[in this window]
[in a new window]
  		Fig. 4. GI50 values stratified according to lower versus higher DPD mRNA expression. The 50 cell lines in which DPD mRNA expression was available were stratified into two groups relative to the median; the distribution of 5-FU or FdUrd GI50s according to DPD mRNA expression is presented in box plot format; the median value is displayed. The top and bottom of the rectangles are the 75th and 25th percentiles; the top and bottom whiskers are the 90th and 10th percentiles. •, 95th and 5th percentiles.

 
Correlations with Cell Line Doubling Times.
Because cytotoxicity is determined at hour 48 of drug exposure under the standard protocol for the NCI cell line screen, cellular doubling time is a potentially important variable in drug sensitivity. The doubling times of the cell line panel have been published previously (34) . The median time is 34 h and ranges from 18 to 88 h. As might have been predicted, cell lines with faster doubling times (<median) were significantly more sensitive to both 5-FU (median GI50, 5.0-fold lower; Fig. 5ACitation ) and FdUrd (median GI50, 4.9-fold lower; Fig. 5BCitation ). The rate of cellular proliferation is thought to influence expression of TS and TK. Cell lines with faster doubling times tended to have higher TK activities (median, 1.9-fold higher; Fig. 5CCitation ) and TS protein content (median, 1.5-fold higher; Fig. 5DCitation ).



View larger version (23K):
[in this window]
[in a new window]
  		Fig. 5. Correlations with doubling times. The doubling times of the cell lines have been published previously (34) . For each pair of variables, the data were stratified into two groups (above and below median) according to the published doubling times for the cell line panel. The data are presented in box plot format, as described in the legend to Fig. 4Citation . P for the rank sum test is shown.

 
Correlations with p53 Gene Mutation.
Mutations in p53 tend to render cells less sensitive to the effects of DNA-damaging agents. Because TS inhibition is associated with induction of DNA strand breaks and interference with DNA repair, we evaluated whether p53 gene status influenced sensitivity to fluoropyrimidines. The p53 gene status is known in 59 of the lines tested in the current study, and 68% have a mutation (34) . Cell lines with wild-type p53 were significantly more sensitive to 5-FU (median GI50, 9.0 versus 29.4 µM; Fig. 6Citation , top panel) and to FdUrd (median GI50, 0.36 versus 1.04 µM; Fig. 6Citation , bottom panel).



View larger version (19K):
[in this window]
[in a new window]
  		Fig. 6. Influence of p53 gene status on sensitivity to 5-FU and FdUrd. The p53 status of the cell lines in the NCI drug screening panel have been published previously (34) . Information was available in 59 cell lines that included GI50s for 5-FU and FdUrd as well as the p53 mutational status. Cells with wild-type p53 were significantly more sensitive to 5-FU (top), and to a lesser extent, to FdUrd.

 
Determination of Thymidine Levels in FBS.
To estimate the extracellular thymidine concentrations under the standard operating conditions of the NCI cell line screen, thymidine levels in two different lots of FBS from different suppliers used by the NCI cell line screen were determined. The concentrations in four replicate samples from each lot were 4.57 ± 0.28 µM and 4.65 ± 0.17 µM (mean ± SD). Because the amount of FBS was diluted to 4.7% of the total volume of the cell culture medium, the final thymidine concentration would therefore be ~0.22 µM. In contrast, 10–20 µM thymidine is typically required in in vitro models to protect against the toxicity of 5-fluoropyrimidines (35, 36, 37) .


   DISCUSSION
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
The present study was undertaken as part of an ongoing effort to characterize the molecular and biochemical profile of the cancer cell lines that comprise the NCI’s drug screening panel. There was a surprising degree of variability in the GI50s for a 48-h exposure to both 5-FU and FdUrd in this model. The tolerated 5-FU dose when given by weekly 48-h continuous infusion is 1750 mg/m2/24 h (38) . When 5-FU is given as a 48-h infusion every 2 weeks with two consecutive daily doses of 500 mg/m2 leucovorin, the recommended 5-FU dose is 1500–2000 mg/m2/24 h (39) . The achievable 5-FU plasma levels with such doses is in the range of 5–7 µM (40, 41, 42) . The 5-FU GI50 was <10 µM in only 30% of the cell lines. The cell lines were significantly more sensitive to FdUrd, and the GI50 was <1 µM in 57%. There is no published clinical experience with a 48-h continuous infusion of FdUrd to provide a reference for achievable plasma levels.

