Clinical Cancer Research Molecular Diagnostics in Cancer Therapeutic Development: Fulfilling the Promise of Personalized Medicine Infection and Cancer: Biology, Therapeutics, and Prevention
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fujioka, S.
Right arrow Articles by Chiao, P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fujioka, S.
Right arrow Articles by Chiao, P. J.
Clinical Cancer Research Vol. 9, 346-354, January 2003
© 2003 American Association for Cancer Research

Experimental Therapeutics, Preclinical Pharmacology

Function of Nuclear Factor {kappa}B in Pancreatic Cancer Metastasis1

Shuichi Fujioka, Guido M. Sclabas, Christian Schmidt, Wayne A. Frederick, Qiang G. Dong, James L. Abbruzzese, Douglas B. Evans, Cheryl Baker and Paul J. Chiao2

Departments of Surgical Oncology [S. F., G. M. S., C. S., W. A. F., Q. G. D., D. B. E., P. J. C.], Gastrointestinal Medical Oncology [J. L. A.], Molecular and Cellular Oncology [P. J. C.], and Cancer Biology [C. B.], The University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030


   ABSTRACT
Top
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Purpose: We seek to elucidate the role of constitutive nuclear factor {kappa}B (NF{kappa}B) activity in human pancreatic cancer cells. We have demonstrated that the transcription factor NF{kappa}B is activated constitutively in human pancreatic adenocarcinoma and human pancreatic cancer cell lines but not in normal pancreatic tissues or in immortalized/nontumorigenic pancreatic epithelial cells, suggesting that NF{kappa}B plays a critical role in development of pancreatic adenocarcinoma.

Experimental Design: By pooling all of the puromycin resistant clones after inhibitor of nuclear factor-{kappa}B phosphorylation mutant (I{kappa}B{alpha}M) retroviral infection, we generated pancreatic tumor cell lines that express a I{kappa}B{alpha}M (S32, 36A) that blocks NF{kappa}B activity. Inhibition of metastatic phenotype was assayed in an orthotopic nude mouse model. NF{kappa}B activity was determined by electrophoretic mobility shift assay, and the expression of NF{kappa}B downstream target genes was analyzed by Northern, Western, and immunohistochemical analyses.

Results: We showed that inhibiting constitutive NF{kappa}B activity by expressing I{kappa}B{alpha}M suppresses liver metastasis, but not tumorigenesis, from the metastatic human pancreatic tumor cell line AsPc-1 in an orthotopic nude mouse model. Furthermore, inhibiting NF{kappa}B activation by expressing I{kappa}B{alpha}M significantly reduced in vivo expression of a major proangiogenic molecule, vascular endothelial growth factor, and, hence, decreased neoplastic angiogenesis. Inhibiting NF{kappa}B activation by expressing I{kappa}B{alpha}M and using pharmacologic NF{kappa}B inhibitor PS-341 also significantly reduced cytokine-induced vascular endothelial growth factor and interleukin-8 expression in AsPc-1 pancreatic cancer cells.

Conclusion: These results demonstrated that the inhibition of NF{kappa}B signaling can suppress the angiogenic potential and metastasis of pancreatic cancer, and suggest that the NF{kappa}B signaling pathway is a potential target for anticancer agents.


   INTRODUCTION
Top
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
NF{kappa}B3 is a family of pleiotropic transcription factors that regulates the transcription of a many genes that play key roles in embryonic development, lymphoid differentiation, apoptosis, and immune and inflammatory responses (1, 2, 3) . Several reports suggest that the members of the NF{kappa}B and their inhibitor, the I{kappa}B families, are involved in the development of cancer (3, 4, 5) . For instance, c-rel, a member of the NF{kappa}B family, was first identified as a cellular homologue of the v-rel oncogene, suggesting that other members of the NF{kappa}B family are also oncogenes (4 , 5) . In addition, the genes encoding c-rel, bcl-3, p105(p50), and p100(p52) are located at sites of recurrent genomic rearrangements in cancer (6, 7, 8, 9, 10) . We first reported that RelA, the p65 subunit of NF{kappa}B, is constitutively activated in human pancreatic adenocarcinoma and human pancreatic cancer cell lines but not in normal pancreatic tissues or in immortalized/nontumorigenic pancreatic epithelial cells (11) . Furthermore, we found that overexpression of downstream target genes of NF{kappa}B that are important in cancer metastasis, such as urokinase plasminogen activator, are inhibited by ectopical expression of an I{kappa}B{alpha}M in these pancreatic cancer cell lines (12) . However, it was still not known whether inhibition of constitutive NF{kappa}B activity would suppress tumorigenic and metastatic phenotypes in pancreatic cancer cells.

