Clinical Cancer Research Meeting Calendar Frontiers in Basic Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brabender, J.
Right arrow Articles by Danenberg, P. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brabender, J.
Right arrow Articles by Danenberg, P. V.
Clinical Cancer Research Vol. 7, 1850-1855, July 2001
© 2001 American Association for Cancer Research


Advances in Brief

Epidermal Growth Factor Receptor and HER2-neu mRNA Expression in Non-Small Cell Lung Cancer Is Correlated with Survival

Jan Brabender1, Kathleen D. Danenberg, Ralf Metzger, Paul M. Schneider, JiMin Park, Dennis Salonga, Arnulf H. Hölscher and Peter V. Danenberg

Department of Biochemistry and Molecular Biology and Norris Comprehensive Cancer Center, University of Southern California, Keck School of Medicine, Los Angeles, California 90033 [J. B., K. D. D., J. P., D. S., P. V. D.], and Department of Visceral and Vascular Surgery, University of Cologne, Cologne 50931, Germany [J. B., R. M., P. M. S., A. H. H.].


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
The prognostic role of epidermal growth factor receptor (EGFR) and HER2-neu remains controversial in patients with non-small cell lung cancer (NSCLC). We studied the association between the mRNA expression of EGFR, HER2-neu, and survival in primary tumor and matching nonmalignant tissues from 83 patients with NSCLC. Analysis was performed using a quantitative real-time PCR system (Taqman). EGFR and HER2-neu mRNA expression was detectable in all (100%) specimens analyzed. Twenty-nine (34.9%) patients had high HER2-neu expression, and 28 (33.7%) patients had high EGFR expression. A high HER2-neu and EGFR coexpression was detectable in 14 (16.9%) patients. High HER2-neu expression was associated with inferior survival (P = 0.004), whereas high EGFR expression showed a trend toward inferior survival (P = 0.176). The impact of HER2-neu and EGFR coexpression on patients’ survival was additive (P = 0.003). Multivariate analysis determined high HER2-neu expression (P = 0.041), and high EGFR/HER2-neu coexpression (P = 0.030) as significant and independent unfavorable prognostic factors. These findings indicate that HER2-neu and EGFR play a crucial role in the biological behavior of NSCLCs. Testing of molecular marker coexpression (EGFR and HER2-neu) improves the estimation of prognosis and appears to define low- and high-risk groups for treatment failure in curatively resected NSCLC.


    Introduction
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Lung cancer is the leading cause of cancer-related deaths among both males and females in Western countries. In the United States, approximately 171,000 new cases of lung cancer will be diagnosed, and 160,000 individuals will die from this disease, each year. Despite improvements in the detection and treatment of lung cancer in the past two decades, the overall 5-year survival remains <15% (1) . To improve further the survival rate in patients with NSCLC,2 their prognostic classification based on molecular alterations will be crucial. Such classifications could provide more accurate and useful diagnostic tools and, eventually, more effective therapeutic options.

EGFR (also known as erbB-1) and HER2-neu (also known as erbB-2) are members of the erbB gene family and encode for transmembrane receptor-type tyrosine-protein kinases (2 , 3) . The ligands of EGFR include epidermal growth factor, and transforming growth factor {alpha}, which, upon the binding of EGFR, transmit growth-stimulatory signals (4) . High levels of EGFR expression have been detected in several human malignancies, including NSCLC (5, 6, 7) . The prognostic importance of EGFR in NSCLC remains unclear. Studies using binding assays correlated increased EGFR expression with advanced stage (8) and shortened overall survival in NSCLC (9) , whereas studies using less quantitative techniques for EGFR mRNA or protein expression failed to show a consistent correlation with outcome (10, 11, 12) . HER2-neu protein overexpression has been demonstrated in NSCLC, including SCC, AC, and LC (7 , 13, 14, 15, 16) . Earlier studies, using protein assays, reported an association with HER2-neu protein overexpression and inferior overall survival in pulmonary ACs (14 , 17) , whereas others did not (11) .

To determine the frequency and prognostic relevance of EGFR and HER2-neu mRNA expression in NSCLC, we performed a real-time quantitative PCR (Taqman) analysis (18 , 19) on surgically removed tumor specimen and adjacent nonmalignant tissue from 83 patients with curatively resected NSCLC.


    Materials and Methods
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Patients.
Eighty-three patients were included in this study, consisting of sixty-five (78.3%) men and 18 (21.7%) women with a median age of 63.5 years (range, 34–82 years). Thirty-nine (47%) patients had SCCs, 32 (38.6%) had ACs, and 12 (14.5%) had LC. The primary tumors were graded histopathologically as well-differentiated (G1; one patient), moderately differentiated (G2; 18 patients), and poorly differentiated (G3; 64 patients). Tumor staging was performed according to the UICC Tumor-Node-Metastasis classification: 41 (49.4%) had stage I tumors; 16 (19.3%) had stage II tumors; and 26 (31.3%) had stage IIIa tumors. All tumors were completely resected (R0 category) by at least a lobectomy, as quality control. Patients with histopathological stage IIIa tumors received postoperative radiotherapy. The median follow-up was 85.9 months (minimum, 63.3 months, and maximum, 105.2 months), and no patient was lost to follow-up.

Tissue Acquisition.
Tissue for gene expression analysis was obtained immediately after lung resection before starting mediastinal lymphadenectomy and was immediately frozen in liquid nitrogen. Tissues were analyzed from the following two locations: (a) tumor; and (b) uninvolved lung tissue taken from the greatest distance to the tumor. Six-µm frozen sections were taken from blocks of tumor tissue, and starting with the first section, every fifth one was routinely stained with HE and histopathologically evaluated. Sections were pooled for RNA isolation from areas of estimated 75% malignant cells.

RNA Extraction and cDNA Synthesis.
Total RNA was isolated by a single-step guanidinium isothiocyanate method using the QuickPrepMicro mRNA Purification Kit (Amersham Pharmacia Biotech Inc., Piscataway, NJ) according to the manufacturer’s instructions. After RNA isolation, cDNA was prepared from each sample as described previously (20) .

PCR Quantification.
Quantitation of cDNAs and an internal reference gene (ß-actin) was done using a fluorescence-based, real-time detection method [ABI PRISM 7700 Sequence Detection System (Taqman); Perkin-Elmer Applied Biosystems, Foster City, CA.], as previously described (18, 19, 20) .

The PCR reaction mixture consisted of 600 nM of each primer, 200 nM probe; 2.5 units AmpliTaq Gold Polymerase; 200 µM of each dATP, dCTP, and dGTP; 400 µM dUTP; 5.5 mM MgCl2; and 1x Taqman Buffer A containing a reference dye to a final volume of 25 µl (all reagents, Applied Biosystems, Foster City, CA). Cycling conditions were 50°C for 10 s, 95°C for 10 min, and then 46 cycles at 95°C for 15 s and 60°C for 1 min.

The primers and probe sequences used were as follows. In all cases, the first primer is the forward PCR primer, the second is the reverse PCR primer, and the third is the Taqman probe. HER2-neu: CTGAACTGGTGTATGCAGATTGC, TTCCGAGCG GCCAAGTC; 6FAM(carboxyfluorescein)5'-TGTGTACGAGCCGCACATCCTCCA-3'TAMRA(N,N,N',N'-tetramethyl-6carboxyrhodamine); EGFR: TGCGTCTCTTGCCG GAAT, GGCTCACCCTCCAGAAGCTT; 6FAM5'-ACGCATTCCCTGCCTCGGCTG-3'TAMRA; ß-actin: TGAGCGCGGCTACAGCTT, TCCTTAATGTCACGCACG ATTT; 6FAM5'-ACCACCACGGCCGAGCGG-3'TAMRA.

Statistical Analysis.
Taqman analyses yield values that are expressed as ratios between two absolute measurements (gene of interest:internal reference gene). The ratio between mRNA expression in nonmalignant lung tissue and matching tumor tissue was used as a measure of the degree of gene expression. Associations between two related variables were tested by using the Wilcoxon signed rank test. The {chi}2 test was used to analyze the associations between categorical clinicopathological variables. Hazards ratios were used to calculate the relative risks of death. These calculations were based on the Pike estimate, with the use of the observed and expected number of events as calculated in the Log rank test statistic (21) . The maximal {chi}2 method of Miller and Siegmund (22) and Halpern (23) was adapted to determine which expression value best segregated patients into poor- and good-prognosis subgroups (in terms of likelihood of surviving), with the log-rank test as the statistics used to measure the strength of the grouping. To determine a P that would be interpreted as a measure of the strength of the association based on the maximal {chi}2 analysis, 1000 boot-strap-like simulations were used to estimate the distribution of the maximal {chi}2 statistics under the hypothesis of no association (23) . Cox’s proportional hazards modeling of factors that were significant in univariate analysis was performed to identify which factors might have a significant influence on survival. The level of significance was set to P < 0.05.


    Results
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
HER2-neu mRNA expression was detectable by quantitative real-time RT-PCR in 83 of 83 (100%) normal lung and in 83 of 83 (100%) tumor samples. In 44 (53%) of 83 patients, the HER2-neu expression level, expressed as the ratio between HER2-neu and ß-actin PCR product, was elevated in tumor compared with paired normal lung tissue (the T:N ratio was higher than 1.0). The median HER2 neu mRNA expression was 4.17 (range, 0.28–23.86) in normal lung and 4.35 (range, 0.21–68.11) in tumor tissue (P = 0.019; Wilcoxon test). To determine whether there was any prognostic significance attached to quantitative differences in HER2-neu mRNA expression levels, the maximal {chi}2 method (22 , 23) was adapted to determine which HER2-neu expression level best segregated patients into poor- and good-prognosis subgroups. This method found that segregation was best achieved by using a T:N HER2-neu expression ratio of 1.8 as a cutoff value. By this criterion, 29 (34.9%) patients had a high HER2-neu expression and 54 (65.1%) had a low HER2-neu expression. Table 1Citation shows associations between clinicopathological data and HER2-neu gene expression status. There were no statistical significant differences detectable. HER2-neu mRNA expression was significantly associated with patient survival. The median survival (51.4 months; range, 3.8–105.3 months) was not reached in the low HER2 neu-expression group compared with 31.1 months (95% CIs, 21.96; 40.24) in the high HER2-neu expression group. To determine a P, we used bootstrap-like simulations to estimate the distribution of a maximal {chi}2 statistic, because the cutoff point of 1.8 had been chosen after examining the data. The resulting adjusted P was .004 (log-rank test). The importance of HER2-neu as a prognostic factor was next determined by the Cox’s proportional hazards model analysis. In a univariate analysis of potential prognostic factors, high HER2-neu expression as well as advanced pT classification, pN classification, and tumor stage were significant unfavorable prognostic factors (Table 2)Citation . In a multivariate analysis of prognostic factors (Table 3Citation , Models A and B), high HER2-neu expression was a significant and independent unfavorable prognostic factor, as was advanced pN classification and tumor stage.


View this table:
[in this window]
[in a new window]

 
Table 1 Relationships with HER2-neu and EGFR mRNA expression

 

View this table:
[in this window]
[in a new window]

 
Table 2 Survival in NSCLC based on clinical and molecular parameters

 

View this table:
[in this window]
[in a new window]

 
Table 3 Cox proportional hazards regression models

 
EGFR mRNA expression was detectable by quantitative real-time RT-PCR in 83 of 83 (100%) normal lung and in 83 of 83 (100%) tumor samples. In 42 (51%) of 83 patients, the EGFR expression level was elevated in tumor compared with paired normal lung tissue (the T:N ratio was >1.0). The median EGFR mRNA expression was 8.17 (range, 0.31–46.26) in normal lung and 7.22 (range, 0.27–97.49) in tumor tissue (P = not significant). The maximal {chi}2 method (22 , 23) determined a T:N EGFR expression ratio of 1.8 as a cutoff value to best segregate patients into low- and high-EGFR expressors. By this criterion, 28 (33.7%) patients had a high EGFR-expression status and 55 (66.3%) had a low EGFR-expression status. There were no statistical significant differences between clinicopathological variables and EGFR mRNA expression status detectable (Table 1)Citation . A trend toward inferior overall survival was observable for the high EGFR expression group but did not reach statistical significance (Table 2)Citation . The median survival was not reached in the low EGFR-expression group compared with 32.37 months (95% CI, 8.43–56.31) in the high-EGFR expressor group (P = 0.176).



View larger version (20K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Estimated probability of survival of curatively resected non-small cell lung cancer patients versus combined patterns of EGFR and HER2-neu coexpression in NSCLC. The median survival was not reached in the group that showed low HER2-neu and EFGR expression, compared with 45.47 months in the high EGFR-expression group, 31.10 months (95% CI, 14.77–47.43) in the high HER2-neu-expression group, and 22.03 months (95% CI, 2.30; 41.76; P = 0.003) in the high HER2-neu- and EGFR-expression group.

 
High expression levels of HER2-neu and EGFR were found in 14 of 83 (16.9%) patients. Forty of 83 (48.2%) patients showed a low expression status for HER2-neu and EGFR, whereas 14 of 83 (16.9%) showed a high expression for EGFR only, and 15 of 83 (18.1%) patients displayed a high expression for HER2-neu. The median survival was not reached in the group that showed low HER2-neu and EFGR expression, compared with 45.47 months in the high EGFR-expression group, 31.10 months (95% CI, 14.77–47.43) in the high HER2-neu-expression group, and 22.03 months (95% CI, 2.30; 41.76; P = 0.003; log-rank test; Table 2Citation and Fig. 1Citation ) in the high-HER2-neu and -EGFR expression group. Univariate analysis displayed high HER2-neu and high EGFR coexpression as a significant unfavorable prognostic factor (Table 2)Citation . In a multivariate analysis of prognostic factors (Table 3Citation , Models C and D), high HER2-neu and high EGFR coexpression was a significant and independent unfavorable prognostic factor, as was advanced pN classification and tumor stage.