No correlation was noted between TK activity and sensitivity to either FdUrd or 5-FU. Previous investigators have reported that the basis for insensitivity of cancer cell lines selected in vitro for resistance to FdUrd has been either deletion of TK, which would prevent activation of the drug, or deficiency in facilitated nucleoside transport, which would limit cellular permeation (26, 27, 28, 29, 30 , 43, 44) . None of the cell lines in the panel have been subjected to such selection pressure, and TK activity was detectable in every cell line. The membrane-based facilitated nucleoside transport system is complex and composed of at least eight distinct members. This latter target has not yet been characterized in the NCI cell line panel. However, cell lines deficient in nucleoside transport retain sensitivity to 5-FU, which uses a different facilitated transport system for pyrimidine and purine bases (43, 44, 45) .

TS protein and mRNA expression each varied by ~50-fold among the cell lines; there was a weak-moderate correlation between increasing TS mRNA expression and higher TS protein content. The correlation coefficient reflects the tightness of fit of the data points around the regression line, whereas the highly significant P indicates that the trend for TS mRNA and TS protein to increase in concert is not random.

On the basis of prior studies suggesting that high TS expression is associated with insensitivity to 5-FU, we anticipated seeing a correlation between either TS protein content and/or TS mRNA expression and GI50s in the present study. However, no such relationship was evident by either linear regression or when the values were stratified into two categories relative to the median values for the population. This lack of correlation may be attributable to a number of factors. The duration of drug exposure was only 48 h, whereas the median doubling time has been reported to be 34 h (34) . Indeed, the cell lines with faster doubling times were five times more sensitive to 5-FU and FdUrd than lines with slower doubling times. Duration of exposure to these two 5-fluoropyrimidines is known to be a critical factor influencing cytotoxicity (14) . The observation that the cancer lines with the fastest doubling times had significantly higher TS protein content may account for why TS protein content did not correlate with sensitivity to 5-FU and FdUrd.

The standard operating procedure of the NCI cell line screen specifies the use of nondialyzed FBS, which contains thymidine. The vendor of the FBS used by the NCI drug screen does not define the thymidine concentrations in their serum. Therefore, we measured the thymidine levels by an HPLC method. The concentration in two separate lots of FBS from two different suppliers used by the NCI cell line screening facility were about 4.6 µM. These results are consistent with the thymidine concentration in FBS in the component database of Hyclone Laboratories (Logan, UT): 5.3 ± 2.9 µM.3 However, because the contribution of FBS to the total volume of the cell culture medium is <5%, the final concentration in the medium is about 0.22 µM, which is at least 40-fold lower than the thymidine concentrations typically required for in vitro protection against 5-FU. Furthermore, the final thymidine concentration is in the range reported for thymidine in human plasma (46) , which is considered to be insufficient to protect against the cytotoxicity of TS inhibitors (47) . In addition, all of the cell lines were significantly more sensitive to FdUrd than to 5-FU (average GI50, 34-fold lower), a finding that would not be expected if the concentration of thymidine was sufficient to rescue the cells from FdUMP-mediated TS inhibition.

Lethality associated with 5-fluoropryimidines may in some cases be attributed to "post-replicative" cell death mechanisms, in which programmed cell death occurs in the cell cycle(s) subsequent to the one in which the cells were initially exposed to the damaging agent. Although the precise basis for delayed apoptosis is not clear, a possible explanation is that initial sublethal damage to genes that are essential for cell survival may ultimately lead to cell death with subsequent rounds of DNA replication (48) . The observation that the estimated 50% lethal concentration (LC50) for 5-FU was >1000 µM in 100% of the cell lines (data not shown) supports the premise that the culture methods used do not allow 5-FU-mediated lethality to become manifest. Similarly, FdUrd was not associated with lethality in this 48-h assay; only 2 of 63 lines had a LC50 <10 µM, and the LC50 was >1000 µM in 94% of the lines. Factors operating downstream from the targets analyzed also play a pivotal role in 5-FU sensitivity. The pattern and extent of DNA damage induced by 5-fluoropyrimidines in human cancer cell lines varies and may be affected not only by the activity of enzymes involved in DNA repair but also by downstream pathways that are required to implement cellular destruction (49, 50, 51) . There was a striking association between wild-type p53 gene status and sensitivity to 5-FU; although there was greater variability, p53 gene status also influenced sensitivity to FdUrd. This observation is consistent with the literature indicating that although TS inhibition is necessary for induction of apoptosis, downstream factors such as p53, Bcl-2, and dUTPase influence whether TS inhibition is sufficient for cell death (49, 50, 51) .

