| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Experimental Therapeutics, Preclinical Pharmacology |
CRC Centre for Cancer Therapeutics, The Institute of Cancer Research, Sutton SM2 5NG [V. S., M. G. R., E. B., P. W., L. R. K.], and St. Georges Hospital Medical School, Cranmer Terrace, London SW17 OQS [L. R. K.], United Kingdom
| ABSTRACT |
|---|
|
|
|---|
-subunit of farnesyl transferase by phosphorylation. Hence, resistance to R115777 was generated; the mechanism of resistance in this model may be associated with the enzyme target of the inhibitor. The results suggest that the development of clinical resistance may occur with farnesyl protein transferase inhibitors. | INTRODUCTION |
|---|
|
|
|---|
Proteins that are modified by prenylation often contain a CAAX box motif at their COOH terminus, where C is cysteine, A is any aliphatic amino acid, and X can be any amino acid, but determines which of the enzymes preferentially modifies the protein (1) . The prenyl group is added to the cysteine of the CAAX box; then the three terminal amino acids are removed, and a carboxymethyl group is added. Altogether, these alterations enable the protein to bind to the plasma membrane, which is required to exert its biological function. Examples of protein substrates of farnesyl transferase are the ras family of oncoproteins, rhoB, nuclear lamins, rhodopsin kinase, CENP-E, and CENP-F (2 , 3) .
FTIs3 are a class of inhibitors that affect prenylation (4 , 5) . It was originally thought that they would predominantly inhibit the growth of ras-dependent tumors. However, studies since have suggested that ras may not be the sole or even the main target of these compounds, and, certainly, responses to these agents do not appear to correlate with ras status (2 , 5 , 6) .
Because FTIs are a new class of compounds that are currently undergoing clinical trials, little is known about possible mechanisms of resistance to these agents. As resistance occurs to most commonly used anticancer drugs and also occurs with new agents acting on novel "molecular targets," such as flavopiridol (7) and STI-571 (8) , it seems likely that it will also occur with novel agents, such as R115777 (9) . The present study set out to investigate the chemosensitivity to R115777 of a small panel of human cancer cell lines, to generate a resistant cell line, and to examine possible mechanisms of resistance in this line. The approaches taken were based on both known mechanisms of resistance and the mechanism of action of the agent investigated. Hence, the roles of drug efflux pumps, drug accumulation, farnesyl transferase protein expression, and enzyme activity were determined.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell Culture.
All cells (human colon cancer cell lines BE, COLO205, DLD1, HCT116, HT29, KM12, and KM12/R115 possessing acquired resistance to R115777), human breast cancer cell line MCF7, human ovarian carcinoma cell line CH1/doxR (11)
, A2780 A1, A2780 E6 (12)
, SKOV3-puro, and SKOV3-S2 (13)
were grown as monolayers in DMEM (Life Technologies, Inc., Paisley, Scotland, United Kingdom) augmented with 10% heat-inactivated FCS, 2 mM L-glutamine, MEM nonessential amino acids (both Life Technologies, Inc.), and 0.5 µg/ml hydrocortisone in a 6.5% CO2, 93.5% air atmosphere.
Growth Inhibition Assay.
The SRB assay was used to determine growth inhibition (14)
. Briefly, cells were seeded at 4 x 104 cells/ml into 96-well microtiter plates in 160 µl of growth medium. After overnight incubation, serial dilutions of drug were added to quadruplicate wells, and cells were exposed for 96 h. Quantitation of cell growth was assessed using 0.4% SRB dissolved in 1% acetic acid. IC50s were determined, and RFs were calculated for each individual experiment by the ratio of IC50 of KM12:R115 cells over IC50 of KM12 cells. A mean and SD was then determined.
Doubling Times.
Cells were seeded at a concentration of 1 x 105 into 25-cm2 flasks. The cells were harvested by trypsinization, and the number was determined using a hemocytometer after 24-, 48-, 72-, and 96-h incubation. The doubling times were calculated for the exponential growth phase.
Western Blot.
Western blot analysis of proteins was carried out as described previously (13)
using asynchronous cells in exponential growth phase with detection by enhanced chemiluminescence (NEN Life Sciences, Boston, MA). Antibodies were obtained from Santa Cruz Biotechnology [FTase
(C-19), FTase ß (X-28), hsp40 (N-19), Raf-1 (E-10), rhoB (119), and lamin B (C-20)], Centicor Diagnostics [Malvern, PA; PgP (C219)], Transduction Laboratories (Lexington, KY; pan-ras), New England Biolabs [phospho-raf (ser259)], and Sigma Chemicals (actin). Prelamin A antibody was kindly provided by Drs. A. Adjei and S. Kaufmann (Mayo Clinic, Rochester, NY; Ref. 15
). Secondary antibody conjugated to horseradish peroxidase was obtained from Amersham Pharmacia Biotech (Amersham, United Kingdom).
Immunoprecipitation.
Cell lysates [50 mM HEPES, 250 mM NaCl, 0.1% NP40, 10 mM ß-glycerophosphate, 1 mM NaF, 1 mM EDTA, 1 mM DTT (Roche, Lewes, United Kingdom), 0.2 mM NaVO3, and protease inhibitor tablets (Roche)] were prepared from exponentially growing cells exposed to equimolar or equitoxic doses of R115777 for 24 h before harvesting. Protein (300400 µg) was immunoprecipitated using 2.4 µg of antibody to farnesyl transferase
and bound to protein A Sepharose beads. After washing, Western blot analysis was carried out as above, and the blot was probed for phospho-thr and phospho-ser (both Zymed, San Francisco, CA).
Uptake of R115777.
The accumulation of R115777 was measured in exponentially growing cells exposed to medium containing 2.5 or 30 µM 14C-R115777 provided by Dr. D. End, Janssen Research Foundations (specific activity 1.43 Gbq.mmol, 5.98 MBq/ml) for 4 h at 37°C. To determine drug efflux, cells were washed twice in PBS after the 4-h incubation and maintained for an additional 4 h. Cells were washed and lysed in NaOH overnight, and the radioactivity was counted in the lysate and supernatant by scintillation counting (2200CA; Packard).
Measurement of Prenyl Transferase Activity.
Prenyl transferase activity was measured based on a method published previously (16)
. Briefly, exponentially growing cells were lysed in 50 mM Tris, 200 mM KCl, 20 µM ZnCl2, 5 mM DTT, 100 µM leupeptin, and 1 mM phenylmethylsulfonyl fluoride by sonication. Homogenates were centrifuged at 178,000 x g for 90 min at 4°C using a fixed angle rotor (Centrikon, T-2060 Ultracentrifuge; Kontron, St. Albans, Herts, United Kingdom). The supernatant was concentrated in Millipore Biomax filters by centrifugation at 120 x g for 30 min at room temperature. An aliquot was taken to determine protein levels by the bicinchoninic acid protein assay (Pierce, Rockford, IL). Prenyl transferase (or geranylgeranyl transferase I) activity was measured in duplicate by mixing 10 µl of cytosol homogenate and 15 µl of FTase buffer containing 50 mM Tris (pH 7.5), 5 mM MgCl2, 20 µM ZnCl2, 50 µM DTT, 6.8 mM n-octylglucoside, 0.5 µM [1-3H] farnesylpyrophosphate (specific activity 20.5 Ci/mmol; NEN Life Sciences) or [1-3H] geranylgeranylpyrophosphate (both NEN Life Sciences), 200 µM Na3VO4, 5 µM H-ras wt for farnesyl transferase, or H-ras-CVLL (both Panvera Corp., Madison, WI) for geranylgeranyl transferase I. Samples were incubated for times
60 min at 37°C, and the reaction was stopped by the addition of 65 µl of 10% hydrochloric acid in ethanol. Samples were transferred to Whatman GFC filters, which were washed four times with ethanol, dried filters were mixed with 4 ml of scintillant (Ultima Gold), and tritium levels were counted.
Sequencing.