    Discussion
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
In this study, we measured the mRNA expression of HER2-neu and EGFR in 83 tumor tissues and matched specimen of nontumor tissues from NSCLC patients to test the hypothesis that the quantity of expression of these genes by themselves or in combination are of prognostic importance in this disease. Expression of both genes was detectable in all specimen analyzed. However, the intratumoral content of mRNA expression varied among the tumors over a range of 324-fold for HER2-neu and 361-fold for EGFR. This observation of seemingly variable amounts of mRNA implies heterogeneity of expression patterns within individual tumor cells and may be reflected in the biological behavior of these tumors.

Previous studies of HER2-neu and EGFR expression in NSCLC reported enormous variations in frequencies of NSCLC tumors scored positive for both EGFR and HER2-neu expression. Overexpression of HER2-neu, defined as positive staining, were reported in 13–80% in ACs (11 , 14 , 17 , 24, 25, 26, 27) , in 2–45% in SCCs (11 , 14 , 24 , 25 , 28) , and in 0–20% in LCs, (11 , 14) by using paraffin-embedded slides (14 , 24 , 28) or HER2-neu antisera (11 , 14 , 17 , 24 , 27) for immunohistochemistry. Consequently, different results have been reported concerning the impact of HER2-neu overexpression in NSCLC. Kern at al. (14) and Tateishi et al. (24) reported significantly inferior survival in patients overexpressing HER2-neu, whereas Pfeiffer et al. (11) did not detect differences in survival in HER2-neu-overexpressing ACs. It is noteworthy that the latter studies refer to AC only. Thus far, an association of HER2-neu overexpression and survival in SCCs and LCs of the lung has not been reported. In this study, we used a new approach to detect HER2-neu expression in NSCLC. First, we used a real-time RT-PCR (Taqman) method with high sensitivity and specificity for mRNA quantitation (18 , 19 , 29) . Secondly, mRNA expression status was determined by a method used by Mafune et al. (30) , who calculated individual tumor:normal (T:N) expression ratios in matching tissues obtained from patients with SCCs of the esophagus. This method of analysis leads to a precise expression value for each patient, because it is based on the individual background expression obtained from matching nonmalignant tissue. Using this method, we detected a high HER2-neu expression status in 34.9% of NSCLC patients analyzed. In addition, multivariate analysis revealed high HER2-neu expression as an independent prognostic factor for survival (P = 0.041) in NSCLC.

Expression of EGFR in NSCLC has been reported extensively in studies using immunohistochemical methods for expression analysis (7 , 8 , 9 , 10 , 12 , 24 , 31, 32, 33, 34) , with frequencies for EGFR overexpression between 32% and 47% in NSCLC (10 , 12 , 24 , 32 , 33) . Significant differences in EGFR expression have been reported among histological subtypes, generally with higher EGFR expression in SCC compared with AC and LC (9 , 7 , 12 , 33 , 34) . Most of the studies reported no correlation of EGFR overexpression with patients’ survival (12 , 10 , 24 , 32 , 33) . Only Ohsaki et al. (34) correlated EGFR protein expression with poor prognosis in NSCLC patients with p53 overexpression (P = 0.024). Consistent with most previous reports, we found that EGFR mRNA expression was not prognostically significant for patients with curatively resected NSCLC.

One of the critical questions is the evaluation of interrelationships between factors reported to be of prognostic importance, and only a few studies have addressed this question regarding HER2-neu and EGFR coexpression in NSCLC. Tateishi et al. (24) , measuring EGFR and HER2-neu protein expression, reported cooverexpression in 13% of ACs analyzed, and found that cooverexpression of these two genes was associated with inferior 5-year survival. The latter finding is consistent with the results obtained in our study and confirms that high HER2-neu and EGFR coexpression have a role in the biological behavior of NSCLC and the prognosis of patients with NSCLC.

HER2-neu expression may be linked to a chemoresistant phenotype in human NSCLC. Tumors cell lines overexpressing the HER2-neu protein product p185neu have been shown to be more resistant to cisplatin (35, 36, 37, 38) . Recently, the United States Food and Drug Administration approved the use of the monoclonal antibody trastazumab (Herceptin) for the treatment of HER2-neu-overexpressing metastatic breast cancers (16) . The possibility that adjuvant chemotherapy might improve the survival in patients with NSCLC makes this drug, among others, an attractive target for patients with NSCLC. Demonstration of HER2-neu overexpression in NSCLC, using a standardized method, is essential for establishing clinical trials for this or other drugs. A recent report indicates nonspecificity when using the HercepTest for measurement of HER2-neu expression in invasive breast cancers, concluding that the HercepTest may have a high false positivity (39) . The highly sensitive and specific Taqman technology used in this study might prove useful as an alternative measurement for HER2-neu quantitation.

In summary, we have demonstrated the considerable heterogeneity in EGFR and HER2-neu expression of individual NSCLCs, a heterogeneity likely to be reflected in the biological behavior of the tumors, and then identified high HER2-neu expression and high EGFR/HER2-neu coexpression as potential prognostic factors of NSCLCs. EGFR and HER2-neu may have a great value in identifying NSCLC patients at high risk of early disease recurrence after surgery and in selecting patients who will benefit from intensive adjuvant therapy.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 To whom requests for reprints should be addressed, at University of Southern California/Norris Comprehensive Cancer Center, 1441 East Lake Avenue, NOR 5318, Los Angeles, CA 90033; Phone: (323) 865-0517; Fax: (323) 865-0105; E-mail: drbrabender{at}cs.com Back

2 The abbreviations used are: NSCLC, non-small cell lung cancer; EGFR, epidermal growth factor receptor; UICC, Union International Contre Cancer; CI, confidence interval; AC, adenocarcinoma; SCC, squamous cell carcinoma; LC, large cell carcinoma; RT-PCR, reverse transcription-PCR. Back

Received 12/26/00; revised 4/ 9/01; accepted 4/17/01.


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 

  1. Ginsberg R. J., Vokes E. E., Raben A. Non-small cell lung cancer Ed. 5 DeVita V. T. Hellmann S. Rosenberg S. A. eds. . Cancer: Principles in Practice of Oncology, : 858-910, Lipincott-Raven Publishers Philadelphia 1997.
  2. Parsons J. T., Parsons S. J. Protein-tyrosine kinases, oncogenes and cancer DeVita V. T. Hellmann S. Rosenberg S.A. eds. . Important Advances in Oncology, : 3-18, Lipincott-Raven Publishers Philadelphia 1993.
  3. Hynes N. E., Stern D. F. The biology of erbB-2/neu/HER-2 and its role in cancer. Biochem. Biophys. Acta, 1198: 165-184, 1994.[Medline]
  4. Gill G., Bertics P., Santon J. Epidermal growth factor and its receptor. Mol. Cell. Endocrinol., 51: 169-186, 1987.[CrossRef][Medline]
  5. Hendler F. J., Ozanne B. W. Human squamous cell lung cancers express increased epidermal growth factor receptors. J. Clin. Investig., 74: 647-652, 1984.
  6. Cerny T., Barnes D., Hasleton P., Barber P., Healy K., Gullick W., Thatcher N. Expression of epidermal growth factor receptor (EGFR) in human lung tumors. Br. J. Cancer, 54: 265-269, 1986.[Medline]
  7. Veale D., Ashcroft T., Marsh C., Gibson G., Harris A. Epidermal growth factor receptors in non-small cell lung cancers. Br. J. Cancer, 55: 513-516, 1987.[Medline]
  8. Veale D., Kerr N., Gibson G., Kelly P., Harris A. The relationship of quantitative epidermal growth factor receptor expression in non-small cell lung cancer to long term survival. Br. J. Cancer, 68: 162-165, 1993.[Medline]
  9. Fujino S., Enokibori T., Tezuka N., Asada Y., Inoue S., Kato H., Mori A. A comparison of epidermal growth factor receptor levels and other prognostic parameters in non-small cell lung cancer. Eur. J. Cancer, 32: 2070-2074, 1996.
  10. Rusch V., Baselga J., Cordon-Cardo C., Orazem J., Zaman M., Hoda S., McIntosh J., Kurie J., Dmitrovsky E. Differential expression of the epidermal growth factor receptor and its ligands in primary non-small cell lung cancers and adjacent benign lung. Cancer Res., 53: 2379-2385, 1993.[Abstract/Free Full Text]
  11. Pfeiffer P., Clausen P. P., Andersen K., Rose C. Lack of prognostic significance of epidermal growth factor receptor and the oncoprotein p185HER-2 in patients with systemically untreated non-small cell lung cancer: an immunohistochemical study on cryosections. Br. J. Cancer, 74: 86-91, 1996.[Medline]
  12. Pastorino U., Andreola S., Tagliabue E., Pezella F., Incarbone M., Sozzi G., Buyse M., Menard S., Pierotti M., Rilke F. Immunocytochemical markers in stage I lung cancers: relevance to prognosis. J. Clin. Oncol., 15: 2858-2865, 1997.[Abstract]
  13. Schneider P. M., Huang M. C., Chiocca S. M., Manning J., Zhao X., Fang K., Roth J. A. Differential expression of the c-erbB-2 gene in human small cell and non-small cell lung cancer. Cancer Res., 49: 4968-4971, 1989.[Abstract/Free Full Text]
  14. Kern J. A., Schwartz D. A., Nordberg J. E., Weiner D. B., Greene M. I., Torney L., Robinson R. A. p185 neu expression in human lung adenocarcinomas predicts shortened survival. Cancer Res., 50: 5184-5191, 1990.[Abstract/Free Full Text]
  15. Weiner D. B., Nordberg J., Robinson R., Nowell P. C., Gazdar A., Greene M. I., Williams W. V., Cohen J. A., Kern J. A. Expression of the neu gene-encoded protein (P185neu) in human non-small cell carcinomas of the lung. Cancer Res., 50: 421-425, 1990.[Abstract/Free Full Text]
  16. Scheurle D., Jahanzeb M., Aronsohn R. S., Watzek L., Narayanan R. HER-2/neu expression in archival non-small cell lung carcinomas using FDA-approved Hercep test. Anticancer Res., 20: 2091-2096, 2000.[Medline]
  17. Kern J. A., Slebos R. J., Top B., Rodenhuis S., Lager D., Robinson R. A., Weiner D., Schwartz D. A. C-erbB-2 expression and codon 12 K-ras mutations both predict shortened survival for patients with pulmonary adenocarcinoma. J. Clin. Investig., 93: 516-520, 1994.
  18. Heid C. A., Stevens J., Livak K. J., Williams P. M. Real time quantitative PCR. Genome Res., 6: 986-994, 1996.[Abstract/Free Full Text]
  19. Gibson U. E., Heid C. A., Williams P. M. A novel method for real time quantitative RT-PCR. Genome Res., 6: 995-1001, 1996.[Abstract/Free Full Text]
  20. Lord R. V., Salonga D., Danenberg K. D., Peters J. H., DeMeester T. R., Park J. M., Johansson J., Skinner K. A., Chandrasoma P., DeMeester S. R., Bremner C. G., Tsai P. I., Danenberg P. V. Telomerase reverse transcriptase expression is increased early in the Barrett’s metaplasia, dysplasia, carcinoma sequence. J Gastrointest. Surg., 4: 135-142, 2000.[CrossRef][Medline]
  21. Pike M. C. Asymptomatically efficient rank invariant procedures. J. R. Stat. Soc. Series A, 135: 201-203, 1972.
  22. Miller R., Siegmund D. Maximally selected {chi}2 statistics. Biometrics, 38: 1011-1016, 1982.[CrossRef]
  23. Halpern J. Maximally selected {chi}2 statistics for small samples. Biometrics, 38: 1017-1023, 1982.[CrossRef]
  24. Tateishi M., Ishida T., Mitsodumi T., Kaneko S., Sugimachi K. Prognostic value of c-erbB-2 protein expression in human lung adenocarcinoma and squamous cell carcinoma. Eur. J. Cancer, 27: 1372-1375, 1991.
  25. Shi D., He G., Cao S., Pan W., Zhuang H. Z., Yu D., Hung M. C. Overexpression of the c-erbB-2/neu-encoded p185 protein in primary lung cancer. Mol. Carcinog., 5: 213-218, 1992.[Medline]
  26. Bongiorno P. F., Whyte R. I., Lesser E. J., Moore J. H., Orringer M. B., Beer D. G. Alterations of K-ras, p53, and erbB-2/neu in human lung adenocarcinomas. J. Thorac. Cardiovasc. Surg., 107: 590-595, 1994.[Abstract/Free Full Text]
  27. Harpole D. H., Marks J. R., Richards E. G., Herndon J. E., Sugarbaker D. J. Localized adenocarcinoma of the lung: oncogene expression of erbB-2 and p53 in 150 patients. Clin. Cancer Res., 1: 659-664, 1995.[Abstract]
  28. Volm M., Effert T., Mattern J. Oncoprotein (c-myc, c-erbB1, c-erbB2, c-fos) and suppressor gene product (p53) expression in squamous cell carcinomas of the lung. Clinical and biological correlations. Anticancer Res., 12: 11-20, 1992.[Medline]
  29. Chiang P. W., Beer D. G., Wie W. L., Orringer M. B., Kurnit D. M. Detection of erbB-2 amplifications in tumors and sera from esophageal carcinoma patients. Clin. Cancer Res., 5: 1381-1386, 1999.[Abstract/Free Full Text]
  30. Mafune K., Tanaka Y., Mimori K., Mori M., Takubo K., Makuuchi M. Increased expression of onithine decarboxylase mRNA in human esophageal carcinoma. Clin. Cancer Res., 5: 4073-4078, 1999.[Abstract/Free Full Text]
  31. Rachwal W. J., Bongiorno P. F., Orringer M. B., Whyte R. I., Ethier S. P., Beer D. G. Expression and activation of erbB-2 and epidermal growth factor receptor in lung adenocarcinomas. Br. J. Cancer, 72: 56-64, 1995.[Medline]
  32. Rusch V., Baselga J., Cordon-Cardo C., Orazem J., Zaman M., Hoda S., McIntosh J., Kurie J., Dmitrovsky E. Differential expression of the epidermal growth factor receptor and its ligands in primary non-small cell lung cancer and adjacent benign lung. Cancer Res., 15: 2379-2385, 1993.
  33. Pfeiffer P., Nexo E., Bentzen S. M., Clausen P. P., Andersen K., Rose C. Enzyme-linked immunoabsorbent assay of epidermal growth factor receptor in lung cancer: comparison with immunohistochemistry, clinicopathological features and prognosis. Br. J. Cancer, 78: 96-99, 1998.[Medline]
  34. Ohsaki Y., Tanno S., Fujita Y., Toyoshima E., Fujiuchi S., Nishigaki Y., Ishida S., Nagase A., Miyokawa N., Hirata S., Kikuchi K. Epidermal growth factor expression correlates with poor prognosis in non-small cell lung cancer patients with p53 overexpression. Oncol. Rep., 7: 603-607, 2000.[Medline]
  35. Tsai C. M., Chang K. T., Perng R. P., Mitsudomi T., Chen M. H., Kadoyama C., Gazdar A. F. Correlation of intrinsic chemoresistence to non-small cell lung cancer cell lines with HER-2/neu gene expression but not with ras gene mutations. J. Natl. Cancer Inst. (Bethesda), 85: 897-901, 1993.[Abstract/Free Full Text]
  36. Tsai C. M., Chang K. T., Wu L. H., Chen J. Y., Gazdar A. F., Mitsudomi T., Chen M. H., Perng R. P. Correlation between intrinsic chemoresistance and HER-2/neu gene expression, p53 mutations and cell proliferation characteristics in non-small cell lung cancer cell lines. Cancer Res., 56: 206-209, 1996.[Abstract/Free Full Text]
  37. Tsai C. M., Yu D., Chang K. T., Wu L. H., Perng R. P., Ibrahim N. K., Hung M. C. Enhanced chemoresistence by elevation of the levels of p185neu in the HER-2/neu transfected human lung cancer cells. J. Natl. Cancer Inst. (Bethesda), 87: 682-684, 1995.[Free Full Text]
  38. Tsai C. M., Chang K. T., Li L., Perng R. P., Yang L. Y. Interrelationships between cellular nucleotide excision repair, cisplatin cytotoxicity, HER-2/neu gene expression, and epidermal growth factor receptor level in non-small lung cancer cell lines. Jpn. J. Cancer Res., 91: 213-222, 2000.[Medline]
  39. Jacobs T. W., Gown A. M., Yaziji H., Barnes M. J., Schnitt S. J. Specifity of HercepTest in determining the HER-2/neu status of breast cancers using the United States Food and Drug Administration approved scoring system. J. Clin. Oncol., 17: 1983-1987, 1999.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Ann OncolHome page
V. Ludovini, G. Bellezza, L. Pistola, F. Bianconi, L. Di Carlo, A. Sidoni, A. Semeraro, R. Del Sordo, F. R. Tofanetti, M. G. Mameli, et al.
High coexpression of both insulin-like growth factor receptor-1 (IGFR-1) and epidermal growth factor receptor (EGFR) is associated with shorter disease-free survival in resected non-small-cell lung cancer patients
Ann. Onc., May 1, 2009; 20(5): 842 - 849.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Pathol.Home page
V Martin, L Mazzucchelli, and M Frattini
An overview of the epidermal growth factor receptor fluorescence in situ hybridisation challenge in tumour pathology
J. Clin. Pathol., April 1, 2009; 62(4): 314 - 324.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
M. Barve, J. Bender, N. Senzer, C. Cunningham, F. A. Greco, D. McCune, R. Steis, H. Khong, D. Richards, J. Stephenson, et al.
Induction of Immune Responses and Clinical Efficacy in a Phase II Trial of IDM-2101, a 10-Epitope Cytotoxic T-Lymphocyte Vaccine, in Metastatic Non-Small-Cell Lung Cancer
J. Clin. Oncol., September 20, 2008; 26(27): 4418 - 4425.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
A. L. Van Dyke, M. L. Cote, G. M. Prysak, G. B. Claeys, A. S. Wenzlaff, V. C. Murphy, F. Lonardo, and A. G. Schwartz
COX-2/EGFR expression and survival among women with adenocarcinoma of the lung
Carcinogenesis, September 1, 2008; 29(9): 1781 - 1787.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Croyle, N. Akeno, J. A. Knauf, D. Fabbro, X. Chen, J. E. Baumgartner, H. A. Lane, and J. A. Fagin
RET/PTC-Induced Cell Growth Is Mediated in Part by Epidermal Growth Factor Receptor (EGFR) Activation: Evidence for Molecular and Functional Interactions between RET and EGFR
Cancer Res., June 1, 2008; 68(11): 4183 - 4191.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
Y. Nieto, F. Nawaz, R. B. Jones, E. J. Shpall, and S. Nawaz
Prognostic Significance of Overexpression and Phosphorylation of Epidermal Growth Factor Receptor (EGFR) and the Presence of Truncated EGFRvIII in Locoregionally Advanced Breast Cancer
J. Clin. Oncol., October 1, 2007; 25(28): 4405 - 4413.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
D. R. Ferry, M. Anderson, K. Beddard, S. Tomlinson, P. Atherfold, J. Obszynska, R. Harrison, and J. Jankowski
A Phase II Study of Gefitinib Monotherapy in Advanced Esophageal Adenocarcinoma: Evidence of Gene Expression, Cellular, and Clinical Response
Clin. Cancer Res., October 1, 2007; 13(19): 5869 - 5875.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
P. A. Janne, J. von Pawel, R. B. Cohen, L. Crino, C. A. Butts, S. S. Olson, I. A. Eiseman, A. A. Chiappori, B. Y. Yeap, P. F. Lenehan, et al.
Multicenter, Randomized, Phase II Trial of CI-1033, an Irreversible Pan-ERBB Inhibitor, for Previously Treated Advanced Non Small-Cell Lung Cancer
J. Clin. Oncol., September 1, 2007; 25(25): 3936 - 3944.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
K. J. Hare, B. Hartmann, H. Kissow, J. J. Holst, and S. S. Poulsen
The Intestinotrophic Peptide, GLP-2, Counteracts Intestinal Atrophy in Mice Induced by the Epidermal Growth Factor Receptor Inhibitor, Gefitinib
Clin. Cancer Res., September 1, 2007; 13(17): 5170 - 5175.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
W. S. Siegel-Lakhai, J. H. Beijnen, W. L. Vervenne, H. Boot, M. Keessen, M. Versola, K. M. Koch, D. A. Smith, L. Pandite, D. J. Richel, et al.
Phase I Pharmacokinetic Study of the Safety and Tolerability of Lapatinib (GW572016) in Combination with Oxaliplatin/Fluorouracil/Leucovorin (FOLFOX4) in Patients with Solid Tumors
Clin. Cancer Res., August 1, 2007; 13(15): 4495 - 4502.
[Abstract] [Full Text] [PDF]


Home page
JAMAHome page
M. V. Karamouzis, J. R. Grandis, and A. Argiris
Therapies Directed Against Epidermal Growth Factor Receptor in Aerodigestive Carcinomas
JAMA, July 4, 2007; 298(1): 70 - 82.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
E. M. Schmelz, H. Xu, R. Sengupta, J. Du, S. Banerjee, F. H. Sarkar, A. K. Rishi, and A. P.N. Majumdar
Regression of Early and Intermediate Stages of Colon Cancer by Targeting Multiple Members of the EGFR Family with EGFR-Related Protein
Cancer Res., June 1, 2007; 67(11): 5389 - 5396.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J. Kurai, H. Chikumi, K. Hashimoto, K. Yamaguchi, A. Yamasaki, T. Sako, H. Touge, H. Makino, M. Takata, M. Miyata, et al.
Antibody-Dependent Cellular Cytotoxicity Mediated by Cetuximab against Lung Cancer Cell Lines
Clin. Cancer Res., March 1, 2007; 13(5): 1552 - 1561.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. Ono and M. Kuwano
Molecular Mechanisms of Epidermal Growth Factor Receptor (EGFR) Activation and Response to Gefitinib and Other EGFR-Targeting Drugs
Clin. Cancer Res., December 15, 2006; 12(24): 7242 - 7251.
[Abstract] [Full Text] [PDF]


Home page
Ann OncolHome page
P Ceppi, M Volante, S Novello, I Rapa, K. Danenberg, P. Danenberg, A Cambieri, G Selvaggi, S Saviozzi, R Calogero, et al.
ERCC1 and RRM1 gene expressions but not EGFR are predictive of shorter survival in advanced non-small-cell lung cancer treated with cisplatin and gemcitabine
Ann. Onc., December 1, 2006; 17(12): 1818 - 1825.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J. A. Engelman and L. C. Cantley
The Role of the ErbB Family Members in Non-Small Cell "Lung Cancers Sensitive to Epidermal Growth Factor Receptor Kinase Inhibitors".
Clin. Cancer Res., July 15, 2006; 12(14): 4372s - 4376s.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Pathol.Home page
B Sonnweber, M Dlaska, S Skvortsov, S Dirnhofer, T Schmid, and W Hilbe
High predictive value of epidermal growth factor receptor phosphorylation but not of EGFRvIII mutation in resected stage I non-small cell lung cancer (NSCLC).
J. Clin. Pathol., March 1, 2006; 59(3): 255 - 259.
[Abstract] [Full Text] [PDF]


Home page
ThoraxHome page
H Nakamura, N Kawasaki, M Taguchi, and K Kabasawa
Survival impact of epidermal growth factor receptor overexpression in patients with non-small cell lung cancer: a meta-analysis
Thorax, February 1, 2006; 61(2): 140 - 145.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
F. Robert, G. Blumenschein, R. S. Herbst, F. V. Fossella, J. Tseng, M. N. Saleh, and M. Needle
Phase I/IIa Study of Cetuximab With Gemcitabine Plus Carboplatin in Patients With Chemotherapy-Naive Advanced Non-Small-Cell Lung Cancer
J. Clin. Oncol., December 20, 2005; 23(36): 9089 - 9096.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
N. T. Ihle, G. Paine-Murrieta, M. I. Berggren, A. Baker, W. R. Tate, P. Wipf, R. T. Abraham, D. L. Kirkpatrick, and G. Powis
The phosphatidylinositol-3-kinase inhibitor PX-866 overcomes resistance to the epidermal growth factor receptor inhibitor gefitinib in A-549 human non-small cell lung cancer xenografts
Mol. Cancer Ther., September 1, 2005; 4(9): 1349 - 1357.
[Abstract] [Full Text] [PDF]


Home page
The OncologistHome page
W. S. Siegel-Lakhai, J. H. Beijnen, and J. H.M. Schellens
Current Knowledge and Future Directions of the Selective Epidermal Growth Factor Receptor Inhibitors Erlotinib (Tarceva(R)) and Gefitinib (Iressa(R))
Oncologist, September 1, 2005; 10(8): 579 - 589.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
T. Mukohara, J. A. Engelman, N. H. Hanna, B. Y. Yeap, S. Kobayashi, N. Lindeman, B. Halmos, J. Pearlberg, Z. Tsuchihashi, L. C. Cantley, et al.
Differential Effects of Gefitinib and Cetuximab on Non-small-cell Lung Cancers Bearing Epidermal Growth Factor Receptor Mutations
J Natl Cancer Inst, August 17, 2005; 97(16): 1185 - 1194.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
F. Cappuzzo, M. Varella-Garcia, H. Shigematsu, I. Domenichini, S. Bartolini, G. L. Ceresoli, E. Rossi, V. Ludovini, V. Gregorc, L. Toschi, et al.
Increased HER2 Gene Copy Number Is Associated With Response to Gefitinib Therapy in Epidermal Growth Factor Receptor-Positive Non-Small-Cell Lung Cancer Patients
J. Clin. Oncol., August 1, 2005; 23(22): 5007 - 5018.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
F. A. Shepherd, J. Rodrigues Pereira, T. Ciuleanu, E. H. Tan, V. Hirsh, S. Thongprasert, D. Campos, S. Maoleekoonpiroj, M. Smylie, R. Martins, et al.
Erlotinib in Previously Treated Non-Small-Cell Lung Cancer
N. Engl. J. Med., July 14, 2005; 353(2): 123 - 132.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
M. S. Tsao, A. Sakurada, J.-C. Cutz, C.-Q. Zhu, S. Kamel-Reid, J. Squire, I. Lorimer, T. Zhang, N. Liu, M. Daneshmand, et al.
Erlotinib in Lung Cancer -- Molecular and Clinical Predictors of Outcome
N. Engl. J. Med., July 14, 2005; 353(2): 133 - 144.
[Abstract] [Full Text] [PDF]


Home page
ChestHome page
Z. Zheng, G. Bepler, A. Cantor, and E. B. Haura
Small Tumor Size and Limited Smoking History Predicts Activated Epidermal Growth Factor Receptor in Early-Stage Non-small Cell Lung Cancer
Chest, July 1, 2005; 128(1): 308 - 316.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
P. A. Janne, J. A. Engelman, and B. E. Johnson
Epidermal Growth Factor Receptor Mutations in Non-Small-Cell Lung Cancer: Implications for Treatment and Tumor Biology
J. Clin. Oncol., May 10, 2005; 23(14): 3227 - 3234.
[Abstract] [Full Text] [PDF]


Home page
Ann OncolHome page
M. K. Mohamed, S. Ramalingam, Y. Lin, W. Gooding, and C. P. Belani
Skin rash and good performance status predict improved survival with gefitinib in patients with advanced non-small cell lung cancer
Ann. Onc., May 1, 2005; 16(5): 780 - 785.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
R. S. Herbst, D. H. Johnson, E. Mininberg, D. P. Carbone, T. Henderson, E. S. Kim, G. Blumenschein Jr, J. J. Lee, D. D. Liu, M. T. Truong, et al.
Phase I/II Trial Evaluating the Anti-Vascular Endothelial Growth Factor Monoclonal Antibody Bevacizumab in Combination With the HER-1/Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitor Erlotinib for Patients With Recurrent Non-Small-Cell Lung Cancer
J. Clin. Oncol., April 10, 2005; 23(11): 2544 - 2555.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
A. Marchetti, C. Martella, L. Felicioni, F. Barassi, S. Salvatore, A. Chella, P. P. Camplese, T. Iarussi, F. Mucilli, A. Mezzetti, et al.
EGFR Mutations in Non-Small-Cell Lung Cancer: Analysis of a Large Series of Cases and Development of a Rapid and Sensitive Method for Diagnostic Screening With Potential Implications on Pharmacologic Treatment
J. Clin. Oncol., February 1, 2005; 23(4): 857 - 865.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
D. Raben, B. Helfrich, D. C. Chan, F. Ciardiello, L. Zhao, W. Franklin, A. E. Baron, C. Zeng, T. K. Johnson, and P. A. Bunn Jr
The Effects of Cetuximab Alone and in Combination With Radiation and/or Chemotherapy in Lung Cancer
Clin. Cancer Res., January 15, 2005; 11(2): 795 - 805.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
J. H. Um, J. K. Kwon, C.-D. Kang, M. J. Kim, D. S. Ju, J. H. Bae, D. W. Kim, B. S. Chung, and S. H. Kim
Relationship between Antiapoptotic Molecules and Metastatic Potency and the Involvement of DNA-Dependent Protein Kinase in the Chemosensitization of Metastatic Human Cancer Cells by Epidermal Growth Factor Receptor Blockade
J. Pharmacol. Exp. Ther., December 1, 2004; 311(3): 1062 - 1070.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
C. D. Britten
Targeting ErbB receptor signaling: A pan-ErbB approach to cancer
Mol. Cancer Ther., October 1, 2004; 3(10): 1335 - 1342.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
B. Van Den Bossche and C. Van de Wiele
Receptor Imaging in Oncology by Means of Nuclear Medicine: Current Status
J. Clin. Oncol., September 1, 2004; 22(17): 3593 - 3607.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
D. R. Gandara, H. West, K. Chansky, A. M. Davies, D. H. M. Lau, J. Crowley, P. H. Gumerlock, F. R. Hirsch, and W. A. Franklin
Bronchioloalveolar Carcinoma: A Model for Investigating the Biology of Epidermal Growth Factor Receptor Inhibition
Clin. Cancer Res., June 15, 2004; 10(12): 4205S - 4209S.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
G. V. Scagliotti, G. Selvaggi, S. Novello, and F. R. Hirsch
The Biology of Epidermal Growth Factor Receptor in Lung Cancer
Clin. Cancer Res., June 15, 2004; 10(12): 4227S - 4232S.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
G. Giaccone
The Role of Gefitinib in Lung Cancer Treatment
Clin. Cancer Res., June 15, 2004; 10(12): 4233S - 4237S.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
R. Govindan
Cetuximab in Advanced Non-Small Cell Lung Cancer
Clin. Cancer Res., June 15, 2004; 10(12): 4241S - 4244S.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
C. J. Langer, P. Stephenson, A. Thor, M. Vangel, and D. H. Johnson
Trastuzumab in the Treatment of Advanced Non-Small-Cell Lung Cancer: Is There a Role? Focus on Eastern Cooperative Oncology Group Study 2598
J. Clin. Oncol., April 1, 2004; 22(7): 1180 - 1187.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
R. Rosell
Toward Customized Trastuzumab in HER-2/neu-Overexpressing Non-Small-Cell Lung Cancers
J. Clin. Oncol., April 1, 2004; 22(7): 1171 - 1173.
[Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
M. Ono, A. Hirata, T. Kometani, M. Miyagawa, S.-i. Ueda, H. Kinoshita, T. Fujii, and M. Kuwano
Sensitivity to gefitinib (Iressa, ZD1839) in non-small cell lung cancer cell lines correlates with dependence on the epidermal growth factor (EGF) receptor/extracellular signal-regulated kinase 1/2 and EGF receptor/Akt pathway for proliferation
Mol. Cancer Ther., April 1, 2004; 3(4): 465 - 472.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
C. Muller-Tidow, J. Schwable, B. Steffen, N. Tidow, B. Brandt, K. Becker, E. Schulze-Bahr, H. Halfter, U. Vogt, R. Metzger, et al.
High-Throughput Analysis of Genome-Wide Receptor Tyrosine Kinase Expression in Human Cancers Identifies Potential Novel Drug Targets
Clin. Cancer Res., February 15, 2004; 10(4): 1241 - 1249.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. Sumitomo, T. Asano, J. Asakuma, T. Asano, A. Horiguchi, and M. Hayakawa
ZD1839 Modulates Paclitaxel Response in Renal Cancer by Blocking Paclitaxel-Induced Activation of the Epidermal Growth Factor Receptor-Extracellular Signal-Regulated Kinase Pathway
Clin. Cancer Res., January 15, 2004; 10(2): 794 - 801.
[Abstract] [Full Text] [PDF]


Home page
Ann OncolHome page
G. Selvaggi, S. Novello, V. Torri, E. Leonardo, P. De Giuli, P. Borasio, C. Mossetti, F. Ardissone, P. Lausi, and G. V. Scagliotti
Epidermal growth factor receptor overexpression correlates with a poor prognosis in completely resected non-small-cell lung cancer
Ann. Onc., January 1, 2004; 15(1): 28 - 32.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A. Onn, A. M. Correa, M. Gilcrease, T. Isobe, E. Massarelli, C. D. Bucana, M. S. O'Reilly, W. K. Hong, I. J. Fidler, J. B. Putnam, et al.
Synchronous Overexpression of Epidermal Growth Factor Receptor and HER2-neu Protein Is a Predictor of Poor Outcome in Patients with Stage I Non-Small Cell Lung Cancer
Clin. Cancer Res., January 1, 2004; 10(1): 136 - 143.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
R. S. Herbst and P. A. Bunn Jr.
Targeting the Epidermal Growth Factor Receptor in Non-Small Cell Lung Cancer
Clin. Cancer Res., December 1, 2003; 9(16): 5813 - 5824.
[Abstract] [Full Text] [PDF]


Home page
JAMAHome page
M. G. Kris, R. B. Natale, R. S. Herbst, T. J. Lynch Jr, D. Prager, C. P. Belani, J. H. Schiller, K. Kelly, H. Spiridonidis, A. Sandler, et al.
Efficacy of Gefitinib, an Inhibitor of the Epidermal Growth Factor Receptor Tyrosine Kinase, in Symptomatic Patients With Non-Small Cell Lung Cancer: A Randomized Trial
JAMA, October 22, 2003; 290(16): 2149 - 2158.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
F. R. Hirsch, M. Varella-Garcia, P. A. Bunn Jr, M. V. Di Maria, R. Veve, R. M. Bremnes, A. E. Baron, C. Zeng, and W. A. Franklin
Epidermal Growth Factor Receptor in Non-Small-Cell Lung Carcinomas: Correlation Between Gene Copy Number and Protein Expression and Impact on Prognosis
J. Clin. Oncol., October 15, 2003; 21(20): 3798 - 3807.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Pathol.Home page
W Hilbe, S Dirnhofer, F Oberwasserlechner, W Eisterer, K Ammann, T Schmid, G Hilbe, J Thaler, and E Woll
Immunohistochemical typing of non-small cell lung cancer on cryostat sections: correlation with clinical parameters and prognosis
J. Clin. Pathol., October 1, 2003; 56(10): 736 - 741.
[Abstract] [Full Text] [PDF]


Home page
ThoraxHome page
K M Fong, Y Sekido, A F Gazdar, and J D Minna
Lung cancer * 9: Molecular biology of lung cancer: clinical implications
Thorax, October 1, 2003; 58(10): 892 - 900.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
G. Sithanandam, G. T. Smith, A. Masuda, T. Takahashi, L. M. Anderson, and L. W. Fornwald
Cell cycle activation in lung adenocarcinoma cells by the ErbB3/phosphatidylinositol 3-kinase/Akt pathway
Carcinogenesis, October 1, 2003; 24(10): 1581 - 1592.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
C. Pellegrini, M. Falleni, A. Marchetti, B. Cassani, M. Miozzo, F. Buttitta, M. Roncalli, G. Coggi, and S. Bosari
HER-2/Neu Alterations in Non-Small Cell Lung Cancer: A Comprehensive Evaluation by Real Time Reverse Transcription-PCR, Fluorescence in Situ Hybridization, and Immunohistochemistry
Clin. Cancer Res., September 1, 2003; 9(10): 3645 - 3652.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
T.-L. Hung, F.-F. Chen, J. M. Liu, W.-W. Lai, A.-L. Hsiao, W.-T. Huang, H. H. W. Chen, and W.-C. Su
Clinical Evaluation of HER-2/neu Protein in Malignant Pleural Effusion-Associated Lung Adenocarcinoma and as a Tumor Marker in Pleural Effusion Diagnosis
Clin. Cancer Res., July 1, 2003; 9(7): 2605 - 2612.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
D. H. Johnson and C. L. Arteaga
Gefitinib in Recurrent Non-Small-Cell Lung Cancer: An IDEAL Trial?
J. Clin. Oncol., June 15, 2003; 21(12): 2227 - 2229.
[Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
H. Takeuchi, A. Bilchik, S. Saha, R. Turner, D. Wiese, M. Tanaka, C. Kuo, H.-J. Wang, and D. S. B. Hoon
c-MET Expression Level in Primary Colon Cancer: A Predictor of Tumor Invasion and Lymph Node Metastases
Clin. Cancer Res., April 1, 2003; 9(4): 1480 - 1488.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
R. Danesi, F. De Braud, S. Fogli, T. M. De Pas, A. Di Paolo, G. Curigliano, and M. Del Tacca
Pharmacogenetics of Anticancer Drug Sensitivity in Non-Small Cell Lung Cancer
Pharmacol. Rev., March 1, 2003; 55(1): 57 - 103.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
S. G. Spiro and J. C. Porter
Lung Cancer--Where Are We Today?: Current Advances in Staging and Nonsurgical Treatment
Am. J. Respir. Crit. Care Med., November 1, 2002; 166(9): 1166 - 1196.
[Abstract] [Full Text] [PDF]


Home page
ThoraxHome page
G E Goodman
Lung cancer * 1: Prevention of lung cancer
Thorax, November 1, 2002; 57(11): 994 - 999.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
A-P. Meert, B. Martin, P. Delmotte, T. Berghmans, J-J. Lafitte, C. Mascaux, M. Paesmans, E. Steels, J-M. Verdebout, and J-P. Sculier
The role of EGF-R expression on patient survival in lung cancer: a systematic review with meta-analysis
Eur. Respir. J., October 1, 2002; 20(4): 975 - 981.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
P. A. Janne, M. L. Taffaro, R. Salgia, and B. E. Johnson
Inhibition of Epidermal Growth Factor Receptor Signaling in Malignant Pleural Mesothelioma
Cancer Res., September 15, 2002; 62(18): 5242 - 5247.
[Abstract] [Full Text] [PDF]


Home page
The OncologistHome page
J. Baselga
Why the Epidermal Growth Factor Receptor? The Rationale for Cancer Therapy
Oncologist, August 15, 2002; 7(90004): 2 - 8.
[Abstract] [Full Text] [PDF]


Home page
The OncologistHome page
C. L. Arteaga
Epidermal Growth Factor Receptor Dependence in Human Tumors: More Than Just Expression?
Oncologist, August 15, 2002; 7(90004): 31 - 39.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
C.S. Brock and S.M. Lee
Anti-angiogenic strategies and vascular targeting in the treatment of lung cancer
Eur. Respir. J., March 1, 2002; 19(3): 557 - 570.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. D. Averbuch
Lung Cancer Prevention: Retinoids and the Epidermal Growth Factor Receptor--A Phoenix Rising?
Clin. Cancer Res., January 1, 2002; 8(1): 1 - 3.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brabender, J.
Right arrow Articles by Danenberg, P. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brabender, J.
Right arrow Articles by Danenberg, P. V.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online