DPD mRNA expression showed the greatest degree of variability. Two cell lines had no detectable DPD mRNA expression using a primer/probe set that evaluated the 5' portion of the message. In addition, five other lines had extremely low levels of DPD mRNA expression. Although there was no linear correlation between DPD mRNA expression and GI50s, cell lines with lower DPD values tended to be more sensitive to 5-FU, whereas no such no relationship was noted between DPD expression and FdUrd sensitivity.

In summary, we found no correlation between either TS mRNA expression, TS protein content, or TK activity and sensitivity to either 5-FU or FdUrd when cytotoxicity was assessed by the standard operating procedures of the NCI drug screen. Wild-type p53 status was a strong predictor of sensitivity to 5-FU and to a lesser extent, to FdUrd, suggesting that factors operating downstream from the targets measured may be more important determinants of sensitivity to 5-fluoropyrimidines under these experimental conditions. In view of the known relevance of TS as a determinant of response to 5-FU-based therapy in the clinical arena, the lack of correlation between TS expression and sensitivity to 5-FU/FdUrd raises a cautionary note regarding interpretation of correlative data using the standard protocol of the cell line screen. Future compounds with unknown or novel mechanisms of action will be tested under a similar, specific protocol. Our results raise the concern that this protocol may fail to detect potentially useful activity of compounds with unknown or novel mechanisms of action, particularly when the agents are not associated with early induction of programmed cell death.


   FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 To whom requests for reprints should be addressed, at NCI-Medicine Branch, National Naval Medical Center, Building 8, Room 5101, 8901 Wisconsin Avenue, Bethesda, MD 20889-5105; Phone: (301) 435-5382; Fax: (301) 480-1683. Back

2 The abbreviations used are: NCI, National Cancer Institute; 5-FU, 5-fluorouracil; FdUrd, 5-fluoro-2'-deoxyuridine; FdUMP, 5-fluoro-2'-deoxyuridine 5'-monophosphate; TS, thymidylate synthase; TK, thymidine kinase; DPD, dihydropyrimidine dehydrogenase; FBS, fetal bovine serum; GI50, concentration of drug that produces 50% growth inhibition; HPLC, high performance liquid chromatography; CNS, central nervous system. Back

3 Internet address: http://www.hyclone.com/comp_request/index.htm. Back

Received 6/28/00; revised 12/28/00; accepted 1/ 8/01.


