
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Clinical Trials |
The Ohio State University Comprehensive Cancer Center, Columbus, Ohio 43210 [S. S. F., B. B., T. F., C. D. B., M. A. C.]; Cancer and Leukemia B Statistical Center, Durham, North Carolina 27708 [S. L. G., R. K. D.]; University of Maryland, Baltimore, Maryland 21215 [E. J. L.]; Roswell Park Cancer Institute, Buffalo, New York 14263 [M. B.]; Mount Sinai Hospital, New York, New York 10029 [L. R. S.]; Duke University Comprehensive Cancer Center, Durham, North Carolina 27710 [J. C.]; University of Chicago, Chicago, Illinois 60637 [R. A. L.]; and Wayne State University School of Medicine, Detroit, Michigan 48201 [C. A. S.]
| ABSTRACT |
|---|
|
|
|---|
Experimental Design: AML patients
60 years in CR after induction and consolidation chemotherapy on Cancer and Leukemia Group B study 9420 were eligible if they had neutrophils
1 x 109/liters and platelets
75 x 109/liters. Patients received low-dose IL-2 (1 x 106 IU/m2/day s.c. for 90 days) or low-dose IL-2 with intermediate pulse doses (612 x 106 IU/m2/day s.c. for 3 days) every 14 days (maximum five pulses). In a subset of patients, we investigated the expression of NKG2D ligands by leukemic cells because they are likely important mediators of natural killer cytotoxicity.
Results: Of 35 CR patients receiving IL-2, 34 were evaluable for toxicity. Median age was 67 (range, 6076) years. Thirteen of 16 patients receiving low-dose IL-2 completed the planned therapy, and 11 of 18 who also received intermediate pulse dose IL-2 therapy completed all five pulses. The spectrum of toxicity in both groups was similar, with predominantly grade 12 fatigue, fever, injection site reactions, nausea, anemia, and thrombocytopenia. Grade 34 hematological and nonhematological toxicity were more frequent in patients also receiving intermediate pulse dose IL-2 therapy. Grade 34 fatigue and hematological toxicity, although uncommon, were the major causes for discontinuing or attenuating therapy. In 8 cases, mRNA for one or more NKG2D ligands was detected in leukemic cells obtained at diagnosis before treatment.
Conclusions: Low-dose IL-2, with or without intermediate pulse dose therapy, given immediately after chemotherapy in first CR to elderly AML patients is well tolerated. Expression of NKG2D ligands by leukemic cells was detected in the majority of cases tested and should be assessed for correlation with response to IL-2 in future studies.
| INTRODUCTION |
|---|
|
|
|---|
60 years is associated with poor prognostic features, including cytogenetic findings such as -5/del(5q), -7/del(7q) or complex karyotypes, as well as high expression of the multidrug resistance glycoprotein MDR1 (5, 6, 7)
. However, poor tolerance to intensive treatment by older patients is also an important factor. Although intensive induction chemotherapy is frequently well tolerated (1
, 2)
, postremission therapy may be less well tolerated. Only 29% of patients > 60 years of age could tolerate repetitive cycles of high-dose cytarabine, compared with 62% of younger patients in a recent CALGB trial investigating high-dose cytarabine postremission therapy (1)
. The biology of the disease and the limited tolerance to intensive postremission therapy in older AML patients indicate the need for alternative, well-tolerated, noncross-resistant therapies in the postremission period to prevent relapse. Several studies indicate that NK cells can mediate an antileukemic effect (8 , 9) . Lysis of leukemic cells (and other targets) by NK cells is regulated by a balance of activating and inhibitory surface receptors that interact with specific MHC class I and class I-like molecules expressed on target cells (10, 11, 12) . Under physiological conditions, recognition of self-MHC class I molecules on target cells by inhibitory receptors on NK cells of the killer cell immunoglobulin receptor and CD94/NKG2 families generates signals that lead to termination of NK cell activation. Autologous tumor cells missing MHC class I molecules or expressing altered self-MHC class I molecules trigger activation of NK cells and lysis. Recently, it was demonstrated that triggering signals mediated by the activating receptor NKG2D can override inhibitory signals generated by the interaction of killer cell immunoglobulin receptor with MHC class I molecules (13 , 14) . Expression of NKG2D ligands, including MHC class I chain-related molecules MICA and MICB, and molecules of the ULBP family by autologous tumor cells that also express unaltered MHC class I molecules may therefore be relevant for NK cell killing. To date, the expression of NKG2D ligands on fresh leukemic blasts has not been reported.