The two subunits were amplified using the extensor HI-Fidelity PCR kit (ABgene; Epsom, Surrey, United Kingdom) according to the manufacturers instructions using the following primers: forward 5' CTGTCCTGCAGCGTGATGAA 3', reverse: 5' ACCACTCTCGTGTGAAACTC 3' for farnesyl transferase
and forward: 5' CTGCTGCTCTTCCTGATCATGGCTTCTCC 3', reverse: 5' TCTAGTCGGTTGCAGGCTCTGCCGATGT 3' for farnesyl transferase ß. The amplification cycles for farnesyl transferase
were: 94°C for 5 min, 35 cycles at 94°C for 1 min, 60°C for 1 min, and 72°C for 3 min to yield a product of 902 bp in length; for farnesyl transferase ß, were: 30 cycles were run at 94°C for 1 min, 65°C for 1 min, and 72°C for 3 min to yield a product of 1334 bp in length. DNA was extracted using the QIaAMP gel extraction kit (Qiagen, Crawley, United Kingdom) according to the manufacturers instructions. Sequencing was carried out using the rhodamine dye terminator reaction kit (PE Biosystems, Warrington, United Kingdom) according to the manufacturers instructions and analyzed using ABI PRISM 377 (PE Biosystems). Primers for sequencing are listed in Table 1
.
|
| RESULTS |
|---|
|
|
|---|
As KM12 cells were the most sensitive cell line in the panel investigated, these were chosen to generate a cell line with acquired resistance to R115777. Over a period of 4 months, KM12 cells were continuously exposed to increasing concentrations of R115777. Concentrations started at 0.2 µM (96-h IC50) and were doubled each time the cells grew to confluency until a concentration of 1.6 µM (8 x original 96-h IC50) was achieved. Cells viable at this concentration showed a 13-fold increase in resistance to R115777 at the IC50 level (Table 2)
. The resistant subline was designated KM12/R115. The resistance was stable for
3 months (data not shown). Doubling times were assessed for the parent and the resistant lines and found not to be significantly different (11.8 ± 2.5 h for KM12 and 13.1 ± 2.6 h for KM12/R115, P = 0.468).
|
Reduced drug accumulation is often associated with resistance to anticancer agents (20)
. It frequently involves the overexpression of drug efflux pumps, such as PgP (21)
. The protein expression of PgP was studied in KM12 and KM12/R115 cells using Western blotting (Fig. 1A)
. No protein was detectable for PgP as compared with the positive control CH1doxR. The screening results mentioned earlier showed that MRP1 expression did not reduce sensitivity to R115777. Besides PgP and MRP1, other drug efflux or uptake mechanisms may potentially be involved in the resistance to R115777. Altered activity of any of these mechanisms could lead to decreased cellular accumulation of drugs. To investigate this, drug accumulation of radiolabelled R115777 was determined in the parent KM12 and the resistant KM12/R115 cells. Levels of R115777 were measured in both these cell lines after 4-h exposure to the drug and 4-h after removal of the drug. The results (Fig. 1B)
show that when treated at 2.5 µM (10 x 96-h IC50 of KM12), parent and resistant cells showed similar levels of drug accumulation. Treatment of KM12/R115 cells with 30 µM (i.e., at an equitoxic dose) showed a 12-fold increase in drug accumulation compared with the cells treated at 2.5 µM. Four h after drug removal, the amount of R115777 measured in the cells decreased. Interestingly, KM12/R115 cells exposed to 2.5 µM the drug retained more of the compound (1.47 ± 0.073 nmol/mg protein) than the parent cells (0.20 ± 0.05 nmol/mg protein) treated at the same concentration, although this difference was not statistically significant (P = 0.08). KM12/R115 cells exposed to 30 µM R115777 decreased levels by 1.5-fold (23.816.1 nmol/mg protein).
|
|
|
and ß, did not differ between the parent and the resistant cell line (Fig. 2)
60 min. In the parent cell line, the amount of product formed by the enzyme activity of farnesyl transferase increased in a linear fashion over the time course investigated. However, in the resistant cells, the enzyme activity was barely detectable (>1000-fold lower than in the parent cells; 0.066 ± 0.028 versus <0.00006 pmol/min/mg protein) under the same conditions (Fig. 3B)
subunit and only differ in their ß-subunit (24)
. Additionally of note, proteins can become geranylgeranylated when farnesylation is blocked (25)
. To determine whether geranylgeranyl transferase I was active in both cell lines, the activity of this enzyme was also determined in cell extracts. Similar levels of geranylgeranyl transferase I activity could be observed in both cell lines (0.127 ± 0.052 pmol/min/mg protein in KM12 versus 0.121 ± 0.075 in KM12/R115; Fig. 3C
Sequencing of Farnesyl Transferase.