   REFERENCES
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Monks A., Scudiero D., Skehan P., Shoemaker R., Paull K., Vistica D., Hose C., Langley J., Cronise P., Vaigro-Wolff A., et al Feasibility of a high-flux anticancer drug screen using a diverse panel of cultured human tumor cell lines. J. Natl. Cancer Inst., 83: 757-766, 1991.[Abstract/Free Full Text]
  2. Stinson S. F., Alley M. C., Kopp W. C., Fiebig H. H., Mullendore L. A., Pittman A. F., Kenney S., Keller J., Boyd M. R. Morphological and immunocytochemical characteristics of human tumor cell lines for use in a disease-oriented anticancer drug screen. Anticancer Res., 12: 1035-1053, 1992.[Medline]
  3. Grever M. R., Schepartz S. A., Chabner B. A. The National Cancer Institute: cancer drug discovery and development program. Semin. Oncol., 19: 622-638, 1992.[Medline]
  4. Boyd M. R., Paull K. D. Some practical considerations and applications of the National Cancer Institute in vitro anticancer drug discovery screen. Drug Dev. Res., 34: 91-109, 1995.[CrossRef]
  5. Monks A., Scudiero D. A., Johnson G. S., Paull K. D., Sausville E. A. The NCI anti-cancer drug screen: a smart screen to identify effectors of novel targets. Anticancer Drug Des., 12: 533-541, 1997.[Medline]
  6. Paull K. D., Shoemaker R. H., Hodes L., Monks A., Scudiero D. A., Rubinstein L., Plowman J., Boyd M. R. Display and analysis of patterns of differential activity of drugs against human tumor cell lines: development of mean graph and compare algorithm. J. Natl. Cancer Inst., 81: 1088-1092, 1989.[Abstract/Free Full Text]
  7. Hodes L., Paull K., Koutsoukos A., Rubinstein L. Exploratory data analytic techniques to evaluate anticancer agents screened in a cell culture panel. J. Biopharm. Stat., 2: 31-48, 1992.[Medline]
  8. Weinstein J. N., Kohn K. W., Grever M. R., Viswanadhan V. N., Rubinstein L. V., Monks A. P., Scudiero D. A., Welch L., Koutsoukos A. D., Chiausa A. J., Paull K. D. Neural computing in cancer drug development: predicting mechanism of action. Science (Washington DC), 258: 447-451, 1992.[Abstract/Free Full Text]
  9. Koutsoukos A. D., Rubinstein L. V., Faraggi D., Simon R. M., Kalyandrug S., Weinstein J. N., Kohn K. W., Paull K. D. Discrimination techniques applied to the NCI in vitro anti-tumour drug screen: predicting biochemical mechanism of action. Stat. Med., 13: 719-730, 1994.[Medline]
  10. Weinstein J. N., Myers T. G., O’Connor P. M., Friend S. H., Fornace A. J., Jr., Kohn K. W., Fojo T., Bates S. E., Rubinstein L. V., Anderson N. L., Buolamwini J. K., van Osdol W. W., Monks A. P., Scudiero D. A., Sausville E. A., Zaharevitz D. W., Bunow B., Viswanadhan V. N., Johnson G. S., Wittes R. E., Paull K. D. An information-intensive approach to the molecular pharmacology of cancer. Science (Washington DC)., 275: 343-349, 1997.[Abstract/Free Full Text]
  11. Bates S. E., Fojo A. T., Weinstein J. N., Myers T. G., Alvarez M., Pauli K. D., Chabner B. A. Molecular targets in the National Cancer Institute drug screen. J. Cancer Res. Clin. Oncol., 121: 495-500, 1995.[CrossRef][Medline]
  12. Leteurtre F., Kohlhagen G., Paull K. D., Pommier Y. Topoisomerase II inhibition and cytotoxicity of the anthrapyrazoles DuP 937 and DuP 941 (Losoxantrone) in the National Cancer Institute preclinical antitumor drug discovery screen. J. Natl. Cancer Inst., 86: 1239-1244, 1994.[Abstract/Free Full Text]
  13. Cholody W. M., Hernandez L., Hassner L., Scudiero D. A., Djurickovic D. B., Michejda C. J. Bisimidazoacridones and related compounds: new antineoplastic agents with high selectivity against colon tumors. J. Med. Chem., 38: 3043-3052, 1995.[CrossRef][Medline]
  14. Grem J. L. Fluoropyrimidines Ed. 2 Chabner B. A. Longo D. L. eds. . Cancer Chemotherapy and Biotherapy: Principles and Practice, : 149-211, Lippincott-Raven Publishers Philadelphia 1996.