IL-2 can augment the cytotoxic effect of NK cells (15) . IL-2-activated NK cells can lyse fresh leukemic blasts that are generally resistant to killing by unstimulated NK cells (16 , 17) . Furthermore, IL-2 alone or in combination with ex vivo-generated IL-2-activated NK cells has been effective in treating leukemia in animals (17, 18, 19) and has induced clinical remissions in AML patients with overt relapse (20, 21, 22) . The dose and schedule of IL-2 in these studies have been highly variable, and in the majority of cases, high doses of IL-2 (318 x 106 IU/m2/d) were used, usually with significant toxicity. Caligiuri et al. (23, 24, 25) demonstrated that low-dose infusion of IL-2 results in the in vivo selective expansion of a normally small subset of NK cells (CD56bright CD16dim) expressing the high-affinity IL-2 receptor. The expanded NK cell population, however, demonstrated cytotoxic activity against NK-resistant cells only on incubation in higher concentrations of IL-2, which saturate the intermediate-affinity receptors. On the basis of the hypothesis that NK cell expansion results from engagement of high-affinity IL-2 receptors with low-dose IL-2 and that cytotoxic activity requires the activation of intermediate-affinity receptors only achieved with intermittent pulse doses with higher concentrations of IL-2, we designed a regimen of extended low-dose IL-2 with interval intermediate-dose IL-2 pulsing (26) . This regimen was well tolerated when used in patients with a variety of solid tumors (26) . In the latter study, however, patients were relatively young and IL-2 therapy did not follow intensive cytoreductive antileukemic chemotherapy.
The primary aim of this study was to investigate the tolerability of low-dose IL-2, with or without intermediate pulse doses, as postremission therapy in AML patients
60 years after intensive remission induction and consolidation chemotherapy. As a secondary aim, in a subset of patients where leukemic cells from diagnosis were available, we also examined for the expression MICA and MICB and the ULBPs by leukemic cells. Expression of these ligands by primary leukemic cells has not been previously reported but is likely to be an important mediator of NK cell killing of autologous target cells.
| PATIENTS AND METHODS |
|---|
|
|
|---|
60 years, biopsy proven AML with FAB M0-M2 or M4-M7 defined by standard criteria (27)
, no prior treatment for AML, no antecedent hematological disorder or history of prior chemotherapy exposure, and adequate renal and hepatic function. Patients with acute promyelocytic leukemia (AML-M3) were excluded and treated on other protocols. The protocol was reviewed and approved by local institutional review boards, and written consent for both AML chemotherapy and IL-2 therapy phases of the study was obtained from all patients.
Induction and Consolidation Therapy.
Protocol CALGB 9420 was a Phase I study undertaken to define the appropriate doses of daunorubicin to be given together with cytarabine, etoposide, and the multidrug resistance glycoprotein 1 modulator PSC-833 (28)
. Induction and consolidation consisted of cytarabine- and anthracycline-based chemotherapy with or without PSC-833. The details of induction and consolidation therapy, together with the results and toxicity of this portion of the protocol, have been reported previously (28)
.
IL-2 Therapy.