The results described earlier in this article indicated that the resistance mechanism to R115777 may involve the target enzyme farnesyl transferase. Studies on another FTI (FTI-277) showed that a mutation in the Dpr1 gene encoding the ß-subunit of the yeast FTase enzyme could lead to resistance to FTIs (26)
. Therefore, sequence analysis of the two subunits of the enzyme was carried out by PCR sequencing of cDNAs from the sensitive and resistant lines. For the
-subunit, the full-length cDNA could not be amplified because of its GC richness at the beginning of the sequence. Thus, a primer starting at 320 bp was used. For the ß-subunit, the full-length sequence was determined. No differences in sequence were observed in either the
- or the ßsubunit when the sequences were compared between the two cell lines and also when the sequences were compared with those published in GenBank (accession no. L10413 for
subunit and L10414 for ß-subunit; data not shown). Of particular note, the ß-subunit mutations associated previously with conversion of substrate specificity of farnesyl transferase to that of geranylgeranyltransferase (amino acid positions Ser-159, Tyr-362, and Tyr-366; Ref. 26
) were not detected in KM12/R115.
Regulation of Farnesyl Transferase
.
As shown above, although the levels of the two subunits are similar on Westerns and there are no mutations, the activity of farnesyl transferase is markedly reduced in extracts from the resistant cells in comparison to extracts from the parent line. There is some evidence that the farnesyl transferase
-subunit may be activated by phosphorylation at either Thr and/or Ser; possibly (27)
by transforming growth factor ß1 receptor (27
, 28)
. Thus, activation of the enzyme could be affected by phosphorylation of the
-subunit. Cells were treated for 24 h with equimolar (2.5 µM) or equitoxic (2.5 µM for KM12 and 30 µM for KM12/R115) concentrations of R115777. Farnesyl transferase
was immunoprecipitated, and Western blot analysis was performed using phospho-ser and phospho-thr antibodies. The results (Fig. 4)
indicate no difference in phosphorylation between KM12 and KM12/R115 (Lanes 1 and 3). In addition, no difference was observed between samples from control cells and those treated with R115777.
|
| DISCUSSION |
|---|
|
|
|---|
A cell line was generated that showed acquired resistance to R115777. This resistance was found to be stable for
3 months in drug-free medium. The fold resistance was 13-fold as measured by SRB growth inhibition assays. No difference in doubling times was observed between the two cell lines.
The chemosensitivity to several other compounds, including one structurally different FTI (FTI-277) and also GGTI-298, were compared between the parent KM12 cells and the resistant KM12/R115 cells. No statistically significant cross-resistance was observed to the commonly used anticancer agents doxorubicin, cisplatin, paclitaxel, and etoposide or to the signal transduction inhibitors UO126, LY294002, and PD153035. Actually, collateral sensitivity was observed after exposure to doxorubicin and cisplatin. The mechanism underlying this intriguing observation is presently unknown but may relate to the involvement of farnesylation in many cellular processes, such as cell cycle control and apoptosis (2
, 6
, 30)
. A 14.5-fold increase in 96-h IC50 was observed after treatment with FTI-277. Interestingly, the 96-h IC50 of GGTI-298 did not differ between KM12 and KM12/R115 cells. These results indicate that the mechanism of resistance is probably specific to the molecular target enzyme farnesyl transferase. The two FTIs used for cross-resistance both compete with the CAAX box peptide for its binding site (5)
. Additional investigations using a competitive inhibitor of the farnesyl donor,
-hydroxyfarnesylphosphonic acid, did not show any growth inhibitory effects at concentrations
100 µM (data not shown). Thus, attempts to determine whether the CAAX box binding site may be involved in the mechanism of resistance in this model could not be carried out using this approach. The lack of cross-resistance to the signaling inhibitors indicates that the mechanism of resistance probably does not involve alterations elsewhere in the ras signaling pathway (although ras does affect pathways other than phosphatidylinositol 3'-kinase/akt and mitogen-activated protein/extracellular signal-regulated kinase kinase).
It was important to rule out other potential mechanisms of resistance. Decreased drug accumulation is often associated with drug resistance and can involve overexpression of drug efflux pumps (20) . One of the most studied efflux pumps is PgP (21) . However, no protein expression of PgP was observed in either the parent or resistant cell line. The studies using the isogenic pair of cells differing only in the expression of MRP1 also indicated that MRP1 was not involved in resistance. Additionally, studies on the KM12 and KM12/R115 cells were carried out using buthionine sulfoximine, which leads to inhibition of MRP1 activity (13) . These confirmed the above results that MRP1 is not involved in the mechanism of resistance to R115777 (data not shown). Determining the concentration of radiolabelled R115777 in KM12 and KM12/R115 cells revealed that after exposure to an equimolar concentration of R115777, similar amounts of the drug were measured in the two cell lines. When the resistant cells were exposed to an equitoxic concentration of the inhibitor (i.e., 12-fold more than the parent cells), a 12-fold increase in R115777 measured in the resistant cells was found. After removing the drug from the medium, a decrease in the amount of drug found in the cells was observed in both the parent and resistant lines. Interestingly, more residual compound was measured in the resistant cells exposed to 2.5 µM compared with the parent cells exposed to the same concentration. Taken together, these results indicate that reduced drug accumulation does not play a role in the resistance mechanism in this model.
Alterations in the level of target proteins can lead to drug resistance, e.g., in the case of topoisomerase inhibitors. Thus, the expression of the two subunits of farnesyl transferase, and various proteins known to be farnesylated (rhoB, hsp40, and raf-1, including phosphorylated raf), pan-ras and lamin B were studied (1) . Except for lamin B, no marked difference in expression of any of these proteins was found. Lamin B is a nuclear protein that forms filaments at the inner surface of the nuclear membrane and is involved in the disassembly of the nucleus during mitosis (1) . The increased expression of lamin B could be a consequence of the decreased activity of farnesyl transferase in the resistant cells, e.g., to compensate for less farnesylation, more protein is being produced. However, it is not clear why lamin B is increased in the resistant line when other proteins that are farnesylated (e.g., ras and rho B) are unaffected. Of potential relevance, proteins normally farnesylated have been found to be geranylgeranylated when farnesylation is inhibited (25) . This switch from one type of prenylation to another might be sufficient for the activity of the respective proteins.
As already mentioned, the activity of farnesyl transferase was measured in KM12 and KM12/R115 cells. This was first performed indirectly by measuring the accumulation of prelamin A after exposure to R115777 (15
, 22)
. In both cell lines, inhibition of farnesyl transferase by 2.5 µM R115777 resulted in an increase in prelamin A accumulation consistent with reduced farnesylation and decreased conversion to lamin A. However, in the resistant cells, this increase was not as pronounced as in the parent cells. Additionally, no further increase in prelamin A accumulation was observed when the resistant cells were treated at 30 µM. These results indicate that a decrease in farnesyl transferase activity may be involved in the mechanism of resistance in this model. Therefore, farnesyl transferase activity was measured in cytosolic extracts of the cells. Farnesyl transferase activity was found to be barely detectable in the extracts of resistant cells, whereas it was clearly detectable (>1000-fold higher) in the extracts of parent cells under the same conditions. The parent cells showed an IC50 of 11.2 nM for R115777 against FTase, which is similar to reported values (9)
. Western blotting showed that expression of both
and ß subunits of the farnesyl transferase enzyme was very similar at the protein level. Hence, this could be ruled out as an explanation for the reduced enzyme activity. The decreased activity of farnesyl transferase in the resistant cells was not attributed to inhibitory substances in the cytosolic extracts, as mixing pure farnesyl transferase with the extract did not change the activity of the enzyme (data not shown). In addition, the farnesyl transferase enzyme did not alter its substrate specificity, as no activity could be measured when either ras-CVLL or geranylgeranylpyrophophate were used. The activity of geranylgeranyl transferase I did not differ between the two cell lines and was not affected by 500 nM R115777, a concentration 50-fold above the IC50 for farnesyl transferase in the parent cells. It is interesting that the resistant line does not attempt to compensate for the reduced activity of farnesyl transferase by elevating geranylgeranyltransferase I.
