This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Zou, Z. Articles by Sesterhenn, I. Search for Related Content PubMed PubMed Citation Articles by Zou, Z. Articles by Sesterhenn, I.

Maspin Expression Profile in Human Prostate Cancer (CaP) and in Vitro Induction of Maspin Expression by Androgen Ablation

Center for Prostate Disease Research, Department of Surgery, Uniformed Services University of the Health Sciences, Rockville, Maryland 20852 [Z. Z., T. C., R. C., J. M., S. S.]; Armed Forces Institute of Pathology, Department of Genitourinary Pathology, Washington, DC 20307 [W. Z., D. Y., I. S.]; The Prostate Centre, Vancouver General Hospital, Vancouver, British Columbia, V6H 3Z6 Canada [M. G. G., P. R.]; and Urology Service, Department of Surgery, Walter Reed Army Medical Center, Washington, DC 20307-5001 [J. M.]

	ABSTRACT

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Purpose: Expression of tumor suppressor gene, MASPIN, is associated with inhibition of tumor cell invasion and metastasis. Loss of or decreased expression of Maspin is found frequently in breast and prostate cancer cells. The objective of this study is to investigate Maspin expression in prostate tumor specimens and explore the mechanisms of hormonal regulation of Maspin expression in prostate tumors.

Experimental Design: Immunohistochemical staining of Maspin expression was performed on surgical whole-mounted prostate specimens. The expression of Maspin was scored on individual tumors. Correlation of Maspin expression with clinicopathological features was analyzed for statistical significance. Androgen ablation-induced Maspin expression was analyzed by Maspin promoter luciferase reporter assay and quantitative reverse transcription-PCR analysis of endogenous Maspin expression in LNCaP cells in vitro and in animal model.

Results: Comprehensive evaluation of Maspin expression profile in multiple tumor foci from whole mounted prostate specimens of prostate cancer patients revealed absence of Maspin expression in a significant fraction (63%). However, Maspin expression is significantly higher in tumor specimens (92%) of patients treated with neoadjuvant androgen ablation therapy before radical prostatectomy. LNCaP cells cultured in androgen-depleted medium show induction of Maspin promoter activity in a promoter luciferase reporter assay. In addition, Maspin expression is increased after castration in LNCaP prostate cancer cells derived tumors in nude mice.

Conclusions: Maspin expression is frequently absent in primary prostate cancers. Up-regulation of MASPIN in response to androgen ablation strongly suggests a physiological role of Maspin in growth inhibition and/or apoptosis of prostate cancer cells during androgen ablation.

	INTRODUCTION

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Maspin is a serpin with tumor suppressing activity. Decreased expression of Maspin is associated with tumor progression in breast tumor cells. Expression of Maspin in breast tumor cells inhibits tumor cell invasion in vitro and tumor cell metastasis in vivo (1) . Maspin expression is regulated by a variety of factors. We demonstrated recently that Maspin is directly regulated by the p53 gene. UV irradiation and cytotoxic agents also induce Maspin expression (2) . The manganese-containing superoxide dismutase is implicated in the up-regulation of Maspin in human breast cancer cells (3) . linolenic acid, an essential fatty acid with anticancer properties, is reported to induce Maspin expression and affect motility of cancer cells (4) . Zhang et al. have reported a comprehensive analysis of the Maspin promoter, which contains multiple cis elements that are subject to transcriptional regulation. Transcriptional activity of Maspin expression differs between benign prostatic cells and tumor cells, and the expression of MASPIN is subject to androgen regulation (5) . Hypermethylation of MASPIN promoter is also implicated in the absence of Maspin expression in breast tumors (6) .