Patients were eligible for treatment with recombinant human IL-2 (Proleukin; Chiron/Cetus Corporation, Emeryville, CA) if they were in continuing CR as documented by the presence of <5% blasts in the BM on an aspirate and biopsy performed after hematological recovery from postremission chemotherapy. In addition, patients were required to have recovered from all nonhematological toxicity, a neutrophil count of
1.0 x 109/liters and a platelet count of
75 x 109/liters without growth factor or platelet transfusion support, respectively, and a satisfactory hepatic and renal function. Initially, patients received IL-2 at a dose of 1 x 106 IU/m2/day by s.c. injection for a total of 90 days. After the first 16 patients were treated, the low-dose IL-2 therapy was judged to be tolerable. The protocol was then modified to incorporate intermittent 3-day intermediate-dose pulse IL-2 in the dose schedule shown in Fig. 1
. IL-2 was initiated at 1 x 106 IU/m2/day by s.c. injection and continued on days 128, 3342, 4756, 6170, and 7584 of therapy. Beginning on day 29, 3-day sequences of s.c., escalating intermediate-dose pulse IL-2 were administered on days 2931 (6 x 106 IU/m2/day), days 4345 (9 x 106 IU/m2/day), and days 5759, 7173, and 8587 (12 x 106 IU/m2/day). Patients did not receive IL-2 on days 32, 46, 60, and 74. Low-dose IL-2 was interrupted for 2 days if any grade 34 toxicity developed and then recommenced at 0.8 x 106 IU/m2/day. If grade 34 toxicity recurred, low-dose IL-2 was stopped again for 2 days and then recommenced at 0.6 x 106 IU/m2/day. Continued grade 34 toxicity resulted in discontinuation of IL-2. Similarly, intermediate-dose IL-2 therapy was interrupted for 2 days if grade 34 toxicity developed and was then recommenced with a dose reduction of 1.5 x 106 IU/m2/day. Intermediate-dose IL-2 therapy was again interrupted and recommenced with an additional 1.5 x 106 IU/m2/day dose reduction for recurrent toxicity. Intermediate-dose pulse IL-2 was discontinued if grade 34 toxicity recurred, although low-dose IL-2 therapy was continued. During therapy, patients received supportive care with acetaminophen and nonsteroidal anti-inflammatory drugs, and RBC and platelet transfusions as required.
|
Analysis of MICA, MICB, and ULBP Expression by Leukemic Blasts.
BM or PB samples were obtained from patients at diagnosis and from consenting healthy adult donors and cryopreserved in liquid nitrogen or used directly. Thawed samples were analyzed for mRNA expression of the NKG2D ligands MICA and MICB, the ULBP-1, ULBP-2, and ULBP-3, and RAE-1-like transcript 4 (RL4), a putative NKG2D ligand and fourth member of the ULBP family (GenBank accession no. AY054974). BM and PBMC were isolated by density centrifugation over a Ficoll-Hypaque (Sigma) gradient at 400 x g for 30 min. Two million mononuclear cells from PB and BM were each harvested for RNA at this point. In the case of cells obtained from healthy donors, the remaining mononuclear cells were enriched for CD34+ cells by magnetic separation (Milyeni Biotech), according to the manufacturers protocol. The purity of this population (
95%) was demonstrated by staining with anti-CD34-PE and visualization on a FACStar Plus cell sorter (Becton Dickinson). MCF7 and LNCaP cell lines were obtained from American Type Culture Collection (Manassas, VA) as positive controls. The HTB-148 cell line was generously provided by Dr. Stephan Tanner.
For reverse transcriptase-PCR, 12 million cells were harvested for RNA using RNeasy Mini Kit (Qiagen), according to the manufacturers protocol. Two µg of RNA were reverse transcribed to cDNA using 300 units of Moloney murine leukemia virus reverse transcriptase (Life Technologies, Inc.) with 20 pmol each of random hexamer and oligodeoxythymidylic acid primers. Approximately 200 ng of cDNA were used as template in PCR using 1.25 units of AmpliTaq DNA polymerase (Perkin-Elmer Applied Biosystems) on a GeneAmp PCR System 9700 instrument (Perkin-Elmer Applied Biosystems). All primer oligonucleotides were purchased from Sigma-Genosys. Primer sequences and cycling parameters for MICA and MICB were as published (31) . Primers for ULBP1, ULBP2, ULBP3, and RL4 were designed using PrimerSelect 4.0 (DNASTAR): ULBP1 (522-bp product) sense, 5'CCGCCAGCCCCGCCTTCCT3' and antisense, 5'CATCCCTGTTCTTCTCCCACTTCT3'; ULBP2 (478-bp product) sense, 5'GTCACAACGGCCTGGAAAGCACA3' and antisense, 5'TGAAGCAGGGGAGGATGATGAGGA3'; ULBP3 (454-bp product) sense, 5'CGGGCCGACGCTCACTCT3' and antisense, 5'GTCCGCTATCCTTCTCCCACTTCT3'; and RL4 (465-bp product) sense, 5'GGAGAAGTGGGGCGAGACCT3' and antisense 5'TTGCCACCAGACACAGATGAGAA3'. Amplification was performed for 35 cycles (30 s at 95°C, 30 s at 60°C, and 45 s at 72°C), followed by 7-min extension step at 72°C. PCR products were separated on 0.8% agarose gels and visualized with ethidium bromide.
Statistical Considerations.
Descriptive statistics were used to describe the baseline characteristics of patients enrolled into the IL-2 therapy component of the study. Toxicity was measured according to the CALBG-expanded common toxicity criteria. OS and DFS were assessed from the start of IL-2 therapy, and the survival distributions were estimated using standard statistical methodology (32)
.
| RESULTS |
|---|
|
|
|---|
|
Of those receiving low-dose IL-2 in combination with intermediate pulse dose therapy, 11 of the 18 eligible patients received all five of the planned intermediate pulse dose treatments. Four patients did not complete treatment, one because of leukemia relapse before the first pulse, two after the second pulse dose, and one after the third pulse dose. One patient received only four intermediate pulse dose IL-2 treatments in error. Pulse dose therapy was discontinued in two patients after the second and third pulses, respectively, because of grade 3 hematological toxicity (neutropenia and thrombocytopenia), although low-dose IL-2 was continued to completion. In the 11patients who completed all five IL-2 pulses, 3 patients required 2040% dose reduction of intermediate-dose IL-2.
Toxicity.
Side effects that occurred at least once in patients receiving low-dose IL-2 therapy and low-dose IL-2 with intermediate pulse dose therapy are depicted in Table 2
. In patients receiving low-dose IL-2, most toxicity was grade 1 or 2, consisting predominantly of fatigue, fever, injection site reactions with local pain, erythema or induration, nausea or vomiting, anemia, and thrombocytopenia. All were easily managed with simple supportive measures. Grade 3 or 4 toxicities were uncommon and were mostly hematological, with lymphopenia, neutropenia, anemia, and thrombocytopenia. Although 4 patients required dose reductions for grade 3 or 4 toxicities, only 2 patients discontinued therapy because of nonhematological toxicity (grade
3 fatigue in both instances). All grade 3 and 4 toxicity was rapidly reversible on discontinuation of IL-2.
|
3 neutropenia and thrombocytopenia, which occurred during preceding low-dose IL-2 treatment. Therefore, although overall toxicity was at least twice as common in the intermediate-dose pulse IL-2 therapy cohort, it was easily managed with simple supportive therapy. Importantly, no deaths were attributable to either low-dose or intermediate pulse dose therapy.
Functional Activity of IL-2-expanded NK Cells.
A subset of patients was examined for the ability of the intermediate-dose bolus IL-2 to activate the expanded NK cells in vivo. Patient PBMCs were collected both immediately before and 24 h after receiving their intermediate dose IL-2 bolus and tested for their ability to lyse NK-resistant COLO 205 target cells. All 4 patients tested demonstrated similar significant (P < 0.05) in vivo increases in cytotoxicity against NK-resistant tumor targets, whereas having similar NK cell percentages both before and 24 h after the IL-2 bolus (Fig. 2)
. As the percentage of NK cells present at both time points was very similar, these data provide direct evidence in support of in vivo lymphokine-activated killing.
|
|
|
| DISCUSSION |
|---|
|
|
|---|
60 years is known to be less tolerant of therapy and to have a poor outcome (36)
. To our knowledge, a study assessing the safety of IL-2 in elderly AML patients after achievement of CR has not been reported.
Our results indicate that IL-2 administration after intensive induction and consolidation is well tolerated by patients with AML ages
60 years. Whereas the majority of patients experienced toxicity, this was mild in most instances and easily managed with simple supportive measures. The addition of pulses of intermediate-dose IL-2 to the low-dose regimen to activate the in vivo-expanded NK cells increased the frequency and severity of nonhematological and hematological toxicity, although this was reversible and manageable. No life-threatening events occurred during either prolonged low-dose IL-2 therapy or intermediate pulse dose therapy. Fatigue and malaise, almost entirely grade 12, were the most common side effects experienced by almost all patients. In only 2 patients receiving low-dose IL-2 only, the severity of fatigue was sufficient to remove the patients from study. Other side effects did not prevent any patient from continuing therapy. However, hematological toxicity, particularly anemia and thrombocytopenia, was significant with each occurring in >70% of patients receiving either low-dose IL-2 only or low-dose IL-2 with intermediate pulse dose therapy. Neutropenia was less frequent. Although myelosuppression was more common than previously reported in less extensively pretreated patients (37)
, it was mostly mild and rapidly reversible on interruption or attenuation of IL-2 therapy. Indeed, grade 34 neutropenia and thrombocytopenia resulted in the discontinuation of therapy in only 2 patients, both in the intermediate pulse dose cohort. The increased frequency of myelosuppression may be related to decreased marrow reserve because of recent intensive induction and consolidation chemotherapy and/or the older age of our patients. Otherwise, the toxicity profile was similar to that seen in a younger group of metastatic cancer patients treated with the same low-dose IL-2 and intermediate pulse dose IL-2 regimen (37)
.
There are very few reports of IL-2 postremission therapy in AML patients, and the reported doses and schedules of IL-2 have varied. Cortes et al. (38)
recently reported their experience with a low-dose IL-2 schedule of 4.5 x 105 unit/m2/day by continuous i.v. infusion for 12 weeks, with weekly bolus injection of 1 x 106 units/m2 IL-2 starting on day 8. This schedule resulted in similar toxicity to that seen our study, with fever, chills, local skin reactions, and thrombocytopenia being the most common side effects. Unlike these investigators, however, we found more severe anemia and lymphopenia, which may be attributable to the higher doses of IL-2 used in our study. However, despite the lower doses of IL-2 used and the younger median age of patients treated, 7 of 18 patients required interruption of IL-2 therapy in the study by Cortes et al. (38)
. The low-dose IL-2 schedules used by these investigators (38)
and by us, however, have been much better tolerated than higher dose schedules used in other studies where hemodynamic and metabolic complications have been severe. For example, McDonald et al. (39)
treated 9 AML patients in first CR with high-dose (3 x 106 units/m2/day) IL-2 given for 545 days intermittently. The schedule was poorly tolerated, with a mean tolerated dose of 57% of the planned dose. In 14 patients ages
55 years with relapsed AML, treatment with repeated 5-day cycles of escalating high-dose IL-2 (up to 18 x 106 units/m2/day) followed by maintenance therapy with 4 x 106 units/m2/day of IL-2 was associated with marked toxicity (20)
. Hypotension, fever, and vomiting of grade
3 occurred in 90% of patients, and grade
3 oliguria was seen in all patients. In addition, 43% of patients developed documented infections during high-dose IL-2 therapy (20)
. Similarly, in a Phase II study of high-dose IL-2 (1624 x 106 units/m2/day) in patients with relapsed leukemia, significant toxicity was observed (21)
. Grade 4 thrombocytopenia was seen in 84% of patients, and in 10 of 49 patients treated, hemodynamic and metabolic toxicities led to discontinuation of treatment.
In this study, we initially used a low maintenance dose of IL-2 of 1 x 106 units/m2/day given by s.c. injection for 90 days. This was based on demonstration by Caligiuri et al. (40)
in a Phase I study of IL-2 therapy in patients with advanced malignancy that the maximum-tolerated dose of IL-2 was 1.25 x 106 units/m2/day. At this dose, serum IL-2 concentrations between 10100 pmol are achieved, which are sufficient to saturate high-affinity IL-2 receptors found on a normally small population (
10%) of circulating NK cells (CD56bright CD16dim). Saturation of high-affinity IL-2 receptors by low-dose IL-2 resulted in the in vivo selective expansion of CD56bright CD16dim NK cells (23, 24, 25
, 40)
. However, these expanded NK cells are not activated and required higher concentrations of IL-2 to activate intermediate-affinity IL-2 receptors to lyse NK-resistant tumor cells (23)
. Therefore, our protocol was modified to incorporate intermediate pulse dose IL-2 therapy to achieve in vivo IL-2 levels that could engage a significant proportion of intermediate-affinity receptors on the expanded NK cell population to augment their cytotoxicity. In a previous study of patients with advanced cancer, this regimen resulted in significant total CD56+ NK cell (796 ± 210%) and CD56bright cell (3247 ± 1382%) expansion with low-dose IL-2 treatment (26)
. With intermediate-dose pulsing, serum IL-2 levels exceeded 100 pmol with in vivo activation of the expanded cells as evidenced by significantly higher IFN-
production by PBMC after pulse (26)
. In addition, as we have demonstrated in 4 patients in this study, fresh PBMC isolated after intermediate-dose pulse therapy showed significantly higher cytolytic activity against the NK-resistant COLO 205 tumor target, compared with prepulse PBMC, while having a similar percentage of CD56+ NK cells.
The efficacy of the IL-2 regimens used in our study in prolonging remission or preventing relapse in patients with AML is currently unknown. In the study by Cortes et al. (38) , who used a similar approach in AML patients in first CR, a comparison of CR duration and survival of IL-2 treated with that of historical controls not treated with IL-2 suggested a benefit from IL-2 therapy. However, this result must be interpreted with caution given the inherent limitations associated with comparison to historical controls, and definitive conclusions await the results of ongoing randomized studies.
An interesting finding in our study is the demonstration of transcripts for several NKG2D ligands, MICA and ULBP-1 and 2, in primary leukemic blasts but not in normal BM-purified CD34+ cells or PBMC. High MICA and MICB expression has been demonstrated by many human epithelial tumors (31 , 41) and more recently on the JA3 and Raji leukemic cell lines (31) , although expression by primary myeloid leukemic blasts had not been reported. Our results show that MICA and MICB expression is also seen in blasts from a proportion of primary human AMLs and is not restricted only to primary human epithelial tumors. A limitation of our finding is that surface expression of these ligands was not studied. However, the presence of 54 MICA and 16 MICB alleles makes study of these molecules on the cell surface by monoclonal antibodies difficult because it is not currently known to what extent the currently available antibodies can detect all these alleles. In contrast to the MIC molecules, transcripts of the ULBP were more frequently expressed, with all our AML cases expressing at least ULBP-3. As with the MIC ligands, surface expression of ULBPs could not be assured from detection of their transcripts. Indeed, in one study, tissue expression of ULBP mRNA did not always correlate with surface expression as detected by monoclonal antibodies, suggesting that surface expression of the ULBPs may be regulated at a posttranscriptional level (14) . Furthermore, as MICB and ULBP-3 transcripts were found in samples of normal blood, BM, and CD34+ enriched cells, we cannot exclude the possibility that their demonstration in our AML cases may be because of contaminating nonleukemic cells. Therefore, further study of activating ligand expression on the surface of leukemic cells as monoclonal antibody reagents become available is required. The observation that transcripts of some of the activating ligands (MICB and ULBP-3) is also expressed in normal blood and BM cells suggests the possibility that these ligands may not be as important as MICA, ULBP-1 and ULBP-2, and RL4 for the recognition and selective killing of leukemic cells by autologous NK cells. Such a difference may be related to potential differences in the affinity of different ligands to NKG2D. Alternatively, the selective killing of leukemic cells by autologous NK cells may be explained by a dissociation between mRNA expression and surface expression of ligand in normal cells, such that while normal cells express MICB and ULBP-3 mRNA, surface expression may be low or lacking. This requires additional investigation and is currently being studied by our group. Indeed, elucidation of the relative importance of the different activating ligands in triggering NK cells is relevant because AML blasts have recently been demonstrated to express normal levels of MHC class I molecules (42) , which could be expected to engage inhibitory receptors on autologous NK cells. The study of the relevance of activating ligand surface expression may assist in the selection of AML cases that have high ligand expression and, therefore, may be most suitable for IL-2-based therapy.
In conclusion, our study has demonstrated that IL-2 postremission therapy, particularly low-dose IL-2 to expand NK cells, with intermittent high-dose bolus therapy to activate these expanded cells, is well tolerated in elderly AML patients. The efficacy of this regimen is currently being tested in a randomized study of patients
60 years in first CR (CALBG 9720).
| FOOTNOTES |
|---|
1 This work was supported by, in part, by National Cancer Institute Grants to the Cancer and Leukemia Group B: CA77658, CA33601, CA31946, CA 16038, CA31983, CA04457, CA41287, CA47545, and Coleman Leukemia Research Foundation. ![]()
2 To whom requests for reprints should be addressed, at Division of Hematology and Oncology, The Ohio State University, A433A Starling Loving Hall, 320 West 10th Avenue, Columbus, OH 43210. Phone: (614) 293-7638; Fax: (614) 293-6690. ![]()
3 The abbreviations used are: AML, acute myeloid leukemia; DFS, disease-free survival; OS, overall survival; CR, complete remission; CALGB, Cancer and Leukemia Group B; NK, natural killer; IL-2, interleukin 2; ULBP, FAB, French-American-British; UL-16 binding protein; PB, peripheral blood; PBMC, peripheral blood mononuclear cells BM, bone marrow; RL4, RAE-1-like transcript 4; RT-PCR, reverse transcriptase-polymerase chain reaction. ![]()
Received 4/ 4/02; revised 5/25/02; accepted 5/30/02.
| REFERENCES |
|---|
|
|
|---|
cells of MICA and MICB. Proc. Natl. Acad. Sci. USA, 96: 6879-6884, 1999.This article has been cited by other articles:
![]() |
M. A. Caligiuri Human natural killer cells Blood, August 1, 2008; 112(3): 461 - 469. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Strowig, F. Brilot, and C. Munz Noncytotoxic Functions of NK Cells: Direct Pathogen Restriction and Assistance to Adaptive Immunity J. Immunol., June 15, 2008; 180(12): 7785 - 7791. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. N. Kochenderfer, J. L. Simpson, C. D. Chien, and R. E. Gress Vaccination regimens incorporating CpG-containing oligodeoxynucleotides and IL-2 generate antigen-specific antitumor immunity from T-cell populations undergoing homeostatic peripheral expansion after BMT Blood, July 1, 2007; 110(1): 450 - 460. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Markasz, G. Stuber, B. Vanherberghen, E. Flaberg, E. Olah, E. Carbone, S. Eksborg, E. Klein, H. Skribek, and L. Szekely Effect of frequently used chemotherapeutic drugs on the cytotoxic activity of human natural killer cells Mol. Cancer Ther., February 1, 2007; 6(2): 644 - 654. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Hanaoka, T. Kawaguchi, K. Horikawa, S. Nagakura, H. Mitsuya, and H. Nakakuma Immunoselection by natural killer cells of PIGA mutant cells missing stress-inducible ULBP Blood, February 1, 2006; 107(3): 1184 - 1191. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Nowbakht, M.-C. S. Ionescu, A. Rohner, C. P. Kalberer, E. Rossy, L. Mori, D. Cosman, G. De Libero, and A. Wodnar-Filipowicz Ligands for natural killer cell-activating receptors are expressed upon the maturation of normal myelomonocytic cells but at low levels in acute myeloid leukemias Blood, May 1, 2005; 105(9): 3615 - 3622. [Abstract] [Full Text] [PDF] |
||||
![]() |
A Hartkamp, R Geenen, M Bijl, A A Kruize, G L R Godaert, and R H W M Derksen Serum cytokine levels related to multiple dimensions of fatigue in patients with primary Sjogren's syndrome Ann Rheum Dis, October 1, 2004; 63(10): 1335 - 1337. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Sekeres, B. Peterson, R. K. Dodge, R. J. Mayer, J. O. Moore, E. J. Lee, J. Kolitz, M. R. Baer, C. A. Schiffer, A. J. Carroll, et al. Differences in prognostic factors and outcomes in African Americans and whites with acute myeloid leukemia Blood, June 1, 2004; 103(11): 4036 - 4042. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. R. Salih, H. Antropius, F. Gieseke, S. Z. Lutz, L. Kanz, H.-G. Rammensee, and A. Steinle Functional expression and release of ligands for the activating immunoreceptor NKG2D in leukemia Blood, August 15, 2003; 102(4): 1389 - 1396. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH |