Clinical Cancer Research Prevention Award Frontiers in Basic Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lord, R. V. N.
Right arrow Articles by Rosell, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lord, R. V. N.
Right arrow Articles by Rosell, R.
Clinical Cancer Research Vol. 8, 2286-2291, July 2002
© 2002 American Association for Cancer Research


Molecular Oncology, Markers, Clinical Correlates

Low ERCC1 Expression Correlates with Prolonged Survival after Cisplatin plus Gemcitabine Chemotherapy in Non-Small Cell Lung Cancer1

Reginald V. N. Lord2, Jan Brabender2, David Gandara, Vicente Alberola, Carlos Camps, Manuel Domine, Felip Cardenal, José M. Sánchez, Paul H. Gumerlock, Miquel Tarón, José J. Sánchez, Kathleen D. Danenberg, Peter V. Danenberg and Rafael Rosell3

University of Southern California/Norris Comprehensive Cancer Center, Los Angeles, California 90033 [R. V. N. L., J. B., P. V. D.]; University of California, Davis Cancer Center, Sacramento, California 95817 [D. G., P. H. G.]; Hospital Arnau de Vilanova, 46015 Valencia, Spain [V. A.]; Hospital General de Valencia, 46014 Valencia, Spain [C.C.]; Fundación Jiménez Diaz, 28005 Madrid, Spain [M. D.]; Institut Català d’Oncologia, 08907 Bellvitge, Barcelona, Spain [F. C.]; Hospital Germans Trias i Pujol, Badalona, s/n 08916 Barcelona, Spain [J. M. S., M. T., R. R.]; Free University of Madrid, 28029 Madrid, Spain [J. J. S.]; and Response Genetics, Los Angeles, California 90033 [K. D. D.]


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Purpose: Overexpression of the excision repair cross-complementing 1 (ERCC1) gene, which is crucial in the repair of cisplatin (CDDP)-DNA adducts, is reported to negatively influence the effectiveness of CDDP-based therapy for gastric and ovarian cancers. Recent evidence indicates that Gemcitabine (Gem) may modulate ERCC1 nucleotide excision repair activity, and down-regulation of DNA repair activity by ERCC1 antisense RNA reportedly inhibits synergism of CDDP/Gem. We investigated whether ERCC1 mRNA expression levels were associated with clinical outcomes after treatment with a combination Gem/CDDP regimen for patients with advanced stage non-small cell lung cancer (NSCLC).

Experimental Design: Response and survival were correlated with the level of ERCC1 expression in 56 patients with advanced (stage IIIb or IV) NSCLC treated as part of a multicenter randomized trial with Gem 1250 mg/m2 days 1 and 8 plus CDDP 100 mg/m2 on day 1 every 3 weeks. mRNA was isolated from paraffin-embedded pretreatment primary tumor specimens, and relative expression levels of ERCC1/ß-actin were measured using a quantitative reverse transcription-PCR (Taqman) system.

Results: ERCC1 expression was detectable in all tumors. There were no significant differences in ERCC1 levels by gender, age, performance status, weight loss, or tumor stage. The overall response rate was 44.7%. There were no significant associations between ERCC1 expression and response. Median overall survival was significantly longer in patients with low ERCC1 expression tumors (61.6 weeks; 95% confidence interval, 42.4–80.7 weeks) compared to patients with high expression tumors (20.4 weeks, 95% confidence interval, 6.9–33.9 weeks). ERCC1 expression, Eastern Cooperative Oncology Group performance status, and presence of weight loss were significant prognostic factors for survival in a Cox proportional hazards multivariable analysis.

Conclusions: These data suggest that ERCC1 expression is a predictive factor for survival after CDDP/Gem therapy in advanced NSCLC. Although there was a trend toward decreased response with high ERCC1 mRNA levels, this difference failed to reach statistical significance. This result may reflect the impact of Gem and the requirement for ERCC1 expression for CDDP/Gem synergism or may be attributable to the relatively small patient sample size in this study. Prospective studies of ERCC1 as a predictive marker for activity of CDDP-based regimens in NSCLC are warranted.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Lung cancer is the leading cause of cancer death in both men and women in many countries, including Spain and the United States. More than 75% of lung cancers are NSCLC.4 Except for some patients with surgically resectable disease, the prognosis for patients with NSCLC is poor. Platinum-based chemotherapy has been shown to provide survival and quality of life benefits for patients with advanced stage, unresectable NSCLC, but overall 2-year survival rates for this group remain <15% (1 , 2) .

Pharmacogenetics, the study of genes that influence drug activity and toxicity, offers the possibility of tailoring therapy to the specific genetic profile of individual patients and tumors. A pharmacogenetic approach can thus potentially increase response rates and survival outcomes while decreasing toxicity and overall treatment costs. The cytotoxic effect of the anticancer drug CDDP is principally attributable to the formation of bulky intrastrand platinum-DNA adducts. Removal of these adducts from genomic DNA is mediated by the nucleotide excision repair pathway, (3 , 4) , a critical element of which for this function is the ERCC1 gene (3 , 5 , 6) . DNA repair can be attenuated by blocking the interaction between ERCC1 protein and the XPA (7) , and high ERCC1 expression is associated with resistance to platinum-containing therapy in human ovarian and gastric tumor specimens (8 , 9) . Cytotoxic synergism has been demonstrated between Gem and CDDP, (10, 11, 12, 13) , and a higher response rate was found for the combination of Gem plus CDDP compared with a standard CDDP plus etoposide regimen in patients with advanced NSCLC (14) . Importantly, this Gem/CDDP synergism has been shown to involve ERCC1 and the nucleotide excision repair pathway; expression of ERCC1 antisense RNA abrogates gemcitabine-mediated cytotoxic synergism with CDDP in vitro in human colon cancer cells defective in mismatch repair but proficient in nucleotide excision repair (15) . In this study, we investigated whether these in vitro findings apply in vivo by measuring ERCC1 mRNA levels in primary NSCLC tissues and correlating these with the clinical outcomes for patients treated as part of a prospective randomized trial with a combined Gem/CDDP regimen.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Patients and Samples.
Clinical data were retrieved from the medical and trial database records of patients with advanced NSCLC who were treated with a standardized Gem/CDDP regimen at various hospitals of the SLCG. All patients were enrolled in the Gem/CDDP arm of a prospective multicenter three-arm randomized trial (GECP/98-02), the SLCG Phase III trial of Gem/CDDP versus Gem/CDDP/vinorelbine versus sequential doublets of Gem/vinorelbine followed by ifosfamide/vinorelbine in advanced NSCLC (16) . The patients were treated between October 1998 and September 2000. All patients received Gem 1250 mg/m2 on days 1 and 8 plus CDDP 100 mg/m2 on day 1 every 3 weeks. Eligibility criteria for GECP/98-02 were measurable stage IV (with brain metastases eligible if asymptomatic) or stage IIIB (malignant pleural and/or pericardial effusion and/or supraclavicular adenopathy) NSCLC and ECOG performance score 0–2.

All patients had chest X-ray and a computed tomography scan of the chest and upper abdomen before entry into the study and underwent repeat evaluations at least every 6 weeks. Tumor response was assessed according to WHO criteria as complete response, partial response, stable disease, and progressive disease. Tumors were reassessed during treatment with the same imaging methods used to establish the baseline tumor measurement. All patients gave signed informed consent, and the study was approved by the institutional ethics review boards. Archival primary tumor specimens from each patient were retrieved from the participating SLCG centers after review of the H&E-stained slides.

RNA Isolation and cDNA Synthesis.
RNA isolation from paraffin-embedded specimens was done according to a proprietary procedure (US patent number 6,248,535). After RNA isolation, cDNA was prepared from each sample as described previously (17) .

Reverse Transcription-PCR Quantification of mRNA Expression.
Relative cDNA quantitation for ERCC1 and an internal reference gene (ß-actin) was done using a fluorescence-based, real-time detection method (ABI PRISM 7700 Sequence Detection System; TaqMan; Applied Biosystems, Foster City, CA), as described previously (17, 18, 19) .

The primers and probe sequences used are given below. In each case, the first primer is the forward PCR primer, the second is the reverse PCR primer, and the third is the Taqman probe: ERCC1, GGGAATTTGGCGACGTAATTC, GCGGAGGCTGAGGAACAG, and 6FAM (carboxyfluorescein) 5'-CACAGGTGCTCTGGCCCAGCACATA-3'TAMRA (N,N,N',N'-tetramethyl-6-carboxyrhodamine); ß-actin, TGAGCGCGGCTACAGCTT, TCCTTAATGTCACGCACGATTT, and 6FAM5'-ACCACCACGGCCGAGCGG-3'TAMRA.

The PCR reaction mixture consisted of 600 nM of each primer, 200 nM probe, 2.5 units of AmpliTaq Gold polymerase, 200 µM each dATP, dCTP, dGTP, 400 µM dUTP, 5.5 mM MgCl2, and 1x Taqman Buffer A containing a reference dye, to a final volume of 25 µl (all reagents were from Applied Biosystems, Foster City, CA). Cycling conditions were 50°C for 10 s, 95°C for 10 min, followed by 46 cycles at 95°C for 15 s and 60°C for 1 min. Colon, liver, and lung RNAs (all from Stratagene, La Jolla, CA) were used as control calibrators on each plate. All gene expression analyses were performed in a blinded fashion with the laboratory investigators unaware of the clinical data.

Statistical Analysis.
TaqMan analyses yield values that are expressed as ratios between two absolute measurements (gene of interest/internal reference gene). The Mann-Whitney t test was used to test for significant associations between the continuous test variable ERCC1 expression and dichotomous variables (patient sex, age above and below the median age, presence of weight loss, presence of pleural effusion, and tumor stage). The Kruskal-Wallis test was used to test for significant differences in ERCC1 expressions within multiple groups (ECOG performance status and histology). Fisher’s exact test was used for the analysis of categorical clinicopathological values including response and dichotomized ERCC1 values.

All patients were followed from first study treatment until death or until the data were censored, with the patient considered to be alive as of April 2001. Kaplan-Meier survival curves and the log-rank test were used to analyze univariate distributions for survival and disease-free survival. The maximal {chi}2 method of Miller and Siegmund (20) and Halpern (21) was adapted to determine which expression value best segregated patients into poor and good prognosis subgroups (in terms of likelihood of surviving), with the log-rank test as the statistic used to measure the strength of the grouping. To determine a P that would be interpreted as a measure of the strength of the association based on the maximal {chi}2 analysis, 1000 boot-strap-like simulations were used to estimate the distribution of the maximal {chi}2 statistics under the hypothesis of no association (21) . Cox’s proportional hazards modeling of factors that were significant in univariate analysis was performed to identify which factors might have a significant influence on survival. SPSS version 10.0.5 software (SPSS, Inc., Chicago, IL) was used for all statistical analyses. All Ps were two-sided.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Patient and Tumor Characteristics.
Demographic details on the 56 patients included in the study and tumor stage and cell type details are shown in Table 1Citation . The median number of treatment cycles received was three (range, one to six). Three of the 56 patients had received radiotherapy, and 5 patients had undergone surgical resection of the primary tumor.


View this table:
[in this window]
[in a new window]

 
Table 1 Patient characteristics

 
ERCC1 Expression Levels.
ERCC1 mRNA expression was detectable in all 56 samples analyzed. The median ERCC1 expression, relative to the expression of the internal control housekeeping gene ß-actin, was 6.7 x 10-3 (range, 0.8 x 10-3 to 24.6 x 10-3; values shown hereafter without x 10-3, e.g., median, 6.7). Twenty-eight (50%) patients had an ERCC1 level greater than the median, and 50% had a level <6.7. There were no significant associations between ERCC1 levels and any of the factors age (P = 0.66), sex (P = 0.18), presence of weight loss in the 6 months before randomization (P = 0.74), tumor stage (IIIB versus IV; P = 0.39), or presence of pleural effusion (P = 0.25, all Mann-Whitney t test). There were also no significant differences between the ERCC1 levels among patients with different performance status grades (P = 0.48, Kruskal-Wallis test) or different tumor cell types (all four tumor types, P = 0.10, Kruskal-Wallis test), but ERCC1 expression levels were significantly higher in squamous cell carcinomas (median, 8.6) compared with adenocarcinomas (median, 5.2; P = 0.015, Mann-Whitney test).

Response to Chemotherapy.
The tumor response frequencies for the 47 patients who were evaluable for response are shown in Table 1Citation . The overall response rate was 44.7%. The ERCC1 expression levels in the complete response and partial response, i.e., "responding" tumors (median, 4.3; range, 1.2–24.6) were not significantly different from the levels in the stable disease and progressive disease, i.e., "non-responding" tumors (median, 7.85; range, 0.8–24.3; P = 0.31, Mann-Whitney test). There were also no significant differences between the proportion of responding and nonresponding tumors with ERCC1 values greater and less than any ERCC1 level (all Fisher’s exact test). The response rate in tumors with ERCC1 expression below the median value ("low" expression, 52% responders) was higher than for tumors with ERCC1 expression above the median value ("high" expression, 36.4% responders; Fisher’s exact test, P = 0.38).

Association between Patient Overall Survival and ERCC1 Levels.
The median overall survival time was 36.6 weeks (range, 0–113.4 weeks), and the median time to progression was 24.4 weeks (range, 0–102.9 weeks). Use of the log-rank test and the maximal {chi}2 statistic to identify ERCC1 levels that segregated patients into poor and good prognosis subgroups showed that the range of discriminatory values included the median value, which was therefore used as the cutoff value for the survival analysis. Fig. 1Citation shows the Kaplan-Meier survival curve for patients with intratumoral ERCC1 levels above and below the median ERCC1 level. As shown in Table 2Citation , patients with ERCC1 levels below the median had a significantly longer median survival of 61.6 weeks (95% CI, 42.4–80.7 weeks) compared with 20.4 weeks (95% CI, 6.9–33.9 weeks) for patients with ERCC1 levels above the median. Adjusted for tumor stage, the log-rank statistic for the association between low or high ERCC1 expression and overall survival was 3.97, and the P was 0.046. The unadjusted log-rank results are shown in Table 2Citation .



View larger version (14K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Kaplan-Meier survival curve for patients with intratumoral ERCC1 levels above and below the median ERCC1 level.

 

View this table:
[in this window]
[in a new window]

 
Table 2 Factors associated with overall survival

 
An ERCC1 cutoff value of 5.8 was tested because this value was shown in a previous study to be associated with overall survival for patients with gastric cancer (9) . Overall survival was significantly better for the group of NSCLC patients in this study with ERCC1 levels <5.8 (median, 74.71 weeks; 95% CI, 71.77–77.66 weeks) compared with those with ERCC1 levels <5.8 (median, 61.0 weeks; 95% CI, 45.61–76.39 weeks; unadjusted log-rank statistic, 6.37; P = 0.011).

Other factors that were significantly associated with overall survival on univariable analysis using Kaplan Meier survival curves and the log-rank test were the presence of pretreatment weight loss and the ECOG performance status (Table 2)Citation . Patient age (P = 0.18), sex (P = 0.87), tumor stage (P = 0.99), tumor cell type (SCC versus adenocarcinoma P = 0.63), and presence of pleural effusion (P = 0.71) were not significant prognostic factors for overall survival. ERCC1 level, ECOG performance status, and weight loss remained significant prognostic factors for survival in the Cox proportional hazards regression model multivariable analysis (Table 2)Citation . Ps for a Cox regression model stratified on tumor stage were 0.038 for ERCC1, 0.017 for weight loss and 0.02 for ECOG performance status (performance status 0 versus 1 or 2).


    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
This study found an association between lower ERCC1 mRNA expression levels and improved survival after treatment with a combination Gem/CDDP regimen for patients with advanced stage NSCLC. Experimental studies have shown that high ERCC1 levels are associated with increased removal of CDDP-induced DNA adducts and relative CDDP resistance (5) , and ERCC1-defective cells or knockout mice are highly sensitive to DNA cross-linking agents (22 , 23) . Lee et al. (24) showed that transfecting ERCC1 into a UV repair-deficient [ERCC1(-)] Chinese hamster ovary cell line conferred DNA adduct repair capability and CDDP resistance. These findings suggest that the likely explanation for our results is that intratumoral ERCC1 levels are associated with the effectiveness of CDDP therapy because ERCC1 expression influences ERCC1-mediated DNA adduct repair activity (25) .

Confidence in our results is derived from the fact that, although the genetic analysis was performed retrospectively after the trial was closed, the clinical data were collected prospectively under the conditions of a multicenter randomized trial, and the laboratory work was performed in a blinded fashion. Furthermore, other studies have also found an association between lower intratumoral ERCC1 expressions and improved clinical outcomes for patients treated with platinum-containing regimens. Metzger et al. (9) found a significant association between ERCC1 levels and survival after CDDP/5-fluorouracil therapy for patients with gastric cancer. Metzger et al. (9) used a cutoff ERCC1 mRNA expression value of 5.8, which also divided patients in a statistically significant way into good and poor survival arms in our study, although a higher ERCC1 level was a more powerful discriminator. Dabholkar et al. (26) reported that patients with ovarian cancer who were clinically resistant to platinum-based therapy had a statistically significant 2.6-fold higher expression level of ERCC1 in their tumor tissue than patients who responded to that therapy. A further study showed that both ERCC1 and XPAC (the human excision repair gene that corrects the defect in xeroderma pigmentosum group A cells) were important for response to platinum-based chemotherapy in ovarian cancer tissues (8) . Other studies have also reported associations between higher ERCC1 expressions and worse clinical outcomes for CDDP-based therapy for esophageal cancer (27 , 28) and for oxaliplatin/5-fluorouracil treatment for colorectal cancer (29) .

In addition to associations with survival outcomes, several of these studies found associations between ERCC1 expression and chemoresponse (8 , 9 , 26 , 28 , 29) . These studies included patients treated with CDDP but not with Gem. A significant association with response was not found in our study, but this finding was not unexpected because of the requirement for ERCC1 for CDDP/Gem synergism (15) . Despite this requirement, ERCC1 levels remain important, as indicated by the association with survival and the trend toward a lower response rate in patients with high ERCC1 mRNA tumor levels. It is also noteworthy that the 52% response rate in the low ERCC1 group is considerably higher than the 21–40.6% response rates reported in other CDDP/Gem NSCLC randomized trials (14 , 30, 31, 32) .

Cisplatin- or carboplatin-containing regimens have been considered a standard of care in the therapy of advanced stage NSCLCs for >15 years (1) . Recently, randomized studies have sought to determine whether nonplatinum combinations of newer agents were either more efficacious or less toxic. Results have been inconclusive, suggesting that a therapeutic plateau for currently available chemotherapy has been reached (33, 34, 35, 36, 37, 38) . Instead, novel therapeutic approaches will likely be required to optimize chemotherapy effectiveness in individual patients, and the use of potential molecular predictors of response and survival in individual NSCLC patients may well become important criteria for chemotherapy selection (39 , 40) . Recent studies of NSCLC cells or tissues have identified several potentially valuable chemosensitivity markers in addition to ERCC1 (8 , 39 , 41, 42, 43) , but validation of these markers is still required. Another potential clinical consequence of our findings is that, as suggested by Li et al. (5) , pharmacological approaches that inhibit ERCC1 expression may increase cellular sensitivity to CDDP. UCN-01 (7-hydroxylstaurosporine) is a cell cycle checkpoint abrogator that has been shown to inhibit nucleotide excision repair, attenuate the interaction of ERCC1 with XPA (7) , and potentiate CDDP cytotoxicity (44) . In the present study, the multivariate analyses confirmed the strength of the ERCC1 mRNA levels, which was even more significant than that of performance status. Further validation of these findings could lead to a dramatic change in clinical practice, avoiding unnecessary CDDP chemotherapy in almost half of NSCLC patients. The Preliminary Genotypic International Lung Trial, a prospective randomized trial testing the importance of ERCC1 expression and other factors for CDDP effectiveness in NSCLC patients, is under way.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Funded in part by NIH/National Cancer Institute Grant CA 63265 (to D. G.), Grant CA 71716 (to P. V. D.), and Grants CM 17101 and CA 62505 to University of California, Davis Cancer Center (to D. G. and P. H. G.), and a grant from the University of Southern California (to K. D. D. and P. V. D.). Back

2 Both authors contributed equally to this work. Back

3 To whom requests for reprints should be addressed, at Hospital Germans Trias i Pujol, Medical Oncology Service, Ctra de Canyet, s/n 08916 Badalona, Barcelona, Spain. Phone: 3493-497-8925; Fax: 3493-497-8950; E-mail: rrosell{at}ns.hugtip.scs.es Back

4 The abbreviations used are: NSCLC, non-small cell lung cancer; CDDP, cisplatin, cis-diamminedichloroplatinum; Gem, Gemcitabine, 2',2'-difluorodeoxycytidine; ERCC1, excision repair cross-complementing gene 1; XPA, xeroderma pigmentosum group A protein; ECOG, Eastern Cooperative Oncology Group; SLCG, Spanish Lung Cancer Group; CI, confidence interval. Back

Received 12/11/01; revised 4/15/02; accepted 4/15/02.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Bunn P. A., Jr., Kelly K. New chemotherapeutic agents prolong survival and improve quality of life in non-small cell lung cancer: a review of the literature and future directions. Clin. Cancer Res., 4: 1087-1100, 1998.[Abstract]
  2. Non-small Cell Lung Cancer Collaborative Group. Chemotherapy in non-small cell lung cancer: a meta-analysis using updated data on individual patients from 52 randomised clinical trials. Br. Med. J., 311: 899-909, 1995.[Abstract/Free Full Text]
  3. Reed E. Platinum-DNA adduct, nucleotide excision repair and platinum based anti-cancer chemotherapy. Cancer Treat. Rev., 24: 331-344, 1998.[CrossRef][Medline]
  4. Reardon J. T., Vaisman A., Chaney S. G., Sancar A. Efficient nucleotide excision repair of cisplatin, oxaliplatin, and bis-acetoammine-dichloro-cyclohexylamine-platinum(IV) (JM216) platinum intrastrand DNA diadducts. Cancer Res., 59: 3968-3971, 1999.[Abstract/Free Full Text]
  5. Li Q., Yu J. J., Mu C., Yunmbam M. K., Slavsky D., Cross C. L., Bostick-Bruton F., Reed E. Association between the level of ERCC-1 expression and the repair of cisplatin-induced DNA damage in human ovarian cancer cells. Anticancer Res., 20: 645-652, 2000.[Medline]
  6. Yu J. J., Lee K. B., Mu C., Li Q., Abernathy T. V., Bostick-Bruton F., Reed E. Comparison of two human ovarian carcinoma cell lines (A2780/CP70 and MCAS) that are equally resistant to platinum, but differ at codon 118 of the ERCC1 gene. Int. J. Oncol., 16: 555-560, 2000.[Medline]
  7. Jiang H., Yang L. Y. Cell cycle checkpoint abrogator UCN-01 inhibits DNA repair: association with attenuation of the interaction of XPA and ERCC1 nucleotide excision repair proteins. Cancer Res., 59: 4529-4534, 1999.[Abstract/Free Full Text]
  8. Dabholkar M., Vionnet J., Bostick-Bruton F., Yu J. J., Reed E. Messenger RNA levels of XPAC and ERCC1 in ovarian cancer tissue correlate with response to platinum-based chemotherapy. J. Clin. Investig., 94: 703-708, 1994.
  9. Metzger R., Leichman C. G., Danenberg K. D., Danenberg P. V., Lenz H. J., Hayashi K., Groshen S., Salonga D., Cohen H., Laine L., Crookes P., Silberman H., Baranda J., Konda B., Leichman L. ERCC1 mRNA levels complement thymidylate synthase mRNA levels in predicting response and survival for gastric cancer patients receiving combination cisplatin and fluorouracil chemotherapy. J. Clin. Oncol., 16: 309-316, 1998.[Abstract/Free Full Text]
  10. van Moorsel C. J., Pinedo H. M., Veerman G., Bergman A. M., Kuiper C. M., Vermorken J. B., van der Vijgh W. J., Peters G. J. Mechanisms of synergism between cisplatin and gemcitabine in ovarian and non-small-cell lung cancer cell lines. Br. J. Cancer, 80: 981-990, 1999.[CrossRef][Medline]
  11. Bergman A. M., Ruiz V. H. V., Veerman G., Kuiper C. M., Peters G. J. Synergistic interaction between cisplatin and gemcitabine in vitro. Clin. Cancer Res., 2: 521-530, 1996.[Abstract]
  12. Rosell R., Tonato M., Sandler A. The activity of gemcitabine plus cisplatin in randomized trials in untreated patients with advanced non-small cell lung cancer. Semin. Oncol., 25: 27-34, 1998.[Medline]
  13. Edelman M. J., Quam H., Mullins B. Interactions of gemcitabine, carboplatin and paclitaxel in molecularly defined non-small-cell lung cancer cell lines. Cancer Chemother. Pharmacol., 48: 141-144, 2001.[CrossRef][Medline]
  14. Cardenal F., Lopez-Cabrerizo M. P., Anton A., Alberola V., Massuti B., Carrato A., Barneto I., Lomas M., Garcia M., Lianes P., Montalar J., Vadell C., Gonzalez-Larriba J. L., Nguyen B., Artal A., Rosell R. Randomized Phase III study of gemcitabine-cisplatin versus etoposide-cisplatin in the treatment of locally advanced or metastatic non-small-cell lung cancer. J. Clin. Oncol., 17: 12-18, 1999.[Abstract/Free Full Text]
  15. Yang L. Y., Li L., Jiang H., Shen Y., Plunkett W. Expression of ERCC1 antisense RNA abrogates Gemicitabine-mediated cytotoxic synergism with cisplatin in human colon tumor cells defective in mismatch repair but proficient in nucleotide excision repair. Clin. Cancer Res., 6: 773-781, 2000.[Abstract/Free Full Text]
  16. Alberola V., Camps C., Provencia M., Rosell R., Vadell C., Bover I., Rui Zcasado A., Azagra P., Jiménez U., González-Larriba J., Cardenal F. A. A., Carrato A., Morales S., Sánchez J. Cisplatin/Gemcitabine (CG) versus cisplatin/Gemcitabine/vinorelbine (CGV) versus sequential doublets of Gemcitabine/vinorelbine followed by ifosfamide/vinorelbine (GV/IV) in advanced NSCLC: results of a Spanish Lung Cancer Group Phase III trial (GEPC/98-02). Proc. Am. Soc. Clin. Oncol., 20: 308a 2001.
  17. Lord R. V., Salonga D., Danenberg K. D., Peters J. H., DeMeester T. R., Park J. M., Johansson J., Skinner K. A., Chandrasoma P., DeMeester S. R., Bremner C. G., Tsai P. I., Danenberg P. V. Telomerase reverse transcriptase expression is increased early in the Barrett’s metaplasia, dysplasia, adenocarcinoma sequence. J. Gastrointest. Surg., 4: 135-142, 2000.[CrossRef][Medline]
  18. Gibson U. E., Heid C. A., Williams P. M. A novel method for real time quantitative RT-PCR. Genome Res., 6: 995-1001, 1996.[Abstract/Free Full Text]
  19. Heid C. A., Stevens J., Livak K. J., Williams P. M. Real time quantitative PCR. Genome Res., 6: 986-994, 1996.[Abstract/Free Full Text]
  20. Miller R., Siegmund D. Maximally selected {chi}2 statistics. Biometrics, 38: 1011-1016, 1982.[CrossRef]
  21. Halpern J. Maximally selected {chi}2 statistics for small samples. Biometrics, 38: 1017-1023, 1982.[CrossRef]
  22. Westerveld A., Hoeijmakers J. H., van Duin M., de Wit J., Odijk H., Pastink A., Wood R. D., Bootsma D. Molecular cloning of a human DNA repair gene. Nature (Lond.), 310: 425-429, 1984.[CrossRef][Medline]
  23. Melton D. W., Ketchen A. M., Nunez F., Bonatti-Abbondandolo S., Abbondandolo A., Squires S., Johnson R. T. Cells from ERCC1-deficient mice show increased genome instability and a reduced frequency of S-phase-dependent illegitimate chromosome exchange but a normal frequency of homologous recombination. J. Cell Sci., 111: 395-404, 1998.[Abstract]
  24. Lee K. B., Parker R. J., Bohr V., Cornelison T., Reed E. Cisplatin sensitivity/resistance in UV repair-deficient Chinese hamster ovary cells of complementation groups 1 and 3. Carcinogenesis (Lond.), 14: 2177-2180, 1993.[Abstract/Free Full Text]
  25. Chaney S. G., Sancar A. DNA repair: enzymatic mechanisms and relevance to drug response. J. Natl. Cancer Inst., 88: 1346-1360, 1996.[Abstract/Free Full Text]
  26. Dabholkar M., Bostick-Bruton F., Weber C., Bohr V. A., Egwuagu C., Reed E. ERCC1 and ERCC2 expression in malignant tissues from ovarian cancer patients. J. Natl. Cancer Inst., 84: 1512-1517, 1992.[Abstract/Free Full Text]
  27. Moore-Joshi M. H., Danenberg K. D., Lord R. V., Johansson J., Uetake H., Danenberg P. V., Harpole D. H., Jr. Low thymidylate synthase and ERCC1 gene expressions are associated with increased survival after neoadjuvant 5-FU/cisplatin/radiotherapy for esophageal adenocarcinoma. Proc. Am. Soc. Clin. Oncol., 19: 244A 2000.
  28. Metzger R., Schneider P. M., Baldus S. E., et al Quantitative ERCC1 RNA expression identifies non-response to cis-platinum based neoadjuvant radiochemotherapy for esophageal cancer. Proc. Am. Soc. Clin. Oncol., 20: 130a 2001.
  29. Shirota Y., Stoehlmacher J., Brabender J., Xiong Y., Uetake H., Danenberg K. D., Groshen S., Tsao-Wei D. D., Danenberg P. V., Lenz H. ERCC1 and thymidylate synthase mRNA levels predict survival for colorectal cancer patients receiving combination oxaliplatin and fluorouracil chemotherapy. J. Clin. Oncol., 19: 4298-4304, 2001.[Abstract/Free Full Text]
  30. Sandler A. B., Nemunaitis J., Denham C., von Pawel J., Cormier Y., Gatzemeier U., Mattson K., Manegold C., Palmer M. C., Gregor A., Nguyen B., Niyikiza C., Einhorn L. H. Phase III trial of gemcitabine plus cisplatin versus cisplatin alone in patients with locally advanced or metastatic non-small-cell lung cancer. J. Clin. Oncol., 18: 122-130, 2000.[Abstract/Free Full Text]
  31. Crino L., Scagliotti G. V., Ricci S., De Marinis F., Rinaldi M., Gridelli C., Ceribelli A., Bianco R., Marangolo M., Di Costanzo F., Sassi M., Barni S., Ravaioli A., Adamo V., Portalone L., Cruciani G., Masotti A., Ferrara G., Gozzelino F., Tonato M. Gemcitabine and cisplatin versus mitomycin, ifosfamide, and cisplatin in advanced non-small-cell lung cancer: a randomized Phase III study of the Italian Lung Cancer Project. J. Clin. Oncol., 17: 3522-3530, 1999.[Abstract/Free Full Text]
  32. Schiller J. H., Harrington D., Belani C., Langer C., Sandler A., Krook J., Zhu J., Johnson D. H. Comparison of four chemotherapy regimens for advanced non-small-cell lung cancer. N. Engl. J. Med., 346: 92-98, 2002.[Abstract/Free Full Text]
  33. Georgoulias V., Papadakis E., Alexopoulos A., Tsiafaki X., Rapti A., Veslemes M., Palamidas P., Vlachonikolis I., the Greek Oncology Cooperative Group G. Platinum-based and non-platinum-based chemotherapy in advanced non-small-cell lung cancer: a randomised multicentre trial. Lancet, 357: 1478-1484, 2001.[CrossRef][Medline]
  34. Gridelli C., Perrone F., Palmeri S., D’Aprile M., Cognetti F., Rossi A., Gebbia V., Pepe R., Veltri E., Airoma G., Russo A., Incoronato P., Scinto A. F., Palazzolo G., Natali M., Leonardi V., Gallo C., De Placido S., Bianco A. R. Mitomycin C plus vindesine plus etoposide (MEV) versus mitomycin C plus vindesine plus cisplatin (MVP) in stage IV non-small-cell lung cancer: a Phase III multicentre randomised trial. The "Gruppo Oncologico Centro-Sud-Isole" (G. O. C. S. I.). Ann. Oncol., 7: 821-826, 1996.[Abstract/Free Full Text]
  35. Gatzemeier U., Heckmayr M., Hossfeld D. K., Kaukel E., Koschel G., Neuhauss R. A randomized trial with mitomycin-C/ifosfamide versus mitomycin-C/vindesine versus cisplatin/etoposide in advanced non-small-cell lung cancer. Am. J. Clin. Oncol., 14: 405-411, 1991.[Medline]
  36. Kosmidis P. A., Bacoyiannis C., Mylonakis N., et al A randomized Phase III trial of paclitaxel plus carboplatin versus paclitaxel plus gemcitabine in advanced non small cell lung cancer (NSCLC). A preliminary analysis. Proc. Am. Soc. Clin. Oncol., 19: 488 2000.
  37. Yamamoto N., Fukuoka M., Nakagawa K., et al Randomized Phase II study of docetaxel (DOC) plus cisplatin (CDDP) versus DOC plus irinotecan in advanced non-small cell lung cancer (NSCLC): A West Japan Thoracic Oncology Group (WJTOG) study. Ann. Oncol., 11 (Suppl. 4): S107 2000.
  38. Van Meerbeeck J. P., Smit E. F., Lianes P., Schramel F., Lenz M., Debruyne C., Giaccone G. A EORTC randomized Phase III trial of three chemotherapy regimens in advanced non-small-cell lung cancer (NSCLC). Proc. Am. Soc. Clin. Oncol., 20: 308a 2001.
  39. Rosell R., Taron M., O’Brate A. Predictive molecular markers in non-small cell lung cancer. Curr. Opin. Oncol., 13: 101-109, 2001.[CrossRef][Medline]
  40. Rosell R., Green M., Gumerlock P. Advances in the treatment of non-small cell lung cancer: molecular markers take the stage. Semin. Oncol., 28: 28-34, 2001.
  41. Young L. C., Campling B. G., Cole S. P., Deeley R. G., Gerlach J. H. Multidrug resistance proteins MRP3. MRP1, and MRP2 in lung cancer: correlation of protein levels with drug response and messenger RNA levels. Clin. Cancer Res., 7: 1798-1804, 2001.[Abstract/Free Full Text]
  42. Mack P. C., Gandara D. R., Bowen C., Edelman M. J., Paglieroni T., Schnier J. B., Gelmann E. P., Gumerlock P. H. RB status as a determinant of response to UCN-01 in non-small cell lung carcinoma. Clin. Cancer Res., 5: 2596-2604, 1999.[Abstract/Free Full Text]
  43. Monzo M., Rosell R., Sanchez J. J., Lee J. S., O’Brate A., Gonzalez-Larriba J. L., Alberola V., Lorenzo J. C., Nunez L., Ro J. Y., Martin C. Paclitaxel resistance in non-small-cell lung cancer associated with ß-tubulin gene mutations. J. Clin. Oncol., 17: 1786-1793, 1999.[Abstract/Free Full Text]
  44. Pollack I. F., Kawecki S., Lazo J. S. Blocking of glioma proliferation in vitro and in vivo and potentiating the effects of BCNU and cisplatin: UCN-01, a selective protein kinase C inhibitor. J. Neurosurg., 84: 1024-1032, 1996.[Medline]



This article has been cited by other articles:


Home page
INT J SURG PATHOLHome page
G. Rossi, G. Pelosi, P. Graziano, M. Barbareschi, and M. Papotti
Review Article: A Reevaluation of the Clinical Significance of Histological Subtyping of Non--Small-Cell Lung Carcinoma: Diagnostic Algorithms in the Era of Personalized Treatments
International Journal of Surgical Pathology, June 1, 2009; 17(3): 206 - 218.
[Abstract] [PDF]


Home page
J. Thorac. Cardiovasc. Surg.Home page
L. J. Inge, K. D. Coon, M. A. Smith, and R. M. Bremner
Expression of LKB1 tumor suppressor in non-small cell lung cancer determines sensitivity to 2-deoxyglucose.
J. Thorac. Cardiovasc. Surg., March 1, 2009; 137(3): 580 - 586.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
H.-T. Kim, J.-E. Lee, E.-S. Shin, Y.-K. Yoo, J.-H. Cho, M.-H. Yun, Y.-H. Kim, S.-K. Kim, H.-J. Kim, T.-W. Jang, et al.
Effect of BRCA1 Haplotype on Survival of Non-Small-Cell Lung Cancer Patients Treated With Platinum-Based Chemotherapy
J. Clin. Oncol., December 20, 2008; 26(36): 5972 - 5979.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
B. Besse and T. Le Chevalier
Adjuvant Chemotherapy for Non-Small-Cell Lung Cancer: A Fading Effect?
J. Clin. Oncol., November 1, 2008; 26(31): 5014 - 5017.
[Full Text] [PDF]


Home page
JCOHome page
T. C. Krivak, K. M. Darcy, C. Tian, D. Armstrong, B. E. Baysal, H. Gallion, C. B. Ambrosone, and J. A. DeLoia
Relationship Between ERCC1 Polymorphisms, Disease Progression, and Survival in the Gynecologic Oncology Group Phase III Trial of Intraperitoneal Versus Intravenous Cisplatin and Paclitaxel for Stage III Epithelial Ovarian Cancer
J. Clin. Oncol., July 20, 2008; 26(21): 3598 - 3606.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. K. Kim, K.-J. Cho, G. Y. Kwon, S.-I. Park, Y. H. Kim, J. H. Kim, H.-Y. Song, J. H. Shin, H. Y. Jung, G. H. Lee, et al.
Patients with ERCC1-Negative Locally Advanced Esophageal Cancers May Benefit from Preoperative Chemoradiotherapy
Clin. Cancer Res., July 1, 2008; 14(13): 4225 - 4231.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
D. Yu, X. Zhang, J. Liu, P. Yuan, W. Tan, Y. Guo, T. Sun, D. Zhao, M. Yang, J. Liu, et al.
Characterization of Functional Excision Repair Cross-Complementation Group 1 Variants and Their Association with Lung Cancer Risk and Prognosis
Clin. Cancer Res., May 1, 2008; 14(9): 2878 - 2886.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
L. P. Martin, T. C. Hamilton, and R. J. Schilder
Platinum Resistance: The Role of DNA Repair Pathways
Clin. Cancer Res., March 1, 2008; 14(5): 1291 - 1295.
[Abstract] [Full Text] [PDF]


Home page
Am Soc Clin Oncol Ed BookHome page
G. Bepler
Genes Predictive of Chemotherapeutic Efficacy in Non-small Cell Lung Cancer
ASCO Educational Book, January 1, 2008; 2008(1): 350 - 352.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
S. Smith, D. Su, I. A. Rigault de la Longrais, P. Schwartz, M. Puopolo, T. J. Rutherford, G. Mor, H. Yu, and D. Katsaros
ERCC1 Genotype and Phenotype in Epithelial Ovarian Cancer Identify Patients Likely to Benefit From Paclitaxel Treatment in Addition to Platinum-Based Therapy
J. Clin. Oncol., November 20, 2007; 25(33): 5172 - 5179.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
J.-C. Soria
ERCC1-Tailored Chemotherapy in Lung Cancer: The First Prospective Randomized Trial
J. Clin. Oncol., July 1, 2007; 25(19): 2648 - 2649.
[Full Text] [PDF]


Home page
JCOHome page
G. Simon, A. Sharma, X. Li, T. Hazelton, F. Walsh, C. Williams, A. Chiappori, E. Haura, T. Tanvetyanon, S. Antonia, et al.
Feasibility and Efficacy of Molecular Analysis-Directed Individualized Therapy in Advanced Non-Small-Cell Lung Cancer
J. Clin. Oncol., July 1, 2007; 25(19): 2741 - 2746.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
M. Cobo, D. Isla, B. Massuti, A. Montes, J. M. Sanchez, M. Provencio, N. Vinolas, L. Paz-Ares, G. Lopez-Vivanco, M. A. Munoz, et al.
Customizing Cisplatin Based on Quantitative Excision Repair Cross-Complementing 1 mRNA Expression: A Phase III Trial in Non-Small-Cell Lung Cancer
J. Clin. Oncol., July 1, 2007; 25(19): 2747 - 2754.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A. Handra-Luca, J. Hernandez, G. Mountzios, E. Taranchon, J. Lacau-St-Guily, J.-C. Soria, and P. Fouret
Excision Repair Cross Complementation Group 1 Immunohistochemical Expression Predicts Objective Response and Cancer-Specific Survival in Patients Treated by Cisplatin-Based Induction Chemotherapy for Locally Advanced Head and Neck Squamous Cell Carcinoma
Clin. Cancer Res., July 1, 2007; 13(13): 3855 - 3859.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
D. F. Giachino, P. Ghio, S. Regazzoni, G. Mandrile, S. Novello, G. Selvaggi, D. Gregori, M. DeMarchi, and G. V. Scagliotti
Prospective Assessment of XPD Lys751Gln and XRCC1 Arg399Gln Single Nucleotide Polymorphisms in Lung Cancer
Clin. Cancer Res., May 15, 2007; 13(10): 2876 - 2881.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. M. Darcy, C. Tian, and E. Reed
A Gynecologic Oncology Group Study of Platinum-DNA Adducts and Excision Repair Cross-Complementation Group 1 Expression in Optimal, Stage III Epithelial Ovarian Cancer Treated with Platinum-Taxane Chemotherapy
Cancer Res., May 1, 2007; 67(9): 4474 - 4481.
[Abstract] [Full Text] [PDF]


Home page
Ann OncolHome page
H-C Kwon, M. Roh, S. Oh, S-H Kim, M. Kim, J-S Kim, and H-J Kim
Prognostic value of expression of ERCC1, thymidylate synthase, and glutathione S-transferase P1 for 5-fluorouracil/oxaliplatin chemotherapy in advanced gastric cancer
Ann. Onc., March 1, 2007; 18(3): 504 - 509.
[Abstract] [Full Text] [PDF]


Home page
Ann OncolHome page
J Bellmunt, L Paz-Ares, M Cuello, F. Cecere, S Albiol, V Guillem, E Gallardo, J Carles, P Mendez, J. de la Cruz, et al.
Gene expression of ERCC1 as a novel prognostic marker in advanced bladder cancer patients receiving cisplatin-based chemotherapy
Ann. Onc., March 1, 2007; 18(3): 522 - 528.
[Abstract] [Full Text] [PDF]


Home page
Ann OncolHome page
P Ceppi, M Volante, S Novello, I Rapa, K. Danenberg, P. Danenberg, A Cambieri, G Selvaggi, S Saviozzi, R Calogero, et al.
ERCC1 and RRM1 gene expressions but not EGFR are predictive of shorter survival in advanced non-small-cell lung cancer treated with cisplatin and gemcitabine
Ann. Onc., December 1, 2006; 17(12): 1818 - 1825.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
G. Bepler, I. Kusmartseva, S. Sharma, A. Gautam, A. Cantor, A. Sharma, and G. Simon
RRM1 Modulated In Vitro and In Vivo Efficacy of Gemcitabine and Platinum in Non-Small-Cell Lung Cancer
J. Clin. Oncol., October 10, 2006; 24(29): 4731 - 4737.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
K. A. Olaussen, A. Dunant, P. Fouret, E. Brambilla, F. Andre, V. Haddad, E. Taranchon, M. Filipits, R. Pirker, H. H. Popper, et al.
DNA repair by ERCC1 in non-small-cell lung cancer and cisplatin-based adjuvant chemotherapy.
N. Engl. J. Med., September 7, 2006; 355(10): 983 - 991.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
E. Giovannetti, V. Mey, S. Nannizzi, G. Pasqualetti, M. Del Tacca, and R. Danesi
Pharmacogenetics of anticancer drug sensitivity in pancreatic cancer.
Mol. Cancer Ther., June 1, 2006; 5(6): 1387 - 1395.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
E. Giovannetti, M. Del Tacca, V. Mey, N. Funel, S. Nannizzi, S. Ricci, C. Orlandini, U. Boggi, D. Campani, M. Del Chiaro, et al.
Transcription analysis of human equilibrative nucleoside transporter-1 predicts survival in pancreas cancer patients treated with gemcitabine.
Cancer Res., April 1, 2006; 66(7): 3928 - 3935.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. Suzuki, Y. Daigo, N. Ishikawa, T. Kato, S. Hayama, T. Ito, E. Tsuchiya, and Y. Nakamura
ANLN Plays a Critical Role in Human Lung Carcinogenesis through the Activation of RHOA and by Involvement in the Phosphoinositide 3-Kinase/AKT Pathway
Cancer Res., December 15, 2005; 65(24): 11314 - 11325.
[Abstract] [Full Text] [PDF]


Home page
ChestHome page
L. Thomas, L. A. Doyle, and M. J. Edelman
Lung Cancer in Women: Emerging Differences in Epidemiology, Biology, and Therapy
Chest, July 1, 2005; 128(1): 370 - 381.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J. Y. Chang, R. Komaki, R. Sasaki, Z. Liao, C. W. Stevens, C. Lu, F. V. Fossella, P. K. Allen, J. D. Cox, M. R. Spitz, et al.
High Mutagen Sensitivity in Peripheral Blood Lymphocytes Predicts Poor Overall and Disease-Specific Survival in Patients with Stage III Non-Small Cell Lung Cancer Treated with Radiotherapy and Chemotherapy
Clin. Cancer Res., April 15, 2005; 11(8): 2894 - 2898.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
K.-S. Kim, J.-Y. Jeong, Y.-C. Kim, K.-J. Na, Y.-H. Kim, S.-J. Ahn, S.-M. Baek, C.-S. Park, C.-M. Park, Y.-I. Kim, et al.
Predictors of the Response to Gefitinib in Refractory Non-Small Cell Lung Cancer
Clin. Cancer Res., March 15, 2005; 11(6): 2244 - 2251.
[Abstract] [Full Text] [PDF]


Home page
ChestHome page
G. R. Simon, S. Sharma, A. Cantor, P. Smith, and G. Bepler
ERCC1 Expression Is a Predictor of Survival in Resected Patients With Non-small Cell Lung Cancer
Chest, March 1, 2005; 127(3): 978 - 983.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
R. Suk, S. Gurubhagavatula, S. Park, W. Zhou, L. Su, T. J. Lynch, J. C. Wain, D. Neuberg, G. Liu, and D. C. Christiani
Polymorphisms in ERCC1 and Grade 3 or 4 Toxicity in Non-Small Cell Lung Cancer Patients
Clin. Cancer Res., February 15, 2005; 11(4): 1534 - 1538.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
M. Taron, R. Rosell, E. Felip, P. Mendez, J. Souglakos, M. S. Ronco, C. Queralt, J. Majo, J. M. Sanchez, J. J. Sanchez, et al.
BRCA1 mRNA expression levels as an indicator of chemoresistance in lung cancer
Hum. Mol. Genet., October 1, 2004; 13(20): 2443 - 2449.
[Abstract] [Full Text] [PDF]


Home page
Ann OncolHome page
D. Isla, C. Sarries, R. Rosell, G. Alonso, M. Domine, M. Taron, G. Lopez-Vivanco, C. Camps, M. Botia, L. Nunez, et al.
Single nucleotide polymorphisms and outcome in docetaxel-cisplatin-treated advanced non-small-cell lung cancer
Ann. Onc., August 1, 2004; 15(8): 1194 - 1203.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
W. Zhou, S. Gurubhagavatula, G. Liu, S. Park, D. S. Neuberg, J. C. Wain, T. J. Lynch, L. Su, and D. C. Christiani
Excision Repair Cross-Complementation Group 1 Polymorphism Predicts Overall Survival in Advanced Non-Small Cell Lung Cancer Patients Treated With Platinum-Based Chemotherapy
Clin. Cancer Res., August 1, 2004; 10(15): 4939 - 4943.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C.-K. Youn, M.-H. Kim, H.-J. Cho, H.-B. Kim, I.-Y. Chang, M.-H. Chung, and H. J. You
Oncogenic H-Ras Up-Regulates Expression of ERCC1 to Protect Cells from Platinum-Based Anticancer Agents
Cancer Res., July 15, 2004; 64(14): 4849 - 4857.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
R. Rosell, E. Felip, M. Taron, J. Majo, P. Mendez, M. Sanchez-Ronco, C. Queralt, J. J. Sanchez, and J. Maestre
Gene Expression as a Predictive Marker of Outcome in Stage IIB-IIIA-IIIB Non-Small Cell Lung Cancer After Induction Gemcitabine-Based Chemotherapy Followed By Resectional Surgery
Clin. Cancer Res., June 15, 2004; 10(12): 4215S - 4219S.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H. I. Wu, J. A. Brown, M. J. Dorie, L. Lazzeroni, and J. M. Brown
Genome-Wide Identification of Genes Conferring Resistance to the Anticancer Agents Cisplatin, Oxaliplatin, and Mitomycin C
Cancer Res., June 1, 2004; 64(11): 3940 - 3948.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
U. Warnecke-Eberz, R. Metzger, F. Miyazono, S. E. Baldus, S. Neiss, J. Brabender, H. Schaefer, W. Doerfler, E. Bollschweiler, H. P. Dienes, et al.
High Specificity of Quantitative Excision Repair Cross-Complementing 1 Messenger RNA Expression for Prediction of Minor Histopathological Response to Neoadjuvant Radiochemotherapy in Esophageal Cancer
Clin. Cancer Res., June 1, 2004; 10(11): 3794 - 3799.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
R. Rosell, K. D. Danenberg, V. Alberola, G. Bepler, J. J. Sanchez, C. Camps, M. Provencio, D. Isla, M. Taron, P. Diz, et al.
Ribonucleotide Reductase Messenger RNA Expression and Survival in Gemcitabine/Cisplatin-Treated Advanced Non-Small Cell Lung Cancer Patients
Clin. Cancer Res., February 15, 2004; 10(4): 1318 - 1325.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
M. A. Moufarij, D. R. Phillips, and C. Cullinane
Gemcitabine Potentiates Cisplatin Cytotoxicity and Inhibits Repair of Cisplatin-DNA Damage in Ovarian Cancer Cell Lines
Mol. Pharmacol., April 1, 2003; 63(4): 862 - 869.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Selvakumaran, D. A. Pisarcik, R. Bao, A. T. Yeung, and T. C. Hamilton
Enhanced Cisplatin Cytotoxicity by Disturbing the Nucleotide Excision Repair Pathway in Ovarian Cancer Cell Lines
Cancer Res., March 15, 2003; 63(6): 1311 - 1316.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
R. Danesi, F. De Braud, S. Fogli, T. M. De Pas, A. Di Paolo, G. Curigliano, and M. Del Tacca
Pharmacogenetics of Anticancer Drug Sensitivity in Non-Small Cell Lung Cancer
Pharmacol. Rev., March 1, 2003; 55(1): 57 - 103.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
E. Galani, P. A. Ellis, and P. G. Harper
Small-Cell Lung Cancer, High Growth Rate, High Response Rate to Chemotherapy: Ideal for High-Dose Chemotherapy?
J. Clin. Oncol., October 1, 2002; 20(19): 3941 - 3943.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lord, R. V. N.
Right arrow Articles by Rosell, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lord, R. V. N.
Right arrow Articles by Rosell, R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online