The functional targets of Maspin remains unclear. Recently, Zhang et al. (7) have reported that Maspin may function as an angiogenesis inhibitor. Maspin blocks fibroblast growth factor and vascular endothelial growth factor-mediated endothelial cell migration. Maspin expression also inhibits neovascularization in the rat cornea pocket assay, and Maspin-treated prostate tumor cells are associated with reduced vascularization in a xenograft mouse model. Our observation that p53 directly regulates Maspin expression further emphasizes the biological function of Maspin downstream of the p53. These studies suggest that Maspin could play important roles in tumor cell invasion and metastasis.

The biological effects of androgen on target cells, e.g., prostatic epithelial cell proliferation and differentiation, as well as the androgen ablation-induced cell death, are mediated by transcriptional regulation of ARGs³ (8) . The gain of AR functions is believed to play a role in prostate tumorigenesis. Alterations of the androgen receptor gene by mutations in the hormone-binding domain of the AR or by amplification of the ARG have been reported in advanced stages of CaP (8 , 9) . Amplifications of the ARG in hormone refractory CaP represent yet another scenario where gain of AR function is associated with tumor progression (10 , 11) .

Several growth factors commonly involved in cell proliferation and tumorigenesis, e.g., insulin-like growth factor-I, epidermal growth factor, etc., have been shown to activate the transcription transactivation functions of the AR (12) . Recent studies analyzing expression of the ARGs in hormone-sensitive and refractory CWR22 nude mice xenograft models (13) have also shown sustained expression of several ARGs in AR-positive recurrent tumors after castration. This suggests activation of AR in these tumors. Thus, androgen regulation of critical target genes may play a role in normal prostate growth and prostate tumorigenesis.

In this study, we demonstrate that Maspin expression is absent frequently in primary prostate tumors. Therefore, loss of biological functions linked to Maspin, such as inhibition of angiogenesis and cell invasion, may contribute to the process of tumorigenesis. A higher frequency of Maspin expression in hormonally treated patients may serve as a biomarker for patients to respond to hormonal therapy.

	MATERIALS AND METHODS

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Specimens and Clinicopathological Features.
Ninety-seven patients who underwent radical retropubic prostatectomy at Walter Reed Army Medical Center and 24 patients who had neoadjuvant therapy before the prostatectomy were chosen for this study. The specimens were processed as paraffin embedded, whole mounted sectioned at 2.25-mm intervals at the Armed Forces Institute of Pathology. Clinical information and pathological data were obtained from the Department of Defense Center for Prostate Disease Research Tri-service Multicenter Longitudinal Prostate Cancer Database site at Walter Reed Army Medical Center. The Center for Prostate Disease Research database is an Institutional Review Board-approved retrospective and prospective prostate cancer registry of military health care beneficiaries using standardized forms that physicians and data managers complete during each patient visit.

Histopathological grading was done by a single pathologist (I. A. S) according to the Gleason grading system (14) and the WHO method for nuclear grade and glandular differentiation (15) . The specimens were grouped according to the degree of differentiation and nuclear grade. Staging was based on the Tumor-Node-Metastasis system (16) .

Immunohistochemistry Analysis.
H&E sections were analyzed for the presence of tumors. Sections containing the highest number of tumors and/or the largest tumor were selected for each patient. The corresponding tissue blocks were then recut into 4-µm thin sections and mounted on charged slides. The sections were deparaffined, and endogenous peroxidase was blocked with 0.6% hydrogen peroxide in methanol. Antigen retrieval was accomplished by microwaving for 15 min in 1 mM citrate buffer. Immunological detection was achieved with monoclonal anti-Maspin antibody (PharMingen) at a dilution of 1:320. The avidin-biotin-peroxidase system (Vectastain Elite kit; Vector Labs) was used to visualize the binding of the antibody.

The Maspin Immunohistochemistry slides were reviewed and graded by two pathologists (I. A. S. and W. Z.) in a similar manner as described previously (17) . The majority of specimens showed a very focal distribution. The areas of focal positivity with the highest number of immunoreactive tumor cells were used to grade the tumor as: negative; 1+, <25%; 2+, 26–50%; 3+, 51–75%; and 4+, 76–100%.

Statistical Analysis.
The Mantel-Haenszel ² test for trend and logistic regression was used to study the relationship of Maspin to age, race, WHO differentiation, WHO nuclear grade, Gleason sum, pretreatment PSA, and pathological stage in 97 radical prostatectomy patients without prior androgen ablation therapy. Kaplan-Meier survival methodology and Cox regression were used to study the relationship of Maspin expression to disease. The Pearson ² test and logistic regression were used to compare Maspin expression in radical prostatectomy specimens obtained from patients with or without androgen ablation therapy before radical prostatectomy.

Plasmid and Constructs.
The construction of the MASPIN promoter luciferase reporter has been described previously (2) . The promoter region of MASPIN was amplified by PCR according to the reported DNA sequence. The pM-Luc (-759) was generated by the primers: GAGACTCGAGGCTGAAGTACAGTGGTTAG (with XhoI site). The DNA fragment was cloned into the XhoI and HindIII site of the pGL3 basic vector (Promega).

Transfection and Luciferase Assay.
The LNCaP cells were plated at 5 x 10⁵ cells/well (six-well plate) 1 day before the transfection. The transfection was performed using the calcium-phosphate method (Clontech). The MASPIN promoter reporter plasmid (5 µg), p53 plasmid (2.5 µg), and an internal control plasmid pRL-TK (0.5 µg) were cotransfected into cells for 48 h, and the cells were then harvested for luciferase assay. Luciferase activity was measured by luminometer using the Dual-luciferase reporter assay system (Promega). The results are presented as fold induction of the reporter plasmid alone after normalization with the internal control plasmid pRL-TK.

Quantitative Reverse Transcription-PCR.
Total RNA was isolated from LNCaP tumors in nude mice by TRIzol reagent (Life Technologies, Inc., Gaithersburg, MD) according to the manufacturer’s instructions. A portion of total RNA (1 µg) was transcribed reversibly with Superscript reverse transcriptase (Life Technologies, Inc.). The PCR reaction was conducted in 7700 (PE-Biosystems) using the PCR kit from PE-Biosystems. The primers used for MASPIN are: TGCTGCCTACTTTGTTGGCAAGT; Forward: TGATACTGTCAATGTTTCCCATACAGA; Reverse, Probe. CCAGTGCAGATGATGAACATGGAGGCCAC.

LNCaP Tumor Growth.
Experiments on LNCaP tumor growth in nude mice were performed in the laboratory of Dr. Paul Rennie. LNCaP cells (1 x 10⁶) were inoculated s.c. with 0.1 ml of Matrigel (Becton Dickinson Labware, Bedford, MA) in the flank region of 6–8-week-old male athymic nude mice (BALB/c strain; Charles River Laboratory, Montreal, Canada). When the tumors reached 200–300 mm³ in volume, the mice were castrated via scrotal incision under methoxyflurane anesthesia. LNCaP tumors were harvested before and after castration.

	RESULTS

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Histological Distribution of Maspin Expression and Correlation with Clinical Parameters.
In benign prostatic tissue, the basal cells were uniformly immunoreactive with the anti-Maspin antibody. The secretory cells showed a focally intense reaction product either in isolated glands or in small clusters of glands, particularly in the periurethral region (Fig. 1A) .

View larger version (54K): [in this window] [in a new window] [Download PPT slide]   Fig. 1. Immunohistochemical staining of Maspin expression in prostatic tissue. A, strong Maspin expression in benign prostatic secretory cells and basal cells; B, negative Maspin expression in well-differentiated prostatic carcinoma; C, strong Maspin expression in prostatic carcinoma after neoadjuvant therapy.

Representative whole mounted prostate sections from 58 of 97 (60%) prostate cancer patients (60%) without neoadjuvant androgen ablation therapy were negative for Maspin expression (Table 1) . Association of Maspin expression in whole mounted prostate sections to age, race, differentiation, nuclear grade, Gleason sum, PSA, and pathological stage was analyzed. Intriguingly, Maspin expression was inversely correlated with the degree of tumor differentiation statistically (P = 0.05). The Maspin expression was positive in 25.8% of well-differentiated tumors, 43.8% of moderately differentiated tumors, and 50% of poorly differentiated tumors, respectively (Fig. 1B) . In a multivariable logistic regression analysis of the simultaneous influence of all seven variables on Maspin expression, only tumor differentiation was significant. Because of the multifocal nature of prostate cancers, 193 individual tumors were present in cancerous prostate glands of 97 patients. Only 72 of these 193 tumors (37.3%) showed Maspin expression, and 121 (62.7%) lacked Maspin expression. Maspin expression was significantly correlated with the WHO differentiation grade of prostate tumors with increased Maspin expression associating with fewer differentiated tumors (Table 2) . There were 37 individual tumors in prostate glands of 24 patients who had undergone neoadjuvant androgen ablation therapy. All of these cases showed at least focal response to the treatment. Twenty-nine of 37 tumors (78.4%) showed positive Maspin expression, predominantly in the cells with treatment effect (Fig. 1C) . However, there was no correlation between Maspin expression and the WHO differentiation in residual viable tumors similar to the untreated group. Two of three Maspin-negative cases in the treated group were tumors with only focal treatment effect. Tumor specimens from 22 of 24 patients treated with neoadjuvant androgen ablation treatment were Maspin positive (91.7%), a significantly (P < 0.001) higher positivity rate than that of 40.2% Maspin-positive tumors without androgen ablation therapy before surgery (Table 3, A and B) .

Molecular Mechanisms of Maspin Induction in Response to Androgen Ablation.
The strong association of increased Maspin expression in CaP specimens of patients treated with neoadjuvant androgen ablation therapy suggested that Maspin expression could be modulated by the androgen-signaling pathway. To demonstrate that androgen down-regulated MASPIN gene expression in prostate tumor cells, MASPIN promoter luciferase reporter assay was performed in LNCaP cells. LNCaP cells were cultured in androgen-deprived medium for 4 days, followed by transfection with MASPIN promoter luciferase construct. The cells were then cultured in this medium supplemented with 10 nM synthetic androgen R1881 for 48 h. As shown in Fig. 2 , MASPIN promoter-driven luciferase activity was 3-fold higher in androgen-deprived medium than in regular medium. Furthermore, the addition of synthetic androgen R1881 to androgen-deprived media abolished the increase of luciferase activity. This data suggested that the Maspin promoter was down-regulated by androgens in prostate tumor cells.

View larger version (10K): [in this window] [in a new window] [Download PPT slide]   Fig. 2. Induction of Maspin promoter in LNCaP cells. The LNCaP cells were plated at 5 x 105 cells/well (six-well plates) in medium containing charcoal-treated FBS 4 days before the transfection. The transfection was performed using the calcium phosphate method (Clontech). The Maspin promoter reporter plasmid (5 µg), p53 plasmid (2.5 µg), and an internal control plasmid pRL-TK (0.5 µg) were cotransfected into cells for 48 h, and the cells were harvested for luciferase assay. After transfection, the cells were cultured in either regular FBS (PMluc800-R), charcoal-treated FBS (PMluc800-C), or charcoal-treated FBS supplemented with 10 nM R1881 (PMLuc800-C+A). Luciferase activity was measured by luminometer using the dual luciferase reporter assay system (Promega). The results are presented as fold induction of the luciferase activity in regular FBS set as 1. The luciferase activity of the reporter plasmid is normalized with the internal control plasmid pRL-TK.

View larger version (12K): [in this window] [in a new window] [Download PPT slide]   Fig. 3. Real-time PCR analysis of Maspin expression in LNCaP tumors after castration. Total RNA (1 µg) from LNCaP tumors was reversibly transcripted. The cDNA (100 ng) was used in real-time PCR reaction. Six replica reactions were set for each time point, and the average cycle number for the threshold of detection was calculated. The real-time PCR cycle number comparing the intact and castrated RNA determined the fold induction. The 4-fold increase reflected two cycle difference of PCR. GAPDH was used for internal control. Intact, RNA was isolated from LNCaP tumors before castration; 4 days and 10 Days, RNA was isolated from LNCaP tumor after castration.

	DISCUSSION

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Maspin expression was absent in 60% of tumors. However, an inverse relationship between increased Maspin expression and degree of differentiation is intriguing and warrants additional study. This is the first study of a systematic and comprehensive evaluation of Maspin expression in the context of multifocal prostate cancers. Indeed, one of the unexpected data were the inverse relationship of Maspin expression to the degree of differentiation. This observation is indeed counterintuitive to the Maspin function as an inhibitor of tumor cell invasion and metastasis. However, tumor progression is a complex process involving changes in multiple molecular pathways. Furthermore, Maspin expression detected by immunostaining may not predict functional states of Maspin. At present, we are unable to role out a "p53 scenario" for Maspin, where the presence of p53 protein in tumor cells represents dysfunctional protein. On the other hand, increased Maspin expression in poorly differentiated tumors may indicate that a subset of prostate tumors may have acquired additional changes that bypass the normal regulation of Maspin expression. The regulation of Maspin expression, thus, cannot be attributed exclusively to a positive regulation by tumor suppressor gene p53 and a negative regulation by androgen signaling. Zhang et al. (5) have reported a comprehensive analysis of the Maspin promoter, which contains multiple cis elements that are subject to transcriptional regulation.

The experimental evidence presented here strongly suggests transcriptional induction of MASPIN in response to androgen ablation, and perhaps it is one of the important aspects of regulation of MASPIN expression in prostate cancer cells. Genes regulated by androgenic hormones are of critical importance for normal physiological function for the human prostate gland, and they contribute to the development of progression of prostate carcinoma.

Although Maspin expression is not detected in a significant portion of prostate cancers, Maspin expression is prevalent in the radical prostatectomy specimens of patients treated with neoadjuvant androgen deprivation therapy before surgery. Tumor cells that exhibit histological response to "hormonal treatment" showed Maspin expression. These data suggest that the androgen withdrawal may unmask Maspin expression in prostate cancer, which frequently lacks Maspin expression. Therefore, Maspin expression may serve as a possible biomarker for prostate cancer cells responding to the androgen ablation therapy.

A previous study reported that the MASPIN promoter contains a negatively regulated hormone responsive element (20) . Maspin expression on androgen withdrawal indicates either its active role in the androgen ablation-induced apoptosis or just a coincidental expression during the apoptosis. Whether expression of Maspin during androgen ablation is p53 dependent or independent remains to be determined. Regulation of MASPIN by p53, as well as androgen, suggests a role of Maspin in prostate cell growth/differentiation. Taken together, alterations of Maspin expression appear to play a role in prostate tumorigenesis, and the induction of Maspin expression in response to androgen ablation suggests for its potential functions in tumor cell growth inhibition and/or apoptosis.

	FOOTNOTES

 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ Z. Z. and W. Z. have contributed equally to this manuscript.

² To whom requests for reprints should be addressed, at Armed Forces Institute of Pathology, Department of Genitourinary Pathology, Washington, DC 20307. Phone: (202) 782-2756; Fax: (202) 782-3056.

³ The abbreviations used are: ARG, androgen-regulated gene; PSA, prostate-specific antigen; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; FBS, fetal bovine serum.

Received 9/18/01; revised 1/15/02; accepted 1/30/02.

	REFERENCES

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1. Zou Z., Anisowicz A., Hendrix M. J., Thor A., Neveu M., Sheng S., Rafidi K., Seftor E., Sager R. Maspin, a serpin with tumor-suppressing activity in human mammary epithelial cells. Science (Wash. DC), 263: 526-529, 1994.[Abstract/Free Full Text]
2. Zou Z., Gao C., Nagaich A. K., Connell T., Saito S., Moul J. W., Seth P., Appella E., Srivastava S. p53 regulates the expression of the tumor suppressor gene maspin. J. Biol. Chem., 275: 6051-6054, 2000.[Abstract/Free Full Text]
3. Li J. J., Colburn N. H., Oberley L. W. Maspin gene expression in tumor suppression induced by overexpressing manganese-containing superoxide dismutase cDNA in human breast cancer cells. Carcinogenesis (Lond.), 19: 833-839, 1998.[Abstract/Free Full Text]
4. Jiang W. G., Hiscox S., Horrobin D. F., Bryce R. P., Mansel R. E. -Linolenic acid regulates expression of maspin and the motility of cancer cells. Biochem. Biophys. Res. Commun., 237: 639-644, 1997.[CrossRef][Medline]
5. Zhang M., Maass N., Magit D., Sager R. Transactivation through Ets and Ap1 transcription sites determines the expression of the tumor-suppressing gene maspin. Cell Growth Differ., 8: 179-186, 1997.[Abstract]
6. Domann F. E., Rice J. C., Hendrix M. J., Futscher B. W. Epigenetic silencing of maspin gene expression in human breast cancers. Int. J. Cancer, 85: 805-810, 2000.[CrossRef][Medline]
7. Zhang M., Volpert O., Shi Y. H., Bouck N. Maspin is an angiogenesis inhibitor. Nat. Med., 6: 196-199, 2000.[CrossRef][Medline]
8. Trapman J., Cleutjens K. B. Androgen-regulated gene expression in prostate cancer. Semin. Cancer Biol., 8: 29-36, 1997.[CrossRef][Medline]
9. Tilley W. D., Buchanan G., Hickey T. E., Bentel J. M. Mutations in the androgen receptor gene are associated with progression of human prostate cancer to androgen independence. Clin. Cancer Res., 2: 277-285, 1996.[Abstract/Free Full Text]
10. Visakorpi T., Hyytinen E., Koivisto P., Tanner M., Keinanen R., Palmberg C., Palotie A., Tammela T., Isola J., Kallioniemi O. P. In vivo amplification of the androgen receptor gene and progression of human prostate cancer. Nat. Genet., 9: 401-406, 1995.[CrossRef][Medline]
11. Koivisto P., Kononen J., Palmberg C., Tammela T., Hyytinen E., Isola J., Trapman J., Cleutjens K., Noordzij A., Visakorpi T., Kallioniemi O. P. Androgen receptor gene amplification: a possible molecular mechanism for androgen deprivation therapy failure in prostate cancer. Cancer Res., 57: 314-319, 1997.[Abstract/Free Full Text]
12. Culig Z., Hobisch A., Cronauer M. V., Cato A. C., Hittmair A., Radmayr C., Eberle J., Bartsch G., Klocker H. Mutant androgen receptor detected in an advanced-stage prostatic carcinoma is activated by adrenal androgens and progesterone. Mol. Endocrinol., 7: 1541-1550, 1993.[Abstract]
13. Nagabhushan M., Miller C. M., Pretlow T. P., Giaconia J. M., Edgehouse N. L., Schwartz S., Kung H. J., Vere White R. W., Gumerlock P. H., Resnick M. I., Amini S. B., Pretlow T. G. CWR22: the first human prostate cancer xenograft with strongly androgen-dependent and relapsed strains both in vivo and in soft agar. Cancer Res., 56: 3042-3046, 1996.[Abstract/Free Full Text]
14. Gleason D. F. Histologic grading and clinical staging of prostatic carcinoma Tannenbaum M. eds. . Urologic Pathology: The Prostate, Chap. 9, : 171-198, Lea & Febiger Philadelphia 1977.
15. Mostofi D. F., Sesterhenn I. A., Sobin L. H. . International Histological Classification of Prostatic Tumor, WHO Geneva 1980.
16. Hermanek P., Sobin L. H. The International Union Against Cancer. Urological tumors: prostate. TNM classification of malignant tumors, 4^th ed 141-144, Springer-Verlag Berlin 1992.
17. Bettencourt M. C., Bauer J. J., Sesterhenn I. A., Mostofi F. K., McLeod D. G., Moul J. W. Ki-67 expression is a prognostic marker of prostate cancer recurrence after radical prostatectomy. J. Urol., 156: 1069-1070, 1996.[CrossRef][Medline]
18. Xia W., Lau Y. K., Hu M. C., Li L., Johnston D. A., Sheng S., El Naggar A., Hung M. C. High tumoral maspin expression is associated with improved survival of patients with oral squamous cell carcinoma. Oncogene, 19: 2398-2403, 2000.[CrossRef][Medline]
19. Maass N., Hojo T., Ueding M., Luttges J., Kloppel G., Jonat W., Nagasaki K. Expression of the tumor suppressor gene maspin in human pancreatic cancers. Clin. Cancer Res., 7: 812-817, 2001.[Abstract/Free Full Text]
20. Zhang M., Magit D., Sager R. Expression of maspin in prostate cells is regulated by a positive ets element and a negative hormonal responsive element site recognized by androgen receptor. Proc. Natl. Acad. Sci. USA, 94: 5673-5678, 1997.[Abstract/Free Full Text]

This article has been cited by other articles:

				C. Mamot, D. C. Drummond, C. O. Noble, V. Kallab, Z. Guo, K. Hong, D. B. Kirpotin, and J. W. Park Epidermal Growth Factor Receptor-Targeted Immunoliposomes Significantly Enhance the Efficacy of Multiple Anticancer Drugs In vivo Cancer Res., December 15, 2005; 65(24): 11631 - 11638. [Abstract] [Full Text] [PDF]

				R. J. Veldman, G. A. Koning, A. van Hell, S. Zerp, S. R. Vink, G. Storm, M. Verheij, and W. J. van Blitterswijk Coformulated N-Octanoyl-glucosylceramide Improves Cellular Delivery and Cytotoxicity of Liposomal Doxorubicin J. Pharmacol. Exp. Ther., November 1, 2005; 315(2): 704 - 710. [Abstract] [Full Text] [PDF]

				S. Yin, X. Li, Y. Meng, R. L. Finley Jr., W. Sakr, H. Yang, N. Reddy, and S. Sheng Tumor-suppressive Maspin Regulates Cell Response to Oxidative Stress by Direct Interaction with Glutathione S-Transferase J. Biol. Chem., October 14, 2005; 280(41): 34985 - 34996. [Abstract] [Full Text] [PDF]

				K. M. Laginha, S. Verwoert, G. J.R. Charrois, and T. M. Allen Determination of Doxorubicin Levels in Whole Tumor and Tumor Nuclei in Murine Breast Cancer Tumors Clin. Cancer Res., October 1, 2005; 11(19): 6944 - 6949. [Abstract] [Full Text] [PDF]

				H. Buhler and G. Schaller Transfection of Keratin 18 Gene in Human Breast Cancer Cells Causes Induction of Adhesion Proteins and Dramatic Regression of Malignancy In vitro and In vivo Mol. Cancer Res., July 1, 2005; 3(7): 365 - 371. [Abstract] [Full Text] [PDF]

				J. F. Kukowska-Latallo, K. A. Candido, Z. Cao, S. S. Nigavekar, I. J. Majoros, T. P. Thomas, L. P. Balogh, M. K. Khan, and J. R. Baker Jr. Nanoparticle Targeting of Anticancer Drug Improves Therapeutic Response in Animal Model of Human Epithelial Cancer Cancer Res., June 15, 2005; 65(12): 5317 - 5324. [Abstract] [Full Text] [PDF]

				D. C. Drummond, C. Marx, Z. Guo, G. Scott, C. Noble, D. Wang, M. Pallavicini, D. B. Kirpotin, and C. C. Benz Enhanced Pharmacodynamic and Antitumor Properties of a Histone Deacetylase Inhibitor Encapsulated in Liposomes or ErbB2-Targeted Immunoliposomes Clin. Cancer Res., May 1, 2005; 11(9): 3392 - 3401. [Abstract] [Full Text] [PDF]

				T. C. Stover, A. Sharma, G. P. Robertson, and M. Kester Systemic Delivery of Liposomal Short-Chain Ceramide Limits Solid Tumor Growth in Murine Models of Breast Adenocarcinoma Clin. Cancer Res., May 1, 2005; 11(9): 3465 - 3474. [Abstract] [Full Text] [PDF]

				G. Minotti, P. Menna, E. Salvatorelli, G. Cairo, and L. Gianni Anthracyclines: Molecular Advances and Pharmacologic Developments in Antitumor Activity and Cardiotoxicity Pharmacol. Rev., June 1, 2004; 56(2): 185 - 229. [Abstract] [Full Text] [PDF]

				P. Sapra and T. M. Allen Improved Outcome When B-Cell Lymphoma Is Treated with Combinations of Immunoliposomal Anticancer Drugs Targeted to Both the CD19 and CD20 Epitopes Clin. Cancer Res., April 1, 2004; 10(7): 2530 - 2537. [Abstract] [Full Text] [PDF]

				P. Sapra, E. H. Moase, J. Ma, and T. M. Allen Improved Therapeutic Responses in a Xenograft Model of Human B Lymphoma (Namalwa) for Liposomal Vincristine versus Liposomal Doxorubicin Targeted via Anti-CD19 IgG2a or Fab' Fragments Clin. Cancer Res., February 1, 2004; 10(3): 1100 - 1111. [Abstract] [Full Text] [PDF]

				B. Liu, F. Conrad, M. R. Cooperberg, D. B. Kirpotin, and J. D. Marks Mapping Tumor Epitope Space by Direct Selection of Single-Chain Fv Antibody Libraries on Prostate Cancer Cells Cancer Res., January 15, 2004; 64(2): 704 - 710. [Abstract] [Full Text] [PDF]

				Z. Khalkhali-Ellis, A. L. Christian, D. A. Kirschmann, E. M. Edwards, M. Rezaie-Thompson, M. A. Vasef, L. M. Gruman, R. E. B. Seftor, L. E. Norwood, and M. J. C. Hendrix Regulating the Tumor Suppressor Gene Maspin in Breast Cancer Cells: A Potential Mechanism for the Anticancer Properties of Tamoxifen Clin. Cancer Res., January 15, 2004; 10(2): 449 - 454. [Abstract] [Full Text] [PDF]

				A. Gabizon, A. T. Horowitz, D. Goren, D. Tzemach, H. Shmeeda, and S. Zalipsky In Vivo Fate of Folate-Targeted Polyethylene-Glycol Liposomes in Tumor-Bearing Mice Clin. Cancer Res., December 15, 2003; 9(17): 6551 - 6559. [Abstract] [Full Text] [PDF]

				C. Mamot, D. C. Drummond, U. Greiser, K. Hong, D. B. Kirpotin, J. D. Marks, and J. W. Park Epidermal Growth Factor Receptor (EGFR)-targeted Immunoliposomes Mediate Specific and Efficient Drug Delivery to EGFR- and EGFRvIII-overexpressing Tumor Cells Cancer Res., June 15, 2003; 63(12): 3154 - 3161. [Abstract] [Full Text] [PDF]

				I. B. Roninson Tumor Cell Senescence in Cancer Treatment Cancer Res., June 1, 2003; 63(11): 2705 - 2715. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Zou, Z. Articles by Sesterhenn, I. Search for Related Content PubMed PubMed Citation Articles by Zou, Z. Articles by Sesterhenn, I.