It seemed possible from the above results and also from data published previously (26)
that the mechanism of resistance could involve a mutation of the enzyme. A previous study in yeast found that mutations of Ser-159, Tyr-362, or Tyr-366 in the ß-subunit of farnesyl transferase led to an alteration of substrate specificity (26)
. Therefore, the cDNAs for the two subunits of farnesyl transferase were sequenced in the parent and resistant lines. In neither of the two subunits was a mutation found when the sequences were compared either to each other or to GenBank entries (although the first 320 bp of the
-subunit were not analyzed). Thus, a mutation in the sequenced fragments can be ruled out as the cause of the resistance to R115777 in this model, including the Ser-159, Tyr-362, and Tyr-366 ß-subunit sites described in the above yeast study. It is unlikely that a mutation in the unsequenced fragment of the
-subunit of farnesyl transferase plays a role in the resistance mechanism to R115777, because the first 51 amino acid residues of this subunit do not affect the catalytic activity of the enzyme. Moreover, a mutation in this region would also lead to a decrease in the activity of geranygeranyl transferase activity, as both enzymes share the same
-subunit (24)
, and this was not seen.
Another potential explanation for the reduced farnesyl transferase enzyme activity in the resistant cells could be a difference in posttranslational modification or cellular localization. The
-subunit of farnesyl transferase has been shown in some studies to be phosphorylated after stimulation by insulin or interaction with the transforming growth factor-ß receptor (27
, 28)
. This phosphorylation is associated with an increase in farnesyl transferase activity. However, the exact residues that are phosphorylated or the kinase involved in this process are currently not known. It has been suggested that the
-subunit is phosphorylated by a serine/threonine kinase (27)
. If this phosphorylation site lies within the region not sequenced, it is possible that a mutation could have occurred there that would reduce the activity of the enzyme. Alternatively, the activity of the kinase(s) responsible for phosphorylating the farnesyl transferase
-subunit could be reduced. Analysis of the phosphorylation state of the
-subunit of farnesyl transferase by Western blotting showed no difference between parent and resistant cell line. In addition, no difference was observed when cells were exposed to R115777. Thus, these results indicate that activation of the
-subunit of farnesyl transferase by phosphorylation is unlikely to be altered between the two cell lines. However, how the ß-subunit of farnesyl transferase is regulated is currently unknown and, hence, this is a possible area of further investigation.
In conclusion, the work presented herein describes the first example of the generation of a cell line that is resistant to a FTI, in this case, to the drug R115777, which is currently undergoing clinical trial. Evidence was presented that shows that the resistance to R115777 was specific for the class of FTIs. A number of potential mechanisms for the resistance was ruled out, including those involving altered drug transport or changes in the level of
or ß enzyme subunits. Several approaches pointed to a resistance mechanism involving an alteration of the molecular target enzyme itself. Farnesyl transferase enzyme activity was markedly reduced in extracts of the resistant cells, and this was consistent with increased expression of lamin B, which provides a cellular readout for farnesyl transferase activity. However, this reduced activity was not because of mutation or to differences in overall phosphorylation of the
-subunit at either thr or ser. Overall, however, it remains unclear as to how exactly the measured reduced enzyme activity causes resistance to R115777. Additional experiments are required such as isolating FTase from the resistant line and demonstrating it is less sensitive to R115777 and/or using additional quantitative methods showing that protein farnesylation in the resistant cells is affected to a lesser degree by R115777 (e.g., labeling with [3H]farnesyl PPI and immunoprecipitating farnesylated proteins). Regardless, the resistant cell line described here shows a mechanism of resistance that appears to be specific to farnesyl transferase inhibition and indicates that resistance to this class of compounds may also occur in a clinical setting.
| FOOTNOTES |
|---|
1 Supported by the Cancer Research Campaign (United Kingdom; CRC: SP2330/0201) and an Institute of Cancer Research Studentship (to V. S.). P. W. is a CRC Life Fellow. ![]()
2 To whom requests for reprints should be addressed, at Antisoma plc. St Georges Hospital Medical School, Cranmer Terrace, London SW17 OQS, UK. Phone: 44 20 8772 4393; Fax: 44 20 8767 1809; E-mail: lloyd{at}antisoma.com ![]()
3 The abbreviations used are: FTI, farnesyl transferase inhibitor; SRB, sulforhodamine B; GGTI, geranylgeranyl transferase I inhibitor; RF, resistance factor; wt, wild type. ![]()
Received 11/12/01; revised 3/18/02; accepted 3/27/02.
| REFERENCES |
|---|
|
|
|---|
subunit. Cell, 65: 429-434, 1991.[CrossRef][Medline]
. J. Biol. Chem., 270: 29628-29631, 1995.This article has been cited by other articles:
![]() |
T. Raz, V. Nardi, M. Azam, J. Cortes, and G. Q. Daley Farnesyl transferase inhibitor resistance probed by target mutagenesis Blood, September 15, 2007; 110(6): 2102 - 2109. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-L. Harousseau, J. E. Lancet, J. Reiffers, B. Lowenberg, X. Thomas, F. Huguet, P. Fenaux, S. Zhang, W. Rackoff, P. De Porre, et al. A phase 2 study of the oral farnesyltransferase inhibitor tipifarnib in patients with refractory or relapsed acute myeloid leukemia Blood, June 15, 2007; 109(12): 5151 - 5156. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. K. Peterson, P. Kelly, C. A. Weinbaum, and P. J. Casey A Novel Protein Geranylgeranyltransferase-I Inhibitor with High Potency, Selectivity, and Cellular Activity J. Biol. Chem., May 5, 2006; 281(18): 12445 - 12450. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. F. Goemans, C. M. Zwaan, A. Harlow, A. H. Loonen, B. E. S. Gibson, K. Hahlen, D. Reinhardt, U. Creutzig, M. C. Heinrich, and G. J. L. Kaspers In vitro profiling of the sensitivity of pediatric leukemia cells to tipifarnib: identification of T-cell ALL and FAB M5 AML as the most sensitive subsets Blood, November 15, 2005; 106(10): 3532 - 3537. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. F. Cloughesy, J. Kuhn, H. I. Robins, L. Abrey, P. Wen, K. Fink, F. S. Lieberman, M. Mehta, S. Chang, A. Yung, et al. Phase I Trial of Tipifarnib in Patients With Recurrent Malignant Glioma Taking Enzyme-Inducing Antiepileptic Drugs: A North American Brain Tumor Consortium Study J. Clin. Oncol., September 20, 2005; 23(27): 6647 - 6656. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Buzzeo, S. Enkemann, R. Nimmanapalli, M. Alsina, M. G. Lichtenheld, W. S. Dalton, and D. M. Beaupre Characterization of a R115777-Resistant Human Multiple Myeloma Cell Line with Cross-Resistance to PS-341 Clin. Cancer Res., August 15, 2005; 11(16): 6057 - 6064. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Bruzek, J. N. Poynter, S. H. Kaufmann, and A. A. Adjei Characterization of a Human Carcinoma Cell Line Selected for Resistance to the Farnesyl Transferase Inhibitor 4-(2-(4-(8-Chloro-3,10-dibromo-6,11-dihydro-5H-benzo-(5,6)-cyclohepta(1,2-b)-pyridin-11(R)-yl)-1-piperidinyl)-2-oxo-ethyl)-1-piperidinecarboxamide (SCH66336) Mol. Pharmacol., August 1, 2005; 68(2): 477 - 486. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Larghero, N. Gervais, B. Cassinat, J.-D. Rain, M.-H. Schlageter, R. A. Padua, C. Chomienne, and P. Rousselot Farnesyltransferase inhibitor tipifarnib (R115777) preferentially inhibits in vitro autonomous erythropoiesis of polycythemia vera patient cells Blood, May 1, 2005; 105(9): 3743 - 3745. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |