| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Experimental Therapeutics, Preclinical Pharmacology |
Laboratory of Molecular Biology, Center for Cancer Research, National Cancer Institute, NIH, Bethesda, Maryland 20892-4264
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Experimental Design: A group of MAbs against CD30 was produced and characterized for their reactivity and epitopes. Recombinant immunotoxins were made using the Fv genes cloned from the hybridomas. Their cytotoxic activities were examined on various CD30-positive cell lines.
Results: Six MAbs were produced. All reacted with recombinant soluble CD30 and to a CD30-Fc fusion protein, and bound to native CD30 expressed on Hodgkin’s lymphoma-derived cell lines. The epitopes of the six MAbs were classified into two groups by a mutual competition assay for the binding to CD30 on cells. Sequencing the cDNAs revealed that all of the variable chains are unique except one valiable light that is shared by two MAbs. We made four disulfide stabilized Fv-based recombinant immunotoxins, in which the valiable heavy, which is genetically fused with truncated mutant of Pseudomonas exotoxin, forms a disulfide bond with the valiable light. The purified immunotoxins bound to recombinant soluble CD30 immobilized on a biosensor chip with Kds of 4–400 nM. Fluorescence-activated cell sorter analysis confirmed their specific binding. In vitro cytotoxicity tests showed that the immunotoxins specifically kill a variety of CD30-positive lymphoma cell lines as well as CD30-transfected A431 cells. The IC50 ranged from 0.3 to 100 ng/ml.
Conclusions: Four anti-CD30 disulfide stabilized Fv immunotoxins were successfully produced. Two of these showed good cytotoxic activity to various CD30-positive cell lines. These newly produced immunotoxins should be additionally evaluated for the treatment of CD30-positive lymphomas.
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
To extend the usefulness of immunotoxin therapy, it is important to develop immunotoxins against different targets. CD30 is a member of the tumor necrosis factor receptor superfamily. CD30 is an excellent target because it is usually highly expressed on malignant Reed Sternberg cells of HL and in ALCL, whereas it is only expressed in a small subset of normal lymphocytes that can be resupplied from stem cells (19) . Although its function is largely unknown, CD30 has been implicated both in cell death and proliferation (20, 21, 22) . The possibility of using CD30 as a target for immunotoxin therapy has been investigated in earlier studies using anti-CD30 MAbs chemically conjugated with toxins (23, 24, 25, 26) . To obtain an anti-CD30 immunotoxin with better properties, recombinant immunotoxins have been produced. Klimka et al. (27) reported the production of a recombinant immunotoxin derived from the anti-CD30 MAb Ki-4 by fusing its scFv to truncated PE. Recently, the antitumor activity of this immunotoxin was reported in a SCID mouse model (28) . Our group has reported the isolation of a new anti-CD30 scFv using the phage display technique and the properties of immunotoxins containing the scFv (29) . All of these recombinant immunotoxins showed specific binding to CD30-positive lymphoma cell lines and killed target cells as assessed by inhibition of protein synthesis with a IC50 of 40–50 pM. However, the cytotoxic activities were much less than an immunotoxin that targets CD25 on these cells, which has an IC50 of 0.2 pM (30) .
Because only two anti-CD30 Fvs had been used to make the recombinant immunotoxins and because their cytotoxic activities were moderate, we decided to make a panel of anti-CD30 MAbs and pick the best of these for recombinant immunotoxin production. In addition, we made dsFv-based immunotoxins instead of scFv-immunotoxins to take advantage of the benefits of the dsFv form. In this study, we produced six anti-CD30 MAbs and classified them with their reactivities and epitopes. Finally, four dsFv immunotoxins were successfully produced. Two of these showed good cytotoxic activity with IC50s of 5–8 pM on CD30-positive cells.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Recombinant CD30s.
sCD30 was produced in Escherichia coli BL21(
DE3) containing pHR30HNB, a plasmid encoding the extracellular domain of human CD30 with His-tag at the COOH terminus, as described previously (29)
.
The extracellular domain of CD30 was expressed as a fusion protein with human IgG Fc in transfected 293T cells. The DNA fragment encoding human IgG Fc was amplified by PCR using a Ret-Fc plasmid (provided by Dr. M. Billaud, Centre National de la Recherche Scientifique, Strasbourg, France) as the template and inserted between NotI and XbaI sites of pCDNA1.1 (Stratagene, La Jolla, CA). The cDNA for the extracellular domain of CD30 containing its signal peptide (29) was inserted between the NotI and EcoRI to obtain the plasmid pRB-2k1-CD30. The plasmid was transfected into 293T cells by LipofectAMINE reagent (Life Technologies, Inc., Rockville, MD), and the CD30-Fc protein harvested from the culture supernatant and purified with Hi-Trap protein A column (Amersham Pharmacia Biotech, Piscataway, NJ).
Production of Anti-CD30 MAbs.
Female BALB/c mice (6 weeks old) were immunized intradermally twice with 15 µg of pHRm30c, a plasmid encoding full-length of human CD30 under control of cytomegalovirus promoter (29
, 31) . The DNA immunizations were followed by three or four i.v. injections of 50 µg of sCD30 protein with 2-week intervals. Three days after the last boost, spleen cells were taken and fused with SP2/O mouse myeloma cells as described (32)
. Culture supernatants of growing hybridomas were tested for the production of anti-CD30 MAbs by an ELISA described below. Cloning of the specific hybridomas, MAb purification from the culture supernatants, and biotinylation of purified MAb were performed as described (33)
. Isotype of the MAbs was determined by a mouse MAb isotyping kit (Zymed, South San Francisco, CA). Immunoglobulin concentrations in the culture supernatants were determined by a sandwich ELISA as described previously (32)
. The HeFi-I hybridoma producing anti-CD30 MAb (34)
was obtained from the National Cancer Institute, Frederick Cancer Research and Development Center, Biological Resources Branch, Frederick, MD.
Cloning of VH and VL of MAbs.
Total cellular RNA was isolated from 107 hybridoma cells using a RNA extraction kit (Amersham Pharmacia Biotech, Uppsala, Sweden). VH and VL cDNAs of the MAbs were obtained by a RACE method using SMART RACE cDNA amplification kit (Clontech, Palo Alto, CA). In brief, adaptor-ligated cDNA was generated from 5 µg of the RNA using Superscript II reverse transcriptase (Life Technologies, Inc.) with 10 pmol of 3' end primers designed for each chain of immunoglobulin (
, 
1, 2b) to anneal each constant region sequence (GACTGAGGCACCTCCAGATGTTAA for , CAGGGTCACCATGGAGTTAGTTTG for 1, and TCCAGAGTTCCAAGTCACAGTCAC for 2b chain). The primers covered the all of the constant region sequences registered in Kabat database (35)
.4
The prepared cDNAs were used as the template for PCR reactions between 5' end primer that binds to the adaptor sequence and immunoglobulin subclass-specific 3'end primer of which the sequences are located on the upstream of the primers for cDNA synthesis (GGATGGTGGGAAGATGGATACAGTTGGTGCAGC for , AGGGGCCAGTGGATAGACAGATGGGGGTGT for 1, and AGGGGCCAGTGGATAGACTGATGGGGGTGT for 2b chain). The PCR products were cloned into pCR2.1-TOPO vector using TOPO TA cloning kit (Invitrogen, San Diego, CA). At least three independent clones for each chain were sequenced to exclude the possibility of PCR error. The obtained sequences were aligned according to Kabat alignment scheme (36)
.
Construction of Plasmids for dsFv-PE38 Immunotoxins.
Two plasmids were constructed for each dsFv-immunotoxin: one encoded a VL chain with a cysteine mutation at residue 100 (according to Kabat numbering) and the other encoded a VH chain-PE38 fusion protein with a cysteine mutation at position 44 of the VH (8)
. To make the VL construct, each VL was PCR-amplified using a 5' primer, introducing an Nde I site and a 3' primer, introducing an EcoRI site and mutating residue 100 to cysteine. VH fragments containing cysteine mutation at residue 44 were made by a splicing overlap extension PCR method (37)
. Both strands of oligo DNA around residue 44 were synthesized to introduce cysteine at this position. 5' and 3' end primers were designed to introduce an Nde I site containing an ATG initiation codon and a Hind III site that code an additional lysine or glutamine, respectively. Two truncated VH fragments were amplified using one of the two oligos containing the mutation with the 5' or 3' terminal primer. These two fragments were combined in a subsequent assembly reaction in which the overlapped ends of each fragment anneal and extend. The final full-length DNA of VH was amplified by another PCR using the 5' and 3' end primers. The VL(Cys) and VH(Cys) PCR products were digested with Nde I and either EcoRI or Hind III, and were cloned into a T7-based expression vector pRB98Amp (originated from pULI7; 4
) that encodes the connector and PE38 between Hind III and EcoRI sites. The correct construction of the plasmids was confirmed by DNA sequencing.
Production and Purification of Recombinant dsFv-Immunotoxins.
Disulfide-linked immunotoxins were produced by refolding of inclusion body protein as described previously (13
, 38)
. The plasmids encoding VL(Cys) and VH(Cys)-PE38 were separately transfected into E. coli BL21(DE3). The bacterial cultures were induced for the protein expression in the exponential growth phase with 1 mM isopropyl-1-thio-ß-D-galactopyranoside for 2 h. The recombinant proteins accumulated as insoluble inclusion bodies and were isolated from lysed bacteria cells by centrifugation. These inclusion bodies contained the recombinant protein in >70% purity but in an inactive form that requires refolding to an active form. The inclusion bodies were completely solubilized in 6 M guanidine hydrochloride and then reduced with dithioerythritol. The solubilized reduced proteins of VL(Cys) and VH(Cys)-PE38 were combined in an 2:1 molar ratio and refolded by 1:100 dilution into refolding solution containing redox shuffling and aggregation-preventing additives (oxidized and reduced glutathione, and L-arginine). After the refolding, guanidine hydrochloride in the solution was removed by a dialysis against a Tris buffer containing 0.1 M urea. The refolded active protein was then separated from contaminating bacterial proteins and from improperly folded protein by anion exchange chromatography using Q-Sepharose and Mono-Q (Amersham Pharmacia Biotech), and by size exclusion chromatography (TSK3000; TOSOH, Tokyo, Japan). The proteins were analyzed by SDS-PAGE under reducing and nonreducing conditions. Protein concentrations of the purified immunotoxins were determined by a Bradford assay (Coomassie Plus; Pierce, Rockford, IL) with BSA as the standard.
ELISA.
The binding of anti-CD30 MAbs to sCD30 and CD30-Fc was assayed by indirect ELISAs. Microtiter plates (Costar, Cambridge, MA) were coated with 20 ng/well of sCD30 or CD30-Fc in PBS overnight at 4°C. After blocking with 0.5% of BSA in PBS, hybridoma supernatants or purified MAbs were added to the coated wells and incubated for 2 h at room temperature. The bound MAbs were detected with alkaline phosphatase-labeled antimouse IgG (BioSource, Camarillo, CA) and p-nitrophenyl phosphate as the substrate.
FACS Analysis.
FACS analysis was performed to measure the binding of the MAbs or immunotoxins to native CD30 expressed on various cell lines. In a typical protocol for staining with MAb, 2 x 105 cells were incubated with appropriate dilution of the MAbs in 100 µl of PBS containing 5% fetal bovine serum and 0.1% sodium azide. After incubation for 1 h at 4°C, the cells were washed twice with the same buffer and incubated with FITC-labeled goat mouse IgG (BioSource). After washing, the cells were suspended in 1 ml of the buffer, and the fluorescence associated with the live cells was measured using a FACScalibur flow cytometer (Beckman Coulter, Fullerton, CA). For controls, anti-CD30 MAbs HeFi-I, Ber-H2 (DAKO, Glostrup, Denmark) and HRS-4 (Biodesign Int., Kennbunk, ME) were used.
For cell staining using immunotoxins, an anti-PE38 rabbit polyclonal antibody (our laboratory) and R-PE-labeled antirabbit IgG (BioSource) were used as the detection reagents.
A competitive FACS assay was carried out to classify the epitopes recognized by the anti-CD30 MAbs. The CD30-positive cells were incubated with 50 ng/ml of various biotinylated MAbs in the presence of serial dilution of various unlabeled MAbs. R-PE-conjugated streptavidin (Jackson, West Grove, PA) was used for the detection of the biotinylated MAbs bound to cells.
Surface Plasmon Resonance Assay.
The affinity of the dsFv immunotoxins to sCD30 was determined by surface plasmon resonance using BIAcore (Biacore, Piscataway, NJ). An appropriate amount (500 resonance units) of sCD30 was immobilized onto the biosensor chip, CM5 (Biacore). On and off rates of immunotoxins were measured in PBS by injecting 25 µg/ml of each immunotoxin over the chip surface for 5 min and then allowing the bound material to dissociate for 5 min by flowing only the buffer solution over the chip. Binding kinetics were analyzed using BIAevaluation 2.1 software.
Cytotoxicity Assay.
Cytotoxic activities were assayed by the inhibition of cellular protein synthesis measured by [3H]leucine uptake by the cells (29)
. Cells were seeded into 96-well plates at a concentration of 2 x 104 of cells/well and incubated for 24 h (attached cells) or 1 h (suspension cells). The immunotoxins diluted in the culture medium were added to the cells, resulting in final concentrations ranging from 0.01 to 1000 ng/ml. In some experiments, MAbs were added together with the immunotoxin as the competitors. As positive controls, anti-Tac(dsFv)-PE38 (39)
and anti-TFR(Fv)-PE40 (40)
were used. After incubation for 24 h, 2 µCi of [3H]leucine (Amersham Pharmacia Biotech) was added per well and incubated for 2–5 h. The cells were then frozen and thawed and harvested onto glass filters using a cell harvester (Tomtec, Hamden, CT). The radioactivity associated with the cells was determined in an automated scintillation counter (1205 Betaplate; Wallac, Gaithersburg, MD).
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Characterization of Anti-CD30 MAbs.
The characteristics of the six MAbs are summarized in Table 1
. We obtained five IgG1 antibodies and one IgG2b. In ELISA, all of the MAbs showed almost the same level of reactivity to sCD30 and CD30-Fc compared with the control MAbs (HeFi-I, Ber-H2, and HRS-4). We measured the binding activity of the MAbs to native CD30 on cells. A FACS analysis showed that all of the MAbs bound to native CD30 expressed on two CD30-positive HL cell lines, L428 and L540, with apparent affinities ranging from 28% to 180% of the control (HeFi-I).
|
. Although the extent of inhibition varied, 75% inhibition of binding was used as the cutoff value to determine whether epitopes were similar or different.
|
Cloning of cDNAs of the VH and VL Domains of the Anti-CD30 MAbs.
We attempted to clone all Fvs of the MAbs to construct recombinant immunotoxins. VH and VL cDNAs were isolated from the hybridomas by a RACE method as described in "Materials and Methods." All of the variable domains were cloned except VH of T21. The deduced amino acid sequences of VH and VL are shown in Fig. 1
. One set of unique VH and VL cDNAs was obtained from each hybridoma except for T14; two VLs were isolated from T14. These sequences were different from those of the previous anti-CD30 Fvs reported. An aberrant VL sequence derived from SP2/O myeloma cells (41)
was obtained from hybridomas T13 and T14 (data not shown). Sequence analysis using the database of germ-line genes (Ig blast)5
revealed that all of the VH and VL amino acids sequences were derived from different germ-line V genes with a similarity of 83–98%.
|
The VL(Cys) and VH(Cys)-PE38 were expressed in E. coli under control of the T7 promoter and harvested as inclusion bodies. The immunotoxins were refolded and purified as described in "Materials and Methods." The recovery of the inclusion body protein and purified immunotoxin protein are shown in Table 3
. We obtained four immunotoxins based on Fvs of T6, T14-A (using T14-VL-A), T24, and T25. Fig. 2
shows the SDS-PAGE of the purified dsFv immunotoxins under reducing and nonreducing conditions. All of the immunotoxins migrated as single bands with the expected molecular weight (Mr 63,000) in a nonreducing gel. Under reducing conditions, each band separated into two bands, which correspond to VL and VH-PE38. This indicates that all of the dsFv immunotoxins were properly formed.
|
|
, L540 cells expressing CD30 were stained by T6, T14-A, T24, and T25 dsFv-PE38 in a dose-dependent manner, whereas no binding was detected on CD30-negative control cells, SP2/O (data not shown). The relative reactivities estimated by the staining levels varied. T6 and T25 were the strongest binders. T24 and T14-A showed moderate and low levels of binding, respectively. In the same experiment, an immunotoxin reacting with the transferrin receptor [HB21(scFv)-PE40] used as a positive control bound to the cells and a negative control, antimesothelin SS1(dsFv)-PE38, did not. The binding of the anti-CD30 immunotoxins was inhibited by the addition of free CD30-Fc to the reaction, but the binding of the antitransferrin immunotoxin was not affected. These results indicate that the Fv portions of the four different anti-CD30 dsFv-PE38s specifically bind to CD30 molecules on the target cells with a variety of affinities.
|
shows the binding parameters determined from the sensorgrams of each immunotoxin where sCD30 was immobilized on the sensor chip. All of the anti-CD30 dsFv immunotoxins exhibited significant affinities to CD30, which varied over a 100-fold range. Consistent with the FACS data shown in Fig. 3
, T6(dsFv)-PE38 and T25(dsFv)-PE38 exhibited stronger binding than the others with Kds of 22 nM and 4 nM, respectively. The affinity of T25(dsFv)-PE38 was comparable with that of the bivalent HeFi-I MAb and 
10-fold better than that of CL2(scFv)-PE38 that had been established previously in our laboratory.
|
, T6 and T25(dsFv)-PE38 specifically killed the CD30-expressing A431 cells with IC50 values of 0.5 and 0.3 ng/ml, respectively. These two immunotoxins were more effective than CR2(scFv)-PE38 (IC50 = 2.5 ng/ml). T24(dsFv)-PE38 was slightly cytotoxic (IC50 = 20 ng/ml), and T14-A(dsFv)-PE38 was nontoxic. Because T6 and T14-A bind to epitope I, and T24 and T25 bind to epitope II, there was no significant correlation between the cytotoxicity and the epitopes of the immunotoxins. In contrast, the IC50 values were well correlated with their affinities (correlation coefficient = 0.91). All of the anti-CD30 immunotoxins exhibited no cytotoxicity to the control cells (ATAC4) expressing CD25 (Fig. 4B)
. Both the A431/CD30 and the A431/CD25 cells can be killed by a positive control immunotoxin to the transferrin receptor, HB21(scFv)-PE40, to the same extent, suggesting these cells have similar susceptibilities to Pseudomonas exotoxin.
|
, the immunotoxins were effective on almost all of the CD30-positive cell lines. The IC50s varied over a 100-fold range depending on the cells and the immunotoxins. There was almost no correlation between the IC50 values and the expression level of CD30 on the cells. On some cell lines, the IC50s of T6 and T25(dsFv)-PE38 were 10 ng/ml or less, which is comparable with the activities of other dsFv immunotoxins established in our laboratory for clinical use.
|
. Because the epitopes of T6 and T25 were topographically separated as shown in Table 2
, both of the MAbs were used as the competitors. A431/CD30 and three cell lines that were susceptible to the immunotoxins were incubated with various concentrations of competitors and a concentration of T6 or T25 immunotoxin that was 3-fold higher than their IC50s. On all of the cells, the cytotoxicity of the T6 and T25 immunotoxin was inhibited only by their parental MAb. This result shows that the immunotoxins retained the same binding specificity as the parent MAb, and their cytotoxic activities on various CD30-positive cancer cells depend on their specific binding to the proper epitope.
|
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Production and Characterization of Anti-CD30 MAbs.
We isolated various Fvs to test their suitability for making recombinant immunotoxins. In our previous study, we isolated specific scFvs for CD30 by panning scFv-displaying phage libraries made from the spleen cells of DNA-immunized mice (29)
. This approach made it possible to obviate the burden of making specific hybridomas and of cloning of the Fv gene from the hybridoma. Unfortunately the number of different Fvs obtained by this method was limited. This was probably because of the protocol used for PCR amplification of Fv genes, which could have lead to a biased library. In addition, the selection and enrichment steps could affect the Fvs obtained. Therefore, we returned to the hybridoma technique to obtain a variety of different Fvs.
The new anti-CD30 MAbs were characterized for their binding to cells expressing CD30 and for their topographical epitopes. Previously we have concentrated on finding Fvs of high affinity and have not been concerned about the epitopes recognized by these Fvs. However, binding of a Fv to a special epitope on a surface antigen might affect various biological events such as antigen shedding, internalization, and signal transduction. In the case of CD30, there is evidence that the ability of an anti-CD30 MAb, Ki-4, to inhibit shedding of CD30 may explain the relatively high activity of the immunotoxin produced with this antibody (27 , 42 , 43) . Also, MAbs HeFi-I and M44 had been reported to have antitumor effects on ALCL cells (44 , 45) . These MAbs are known to share the same epitope associated with CD30-ligand binding (46) . These studies suggest that immunotoxins containing Fvs that bind to this epitope would have high cytotoxic activity.
In our study, the six Fvs obtained were all highly reactive to native CD30 on human cells by FACS (Table 1)
. Their epitopes were classified into two groups, I and II (Table 2)
. In previous studies, three major groups of epitopes (clusters A, B, and C) on native CD30 have been identified (42
, 46)
. This study and the two studies mentioned previously included the characterization of the following MAbs: Ber-H2, HRS-4, and HeFi-I. Because epitope I (in our study) and cluster A (in previous studies) both include Ber-H2 and HRS-4, and because epitope II and cluster C both include HeFi-I, it is likely that epitope I and II are the same as cluster A and C, respectively. The epitope of Ki-4 (a MAb reported for its inhibitory effects on shedding of CD30) belongs to the same group, epitope I or cluster A, as the following newly produced MAbs: T6, T13, T14, and T21 (42)
. T24 and T25 belong to the same epitope group, epitope II or cluster C, as HeFi-I, which has been reported to possess antitumor activity (45)
. Therefore, our panel of MAbs covers the epitopes of the previous MAbs that have been reported to have biological activities. Our previous immunotoxin, CL2(scFv)-PE38, belongs to epitope I or cluster A (29)
.
Production of the dsFv-based Immunotoxins by Use of the Fvs Isolated.
We obtained unique cDNAs encoding both the VH and VL of six MAbs (T6, T13, T14, T24, T25, and Hefi-I) except for VH of T21. All of the deduced amino acid sequences were different from the sequences of the Ki-4 Fv and our previous anti-CD30 scFv (Fig. 1)
. This suggests that the characteristics of immunotoxins derived from these Fvs may be different from previous immunotoxins. Because all of the sequences contain significant numbers of mutated residues, when compared with the closest germ-line sequences, we expect that these Fvs represent a repertoire of antibodies that had undergone the affinity maturation process in vivo. We succeeded in producing four fully recombinant dsFv-PE38s with reasonable yield and purity.
Effects of Immunotoxins on Cancer Cells.
All of the immunotoxins showed specific binding to CD30 on cells (Fig. 3)
with different affinities with Kds varying from 4 to 410 nM. Consistent with their binding characteristics, the immunotoxins showed specific cytotoxic activity on CD30-transfected cells and CD30-positive cancer cells (Fig. 4
; Table 5
). Several lines of evidence, especially the data in Fig. 5
, demonstrated that the killing was mediated by binding of the Fv portions of the immunotoxins to their own epitopes of CD30 on the cells.
Because the topographical epitope and the affinity of each immunotoxin were determined in this study, we can analyze the relationship between the cytotoxic activity and these properties. The IC50s from cytotoxicity assays varied over a 100-fold range depending on the immunotoxin and cell line used. Although it is clear that T6 and T14-A bind to epitope I, and T24 and T25 bind to epitope II, no significant correlation was observed between binding to these epitopes and the cytotoxic activities of the immunotoxins. In a preliminary experiment, no significant change in the level of soluble CD30 in the culture supernatant was observed after the treatment of cells with immunotoxins, suggesting that the effects of immunotoxins on CD30-shedding may not be different among the different immunotoxins we have produced (data not shown).
In contrast, when comparing the cytotoxic activity of these immunotoxins on each cell line, their activity was well correlated with their affinity. These results suggest that the affinity to CD30 is the primary factor in determining the efficacy of these immunotoxins. The affinities of other immunotoxins developed in our laboratory to different targets range from Kd 1 to 10 nM (47) . These molecules exhibited significant antitumor effects in patients (1 , 6, 7, 8) . It is likely that the affinity of the best immunotoxin (T25, Kd = 4.0 nM) in this study is enough to proceed to develop this immunotoxin for clinical use. Still, it should also be possible to obtain more active immunotoxins by improving their affinities by mutating residues in the Fvs that are important for binding to CD30.
Another notable finding from the cytotoxicity assays is that a large difference was seen in the susceptibilities of the CD30-positive cell lines to the immunotoxins (Table 5)
. The difference in susceptibility was not related to the CD30 level on the cells but was correlated with the IC50 values of an immunotoxin [HB21(scFv)-PE40] targeting the transferrin receptor. These results suggest that the differences in susceptibility to CD30-targeted toxins may be because of the different sensitivities of the cells to any Pseudomonas exotoxin-based immunotoxins. We also investigated whether soluble CD30, produced by shedding of CD30, might influence the IC50 by competing for the immunotoxins and explain the difference in susceptibilities. However, soluble CD30 secreted in the culture supernatants of L428 and L540 cells did not inhibit the cytotoxicity either of the T6 or T25 immunotoxins on A431/CD30 cells (data not shown). Many factors are important in determining the IC50 of immunotoxins on target cells. These include affinity, internalization rates of CD30, and differences in processing of immunotoxins. A preliminary experiment using furin-cleaved immunotoxins showed that the decreased sensitivity of L540 cells is not because of a defect in intracellular processing, which is required for its cytotoxic activity (data not shown).
In this study, we produced two powerful immunotoxins, T6 and T25(dsFv)-PE38, and showed their potential in the treatment of CD30-positive cancers. The newly produced immunotoxins should be evaluated additionally for clinical use because they showed higher cytotoxic activity than previous immunotoxins against CD30 and because disulfide-stabilized Fvs were successfully introduced in these immunotoxins to take advantage of the benefits of the dsFv stability. The mechanism of action of immunotoxins is totally different from that of chemotherapy, and these immunotoxins offer a powerful alternative for the treatment of CD30-positive malignancies.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 Present address: Discovery Research Laboratories, Shionogi & Co., Ltd., Osaka, Japan. 
2 To whom requests for reprints should be addressed, at Laboratory of Molecular Biology, National Cancer Institute, NIH, 37 Convent Drive MSC 4264, Building 37, Room 5106, Bethesda, MD 20892-4264. Phone: (301) 496-4797; Fax: (301) 402-1344; E-mail: pasta{at}helix.nih.gov
3 The abbreviations used are: PE38, a 38-kDa mutant form of Pseudomonas exotoxin A; HL, Hodgkin’s lymphoma; ALCL, anaplastic large cell lymphoma; sCD30, recombinant soluble CD30; dsFv, disulfide-bond stabilized form of Fv fragment; scFv, single-chain Fv; MAb, monoclonal antibody; RACE, rapid amplification of cDNA ends; PE, phycoerythrin; FACS, fluorescence-activated cell sorter; VL, valiable light; VH, valiable heavy.
4 Internet address: http://immuno.bme.nwu.edu/.
5 Internet address: http://www.ncbi.nlm.nih.gov/igblast/.
Received 1/24/02; revised 4/ 5/02; accepted 4/ 9/02.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  X. Du, S. Nagata, T. Ise, M. Stetler-Stevenson, and I. Pastan FCRL1 on chronic lymphocytic leukemia, hairy cell leukemia, and B-cell non-Hodgkin lymphoma as a target of immunotoxins Blood, January 1, 2008; 111(1): 338 - 343. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Onda, S. Nagata, D. J. FitzGerald, R. Beers, R. J. Fisher, J. J. Vincent, B. Lee, M. Nakamura, J. Hwang, R. J. Kreitman, et al. Characterization of the B Cell Epitopes Associated with a Truncated Form of Pseudomonas Exotoxin (PE38) Used to Make Immunotoxins for the Treatment of Cancer Patients J. Immunol., December 15, 2006; 177(12): 8822 - 8834. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. A. Rizvi, A. M. Evens, M. S. Tallman, B. P. Nelson, and S. T. Rosen T-cell non-Hodgkin lymphoma Blood, February 15, 2006; 107(4): 1255 - 1264. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Onda, M. Willingham, S. Nagata, T. K. Bera, R. Beers, M. Ho, R. Hassan, R. J. Kreitman, and I. Pastan New Monoclonal Antibodies to Mesothelin Useful for Immunohistochemistry, Fluorescence-Activated Cell Sorting, Western Blotting, and ELISA Clin. Cancer Res., August 15, 2005; 11(16): 5840 - 5846. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Nagata, T. Ise, M. Onda, K. Nakamura, M. Ho, A. Raubitschek, and I. H. Pastan Cell membrane-specific epitopes on CD30: Potentially superior targets for immunotherapy PNAS, May 31, 2005; 102(22): 7946 - 7951. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Ise, H. Maeda, K. Santora, L. Xiang, R. J. Kreitman, I. Pastan, and S. Nagata Immunoglobulin Superfamily Receptor Translocation Associated 2 Protein on Lymphoma Cell Lines and Hairy Cell Leukemia Cells Detected by Novel Monoclonal Antibodies Clin. Cancer Res., January 1, 2005; 11(1): 87 - 96. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Onda, Q.-c. Wang, H.-f. Guo, N.-K. V. Cheung, and I. Pastan In Vitro and in Vivo Cytotoxic Activities of Recombinant Immunotoxin 8H9(Fv)-PE38 against Breast Cancer, Osteosarcoma, and Neuroblastoma Cancer Res., February 15, 2004; 64(4): 1419 - 1424. [Abstract] [Full Text] [PDF]
|
|
| ||||||||
, T14-A(dsFv)-PE38; 
, T24(dsFv)-PE38; and 
, T25(dsFv)-PE38. Open symbols represent controls: 
, anti-CD30 CL2(scFv)-PE38 that had been established previously; and 
, anti-transferrin receptor HB21(scFv)-PE40. Triplicate sample values were averaged for each point.
), T25 MAb (
), or control mouse IgG1 (•,