  15. Alexander H. R., Grem J. L., Hamilton J. M., Pass H. I., Hong M., Fraker D. L., Steinberg S. M., McAtee N., Allegra C. J., Johnston P. G. Thymidylate synthase protein expression association with response to neoadjuvant chemotherapy and resection for locally advanced gastric and gastroesophageal adenocarcinoma. Cancer (Phila.), 1: 49-54, 1995.
  16. Johnston P. G., Lenz H. J., Leichman C. G., Danenberg K. D., Allegra C. J., Danenberg P. V., Leichman L. Thymidylate synthase gene and protein expression correlate and are associated with response to 5-fluorouracil in human colorectal and gastric tumors. Cancer Res., 55: 1407-1412, 1995.[Abstract/Free Full Text]
  17. Lenz H. J., Leichman C. G., Danenberg K. D., Danenberg P. V., Groshen S., Cohen H., Laine L., Crookes P., Silberman H., Baranda J., Garcia Y., Li J., Leichman L. Thymidylate synthase mRNA level in adenocarcinoma of the stomach: a predictor for primary tumor response and overall survival. J. Clin. Oncol., 14: 176-182, 1996.[Abstract]
  18. Leichman C. G., Lenz H. J., Leichman L., Danenberg K., Baranda J., Groshen S., Boswell W., Metzger R., Tan M., Danenberg P. V. Quantitation of intratumoral thymidylate synthase expression predicts for disseminated colorectal cancer response and resistance to protracted-infusion fluorouracil and weekly leucovorin. J. Clin. Oncol., 15: 3223-3229, 1997.[Abstract]
  19. Kornmann M., Link K. H., Lenz H. J., Pillasch J., Metzger R., Butzer U., Leder G. H., Weindel M., Safi F., Danenberg K. D., Beger H. G., Danenberg P. V. Thymidylate synthase is a predictor for response and resistance in hepatic artery infusion chemotherapy. Cancer Lett., 118: 29-35, 1997.[CrossRef][Medline]
  20. Lenz H. J., Hayashi K., Salonga D., Danenberg K. D., Danenberg P. V., Metzger R., Banerjee D., Bertino J. R., Groshen S., Leichman L. P., Leichman C. G. p53 point mutations and thymidylate synthase messenger RNA levels in disseminated colorectal cancer: an analysis of response and survival. Clin. Cancer Res., 4: 1243-1250, 1998.[Abstract]
  21. Lenz H. J., Danenberg K. D., Leichman C. G., Florentine B., Johnston P. G., Groshen S., Zhou L., Xiong Y. P., Danenberg P. V., Leichman L. P. p53 and thymidylate synthase expression in untreated stage II colon cancer: associations with recurrence, survival, and site. Clin. Cancer Res., 4: 1227-1234, 1998.[Abstract]
  22. Ishikawa Y., Kubota T., Otani Y., Watanabe M., Teramoto T., Kumai K., Kitajima M., Takechi T., Okabe H., Fukushima M. Dihydropyrimidine dehydrogenase activity and messenger RNA level may be related to the antitumor effect of 5-fluorouracil on human tumor xenografts in nude mice. Clin. Cancer Res., 5: 883-889, 1999.[Abstract/Free Full Text]
  23. Fischel J. L., Etienne M. C., Spector T., Formento P., Renee N., Milano G. Dihydropyrimidine dehydrogenase: a tumoral target for fluorouracil modulation. Clin. Cancer Res., 1: 991-996, 1995.[Abstract]
  24. Etienne M. C., Cheradame S., Fischel J. L., Formento P., Dassonville O., Renee N., Schneider M., Thyss A., Demard F., Milano G. Response to fluorouracil therapy in cancer patients: the role of tumoral dihydropyrimidine dehydrogenase activity. J. Clin. Oncol., 13: 1663-1670, 1995.[Abstract/Free Full Text]
  25. Salonga D., Danenberg K. D., Johnson M., Metzger R., Groshen S., Tsao-Wei D. D., Lenz H. J., Leichman C. G., Leichman L., Diasio R. B., Danenberg P. V. Colorectal tumors responding to 5-fluorouracil have low gene expression levels of dihydropyrimidine dehydrogenase, thymidylate synthase, and thymidine phosphorylase. Clin. Cancer Res., 6: 1322-1327, 2000.[Abstract/Free Full Text]
  26. Mulkins M. A., Heidelberger C. Isolation of fluoropyrimidine-resistant murine leukemic cell lines by one-step mutation and selection. Cancer Res., 42: 956-964, 1982.[Abstract/Free Full Text]
  27. Mulkins M. A., Heidelberger C. Biochemical characterization of fluoropyrimidine-resistant murine leukemic cell lines. Cancer Res., 42: 965-973, 1982.[Abstract/Free Full Text]
  28. Inaba M., Naoe Y., Mitsuhashi J. Mechanisms for 5-fluorouracil resistance in human colon cancer DLD-1 cells. Biol. Pharm. Bull., 21: 569-573, 1998.[Medline]
  29. van der Wilt C. L., Smid K., Veerman G., Peters G. J. The role of thymidine kinase activity in murine colon tumours treated with 5-fluorouracil. Adv. Exp. Med. Biol., 431: 653-656, 1998.[Medline]
  30. Agarwal R. P., Han T., Fernandez M. Collateral resistance of a dideoxycytidine-resistant cell line to 5-fluoro-2'-deoxyuridine. Biochem. Biophys. Res. Commun., 262: 657-660, 1999.[CrossRef][Medline]
  31. Munch-Petersen B. Differences in the kinetic properties of thymidine kinase isoenzymes in unstimulated and phytohemagglutinin-stimulated human lymphocytes. Mol. Cell. Biochem., 64: 173-185, 1984.[CrossRef][Medline]
  32. Johnston P. G., Drake J. C., Trepel J., Allegra C. J. Immunological quantitation of thymidylate synthase using the monoclonal antibody TS106 in 5-fluorouracil-sensitive and -resistant human cancer cell lines. Cancer Res., 52: 4306-4312, 1992.[Abstract/Free Full Text]
  33. Horikoshi T., Danenberg K., Stadbauer T. H. W., Volkenandt M., Shea L. C. C., Aigner K., Gustavsson B., Leichman L., Frösing R., Ray M., Gibson N., Spears C. P., Danenberg P. V. Quantitation of thymidylate synthase, dihydrofolate reductase, and DT-diaphorase gene expression in human tumors using the polymerase chain reaction. Cancer Res., 52: 108-116, 1992.[Abstract/Free Full Text]
  34. O’Connor P. M., Jackman J., Bae I., Myers T. G., Fan S., Mutoh M., Scudiero D. A., Monks A., Sausville E. A., Weinstein J. N., Friend S., Fornace A. J., Jr., Kohn K. W. Characterization of the p53 tumor suppressor pathway in cell lines of the National Cancer Institute anticancer drug screen and correlations with the growth-inhibitory potency of 123 anticancer agents. Cancer Res., 57: 4285-4300, 1997.[Abstract/Free Full Text]
  35. Grem J. L., Fischer P. H. Augmentation of 5-fluorouracil cytotoxicity in human colon cancer cells by dipyridamole. Cancer Res., 45: 2967-2972, 1985.[Abstract/Free Full Text]
  36. Johnston P. G., Geoffrey F., Drake J., Voeller D., Grem J. L., Allegra C. J. The cellular interaction of 5-fluorouracil and cisplatin in a human colon carcinoma cell line. Eur. J. Cancer, 32A: 2148-2154, 1996.[CrossRef]
  37. Ren Q., Van Groeningen C. J., Hardcastle A., Aherne G. W., Geoffroy F., Allegra C. J., Johnston P. G., Grem J. L. Determinants of cytotoxicity with prolonged exposure to fluorouracil in human colon cancer cells. Oncol. Res., 9: 77-88, 1997.[Medline]
  38. Aranda E., Diaz-Rubio E., Cervantes A., Anton-Torres A., Carrato A., Massuti T., Tabernero J. M., Sastre J., Tres A., Aparicio J., Lopez-Vega J. M., Barneto I., Garcia-Conde J. Randomized trial comparing monthly low-dose leucovorin and fluorouracil bolus with weekly high-dose 48-hour continuous-infusion fluorouracil for advanced colorectal cancer: a Spanish Cooperative Group for Gastrointestinal Tumor Therapy (TTD) study. Ann. Oncol., 9: 727-731, 1998.[Abstract/Free Full Text]
  39. Beerblock K., Rinaldi Y., Andre T., Louvet C., Raymond E., Tournigand C., Carola E., Favre R., de Gramont A., Krulik M. Bimonthly high dose leucovorin and 5-fluorouracil 48-hour continuous infusion in patients with advanced colorectal carcinoma. Groupe d’Etude et de Recherche sur les Cancers de l’Ovaire et Digestifs (GERCOD). Cancer (Phila.), 79: 1100-1105, 1997.[CrossRef][Medline]
  40. Erlichman C., Fine S., Elhakim T. Plasma pharmacokinetics of 5-FU given by continuous infusion with allopurinol. Cancer Treat. Rep., 70: 903-904, 1986.[Medline]
  41. Remick S. C., Grem J. L., Fischer P. H., Tutsch K. D., Alberti D. B., Nieting L. M., Tombes M. B., Bruggink J., Willson J. K., Trump D. L. Phase I trial of 5-fluorouracil and dipyridamole administered by 72-hour concurrent continuous infusion. Cancer Res., 50: 2667-2672, 1990.[Abstract/Free Full Text]
  42. Grem J. L., McAtee N., Steinberg S. M., Hamilton J. M., Murphy R. F., Drake J., Chisena T., Balis F., Cysyk R., Arbuck S. G., Balis F., Cysyk R., Goldstein L., Sorensen J. M., Chen A., Setser A., Jordan E., Goldspiel B., Carvalho M., Allegra C. J. A Phase I study of continuous infusion 5-fluorouracil plus calcium leucovorin in combination with n-(phosphonacetyl)-L-aspartate in metastatic gastrointestinal adenocarcinoma. Cancer Res., 53: 4828-4836, 1993.[Abstract/Free Full Text]
  43. Sobrero A. F., Moir R. D., Bertino J. R., Handschumacher R. E. Defective facilitated diffusion of nucleosides, a primary mechanism of resistance to 5-fluoro-2'-deoxyuridine in the HCT-8 human carcinoma. Cancer Res., 45: 3155-3160, 1985.[Abstract/Free Full Text]
  44. Sobrero A. F., Handschumacher R. E., Bertino J. R. Highly selective drug combinations for human colon cancer cells resistant in vitro to 5-fluoro-2'-deoxyuridine. Cancer Res., 45: 3161-3163, 1985.[Abstract/Free Full Text]
  45. Domin B. A., Mahony W. B., Zimmerman T. P. Transport of 5-fluorouracil and uracil into human erythrocytes. Biochem. Pharmacol., 46: 503-510, 1993.[CrossRef][Medline]
  46. Howell S. B., Mansfield S. J., Taetle R. Significance of variation in serum thymidine concentration for the marrow toxicity of methotrexate. Cancer Chemother. Pharmacol., 5: 221-226, 1981.[CrossRef][Medline]
  47. Takemura Y., Jackman A. L. Folate-based thymidylate synthase inhibitors in cancer chemotherapy. Anticancer Drugs, 8: 3-16, 1997.[CrossRef][Medline]
  48. Darzynkiewicz Z. Methods in analysis of apoptosis and cell necrosis Parker J. Stewart C. eds. . The Purdue Cytometry CD-ROM, Volume 3: J. Paul Robinson, Publisher Purdue University, West Lafayette 1997.
  49. Lowe S. W., Ruley H. E., Jacks T., Housman D. E. p53-dependent apoptosis modulates the cytotoxicity of anticancer agents. Cell, 74: 957-967, 1993.[CrossRef][Medline]
  50. Fisher T. C., Milner A. E., Gregory C. D., Jackman A. L., Aherne G. W., Hartley J. A., Dive C., Hickman J. A. Bcl-2 modulation of apoptosis induced by anticancer drugs: resistance to thymidylate stress is independent of classical resistance pathways. Cancer Res., 53: 3321-3326, 1993.[Abstract/Free Full Text]
  51. Canman C. E., Lawrence T. S., Shewach D. S., Tang H. Y., Maybaum J. Resistance to fluorodeoxyuridine-induced DNA damage and cytotoxicity correlates with an elevation of deoxyuridine triphosphatase activity and failure to accumulate deoxyuridine triphosphate. Cancer Res., 53: 5219-5224, 1993.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Cancer Res.Home page
C.-M. Hu and Z.-F. Chang
Synthetic Lethality by Lentiviral Short Hairpin RNA Silencing of Thymidylate Kinase and Doxorubicin in Colon Cancer Cells Regardless of the p53 Status
Cancer Res., April 15, 2008; 68(8): 2831 - 2840.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
J. M. Mariadason, D. Arango, Q. Shi, A. J. Wilson, G. A. Corner, C. Nicholas, M. J. Aranes, M. Lesser, E. L. Schwartz, and L. H. Augenlicht
Gene Expression Profiling-Based Prediction of Response of Colon Carcinoma Cells to 5-Fluorouracil and Camptothecin
Cancer Res., December 15, 2003; 63(24): 8791 - 8812.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
N. Magne, J.-L. Fischel, A. Dubreuil, P. Formento, J. Ciccolini, J.-L. Formento, C. Tiffon, N. Renee, S. Marchetti, M.-C. Etienne, et al.
ZD1839 (Iressa) Modifies the Activity of Key Enzymes Linked to Fluoropyrimidine Activity: Rational Basis for a New Combination Therapy with Capecitabine
Clin. Cancer Res., October 15, 2003; 9(13): 4735 - 4742.
[Abstract] [Full Text] [PDF]

Home page
 JCOHome page
C. J. Allegra, S. Paik, L. H. Colangelo, A. L. Parr, I. Kirsch, G. Kim, P. Klein, P. G. Johnston, N. Wolmark, and H. S. Wieand
Prognostic Value of Thymidylate Synthase, Ki-67, and p53 in Patients With Dukes' B and C Colon Cancer: A National Cancer Institute-National Surgical Adjuvant Breast and Bowel Project Collaborative Study
J. Clin. Oncol., January 15, 2003; 21(2): 241 - 250.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Grem, J. L.
Right arrow Articles by Allegra, C. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Grem, J. L.
Right arrow Articles by Allegra, C. J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online