It has been demonstrated recently that NF{kappa}B activation is obligatory for retinal angiogenesis; the administration of an NF{kappa}B inhibitor suppressed retinal neovascularization (13) . Other observations indicate that inhibition of NF{kappa}B activity by expressing I{kappa}B{alpha}M resulted in decreased expression of VEGF and IL-8, angiogenesis, invasion, tumorigenesis, and metastasis in an ovarian cancer cell line, but did not inhibit tumorigenesis in a prostate cancer cell line (14 , 15) . It is now well established that angiogenesis is essential for carcinogenesis, and the growth of both primary and metastatic tumors. Growth beyond 1–2 mm3 requires tumors to develop an adequate blood supply (16, 17, 18) . Angiogenesis, in turn, contributes to metastasis by facilitating the shedding of tumor cells into newly formed blood vessels (19) . Tumor angiogenesis is, in part, regulated by angiogenic factors that are produced and secreted by tumor cells. Several positive regulators of endothelial cells have been identified: VEGF and IL-8 are both involved in the process of new vessel formation. VEGF subunits, particularly of the two smaller isoforms (VEGF121 and 165), have little or no heparin-binding activity and induce their angiogenic effects by binding to the specific transmembrane tyrosine kinase receptors KDR/flk-1 and flt-1, which are expressed selectively on vascular endothelial cells, thus stimulating the growth of endothelial cells (20) . IL-8 was identified originally as potent activator and chemoattractant for neutrophils (21) . Subsequent studies have revealed that IL-8 triggers angiogenesis in vivo via mechanisms that are mediated by direct stimulation of endothelial cell growth or by indirect leukocyte-dependent effects (22 , 23) . Indeed, human recombinant IL-8 can induce proliferation and migration of human umbilical vein endothelial cells, and it can also stimulate vascularization in a rat cornea assay (24) .

Human pancreatic cancer has a very poor prognosis, even after curative resection, and is currently the fifth leading cause of cancer deaths in the United States (25) . The overall 5-year survival rate continues to be dismal, at 1–3% (26) . Most patients with pancreatic cancer have locally advanced, unresectable disease or metastasis at the time of diagnosis (27) . Currently, chemotherapy, radiation therapy, and surgery are largely ineffective in treating this disease (27) . To provide a better understanding of the function of constitutive NF{kappa}B activity in pancreatic cancer, we determined the role of NF{kappa}B in a metastatic pancreatic cancer cell line AsPc-1, using a mouse orthotopic pancreatic cancer model. We showed that constitutive NF{kappa}B activity plays a key role in the regulation of the proangiogenic factors, VEGF and IL-8, and in induction of metastasis. Our results suggest that blocking NF{kappa}B signaling cascades may provide a potential novel therapeutic strategy for pancreatic cancer.


   MATERIALS AND METHODS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture.
The human pancreatic adenocarcinoma cell lines AsPc-1, Panc-1, MiaPaCa-2, CaPan-1, MDAPanc-28, and AsPc-1 were obtained from American Type Culture Collection (Rockville, MD). All of the human pancreatic adenocarcinoma cell lines and murine embryonic fibroblast cells were cultured in DMEM (Life Technologies, Inc., Gaithersburg, MD) containing 10% fetal bovine serum, 100 units/ml penicillin (Life Technologies, Inc.), and 10 mg/ml streptomycin (Life Technologies, Inc.) in a 37°C incubator with 5% CO2.

Animals.
Female athymic BALB/c nude mice were purchased from Charles River Laboratories, Inc. (Wilmington, MA). One million viable AsPc-1 and AsPc-1/I{kappa}B{alpha}M cells suspended in 50 µl of PBS were injected into the pancreatic parenchyma of nude mice, being careful to avoid possible leakage of tumor cells from the injected site. Mice were housed in cabinets with laminar flow under specific pathogen-free conditions. Animals were maintained according to institutional regulations in facilities approved by the Association for the Assessment and Accreditation of Laboratory Animal Care in accordance with current regulations and standards of the United States Department of Agriculture, United States Department of Health and Human Services, and NIH. The animal protocol was approved by the Institutional Animal Care and Use Committee at The University of Texas M. D. Anderson Cancer Center. Mice were used in experiments once they reached 8 weeks of age.

Retroviral Infections of Human Pancreatic Cancer Cell Lines.
The CMV-Flag-I{kappa}B{alpha}M/puror retroviral vector was generated by replacing the XhoI-HindIII fragment of the pRetro-On/puror construct, which contains a TRE minCMV promoter and an rTTA sequence, with XhoI-BamHI fragment of CMV-Flag-I{kappa}B{alpha}M construct, which has mutations (S32, 36A) of the NH2 terminus and a COOH-terminal PEST sequence, which specifically inhibits phosphorylation of I{kappa}B{alpha} and subsequent NF{kappa}B activation. The CMV-I{kappa}B{alpha}M construct was provided by Dr. Inder M. Verma (Salk Institute, La Jolla, CA). The CMV-Flag-I{kappa}B{alpha}M/puror and pRetro-On/puror control retroviruses were generated, and infections were performed as described previously (28) . Pooled puromycin-resistant cells that express Flag-tagged I{kappa}B{alpha}M were used for subsequent analyses.

Reporter Gene Analysis.
One microgram of HIV-{kappa}B or VEGF reporter gene construct containing Firefly Luciferase was cotransfected into tumor cells with an internal control, p-TK Renilla Luciferase, using lipotransfection method (FuGENE 6; Roche, Indianapolis, IN) in triplicate. The HIV-{kappa}B reporter gene construct contains two HIV-{kappa}B enhancers, and the VEGF reporter gene construct contains 1.5 kb of VEGF promoter. The activity of both Firefly and Renilla Luciferase were determined 48 h after transfection using the Dual-Luciferase Reporter Assay System (Promega, Madison, WI).

EMSA.
EMS were performed using nuclear extracts as described previously (29) . Briefly, cells were stimulated with 10 ng/ml of TNF-{alpha} or 100 nM PS341 for various time intervals as indicated. Ten µg of nuclear extract in a 10-µl reaction volume containing 75 mM NaCl, 15 mM Tris-HCl (pH 7.5), 1.5 mM EDTA, 1.5 mM DTT, 25% glycerol, 20 mg/ml BSA, and 1 µg of poly(dI·dC) was incubated on ice for 40 min. Double-stranded oligodeoxyribonucleotide DNA probes (wild-type {kappa}B: 5'-AGTTGAGGGGACTTTCCCAGGC-3', mutant {kappa}B: 5'-AGTTGAGGCGACTTTCCCAGGC-3', and Oct-1: 5'-TGTCGAATGCAAATCACTAGAA-3'; Sigma, Woodlands, TX) were end-labeled and added to the reaction mixture, incubated at room temperature for 20 min, and applied to a 4% nondenatured polyacrylamide gel containing 0.25 x Tris-borate EDTA buffer [22.5 mM Tris, 22.5 mM borate, and 500 µM EDTA (pH 8.0)]. Equal loading of nuclear extracts was confirmed by determining Oct-1 DNA binding activity. For competition assays, a 100-fold molar excess of unlabeled oligonucleotides was added to the binding reaction. For supershift assay, 2 µl of polyclonal antibodies against p65 and p50 were added to the reaction mixture on ice 40 min before the probe was added. After electrophoresis, the gel was dried for 1 h at 80°C and exposed to Kodak X-ray film (Eastman Kodak Co., Rochester, NY) at -80°C.

Northern Blot Analysis.
For Northern blot analysis, total RNA was extracted using TRIZOL Reagent (Life Technologies, Inc.) according to the manufacturer’s protocol. Fifteen µg of RNA were electrophoresed on a 1% denaturing formaldehyde agarose gel, transferred to a nylon membrane using capillary blotting, and UV cross-linked. Reverse transcription-PCR was performed to obtain cDNA probe for Northern blot. In brief, 1 µg of total RNA extracted from MDAPanc-28 cells was incubated at 42°C for 1 h with 100 ng of oligo(dT)12–18 primer (Life Technologies, Inc.), 250 µM of deoxynucleotide triphosphate (Promega), 1x incubation buffer of avian myeloblastosis virus reverse transcriptase (Roche), 20 units of RNase inhibitor (Roche), and 25 units of avian myeloblastosis virus reverse transcriptase (Roche) in a final volume of 20 µl. The samples were then heated to 90°C for 5 min to terminate reaction. One µl of the cDNA reaction was then subjected to 30 PCR cycles (denaturing at 94°C for 1 min, annealing at 56°C for 1 min, and polymerization at 72°C for 1 min) using 250 µU of TaqDNA polymerase (Roche), 1x PCR reaction buffer (Roche), 250 µM deoxynucleotide triphosphate (Promega), and 500 nM specific primers (IL-8: 5'-primer, GGACCCCAAGGAAAACTGGG; 3'-primer, GCTGGCAATGACAAGACTGGG; VEGF: 5'-primer, GGCCTCCGAAACCATGAA; 3'-primer, TGGTGAGAGATCTGGTTCCC) in a final reaction volume of 50 µl. The PCR products were extracted and subsequently cloned into a pCR 2.1-TOPO vector (Invitrogen, Carlsbad, CA) for sequence analysis. The sequences of all of the cDNA fragments agreed with those obtained from GenBank. The cDNA probes (EcoRI-EcoRI) were labeled with [{alpha}-32P]dCTP (Amersham Pharmacia Biotech Inc., Piscataway, NJ) using a random primer labeling kit (Roche) and used for hybridization. Equal loading of mRNA samples was determined by rehybridizing the same membrane filter with a cDNA probe for GAPDH as described previously (29) .

Western Blot Analysis.
Western blot analysis of VEGF using whole cell protein extracts was performed as described previously (30) . Briefly, to determine the levels of VEGF in conditioned medium, cell-culture supernatants were centrifuged and concentrated. Then 50 µg of protein sample (per lane) was mixed with an equal volume of 2x sample buffer (31) , and samples were separated using 8% SDS-PAGE and then transferred onto a polyvinylidene difluoride membrane (Osmonics, Westborough, MA). The membrane was blocked with 5% nonfat milk in PBS containing 0.2% Tween 20 and incubated with a rabbit antibody against VEGF (Santa Cruz Biotechnology, Inc., Santa Cruz, CA). Membranes were washed in PBS containing 0.2% Tween 20 and probed with horseradish peroxidase-coupled secondary goat antirabbit antibodies (Amersham, Arlington Heights, IL). Proteins were detected using the Lumi-Light Western blotting substrate (Roche) according to the manufacturer’s instructions.

Immunohistochemical Staining.
Paraffin-embedded sections (for VEGF staining) and frozen sections (for CD-31 staining) were obtained from marginal regions of resected mouse pancreas, and the tumors derived from implanted AsPc-1 and AsPc-1/I{kappa}B{alpha}M human pancreatic cancer cell lines. The sections were processed for H&E and immunohistochemical stainings. A monoclonal anti-CD31 antibody (PharMingen, San Diego, CA; 1:50) and a rabbit polyclonal anti-VEGF antibody (Santa Cruz Biotechnology, Inc.; 1:500) were used in immunohistochemical studies. Briefly, paraffin-embedded sections were dewaxed in xylene, rehydrated using graded concentrations of alcohol, and treated with 0.5% hydrogen peroxide in methanol for 10 min to block endogenous peroxidase activity. Next, sections were washed three times with PBS for 5 min each time, and nonspecific reactions were blocked by incubating the sections in PBS containing 10% normal goat serum (for VEGF) or 10% normal rabbit serum (for CD-31) for 10 min at room temperature. Sections were then washed three times in PBS for 15 min each. Immune complexes were visualized using the LSAB2 system (Dako, Corp., Carpinteria, CA) and incubated with 0.5 mg/ml diaminobenzidine and 0.03% (v/v) H2O2 in PBS for 7 min. Sections were counterstained with hematoxylin and mounted. Mouse lung specimens known to have immunoreactivity for CD-31 were used as positive controls. Positive immunoreactivity for VEGF was determined by a reddish-brown precipitate in the cytoplasm. Blood vessel detected by antiCD-31 antibody were counted in the five areas of the tumor sections using a light microscope at low power (x40 and x100). The average count in each area was defined as the IMD, and individual IMDs were determined for 200 fields (equivalent to 0.74 mm2). As Weidner et al. (32) have described, neither a vessel lumen nor the presence of RBCs was required to identify a microvessel (32) .

Statistics.
Each experiment was performed independently at least twice with similar results each time; one representative result for each experiment was presented. The significance of the data was determined using the Student t test (two-tailed). A value of P < 0.05 indicates significance. All of the statistical analyses were performed using StatView 5.0 (Abacus Concepts Inc., Berkeley, CA).


   RESULTS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Inhibition of Constitutive NF{kappa}B Activity by I{kappa}B{alpha}M.
To determine the role of constitutive NF{kappa}B activity in tumorigenesis and metastasis, and in the regulation of the expression of proangiogenic molecules, we constructed a retroviral vector expressing Flag-tagged phosphorylation defective mutant of I{kappa}B{alpha} (S32, 36A; I{kappa}B{alpha}M). The human pancreatic tumor cell line AsPc-1 was infected with Flag-tagged I{kappa}B{alpha}M and a control retrovirus, and these cells were selected for resistance to puromycin (800 ng/ml). Nuclear extracts from pooled puromycin-resistant control AsPc-1 cells and AsPc-1 expressing I{kappa}B{alpha}M (AsPc-1/I{kappa}B{alpha}M) were prepared for EMSA. Constitutive RelA/NF{kappa}B activity is found in nuclear extracts from AsPc-1 cell lines (Fig. 1ACitation , Lane 1), consistent with our previous report that NF{kappa}B is activated constitutively in human pancreatic adenocarcinoma cells (11) . NF{kappa}B DNA binding activity is completely abolished in AsPc-1/I{kappa}B{alpha}M cells (Fig. 1A)Citation . Furthermore, the expression of I{kappa}B{alpha}M effectively inhibited the TNF-{alpha}-mediated NF{kappa}B activation in both cell lines (Fig. 1ACitation , Lanes 6–8). Competition and supershift assays showed the presence of RelA and p50 in the NF{kappa}B binding activity in AsPc-1 cells (Fig. 1B)Citation . Consistent with these results, {kappa}B-Luciferase reporter-gene assays showed that AsPc-1 cells have high level of constitutive NF{kappa}B reporter gene activity, and {kappa}B reporter gene assays also indicated an inhibitory effect of I{kappa}B{alpha}M on NF{kappa}B reporter gene activity (Fig. 1C)Citation . These results suggest that the expression of I{kappa}B{alpha}M inhibits the constitutive and TNF-{alpha}-mediated NF{kappa}B DNA-binding activities in pancreatic cancer cell line AsPc-1.



View larger version (43K):
[in this window]
[in a new window]
  		Fig. 1. Effect of I{kappa}B{alpha}M expression on constitutive and TNF-{alpha}-induced NF{kappa}B activity. A, EMSA of NF{kappa}B DNA binding activity in AsPc-1 and AsPc-1/I{kappa}B{alpha}M cells stimulated with TNF-{alpha} (10 ng/ml) for 5, 15, and 30 min, and nuclear extracts were subjected to NF{kappa}B EMSA. A probe containing the Oct-1 motif was used as a control for quality and quantity of cell extracts. B, specificity of the NF{kappa}B DNA-binding activity as determined by competition and supershift experiments in AsPc-1 cells stimulated with 10 ng/ml TNF-{alpha} for 30 min. Arrows indicate the migration of the induced NF{kappa}B DNA-binding complexes. Migration of the free probe is not shown. SS, supershifted band; NS, nonspecific band. C, NF{kappa}B reporter activity in AsPc-1 AsPc-1/I{kappa}B{alpha}M cells transiently transfected with a {kappa}B-Luciferase reporter gene. Fold-increases in Luciferase activity were calculated relative to the Luciferase activity of an internal control (p-TK Renilla Luciferase). Data represent the mean from three different experiments performed in triplicate; bars, ±SE.

 
Inhibition of Tumorigenesis and Metastasis by Blocking NF{kappa}B Activation.
To determine whether inhibition of NF{kappa}B can suppress tumorigenesis and metastasis, we performed an in vivo experiment using an orthotopic nude mouse model. Six weeks after injection of AsPc-1 and AsPc-1/I{kappa}B{alpha}M cells, all of the mice became sick and were sacrificed. Pathological examination was performed to determine the extent of tumor formation and metastasis. As shown in Fig. 2ACitation , 100% (10 of 10) of animals injected with AsPc-1 and AsPc-1/I{kappa}B{alpha}M cells presented pancreatic tumors. The mice injected with AsPc-1 cells displayed aggressive manifestation of cancer: 36% (4 of 11) had jaundice, 72% (8 of 11) had liver metastasis, 100% (11 of 11) had tumor formation in pancreas, 100% (11 of 11) had peritoneal metastasis, and 72% (8 of 11) had ascites accumulation (Fig. 2, B and C)Citation . However, the mice injected with AsPc-1/I{kappa}B{alpha}M cells revealed extinguished incidence of clinical manifestations: 0% (0 of 10) had jaundice, 0% (0 of 10) had liver metastasis, and 10% (1 of 10) had peritoneal metastasis and ascites formation (Fig. 2, B and C)Citation , although the weight of pancreatic tumors was not reduced in these mice as compared with control mice injected with AsPc-1 cells (Fig. 2D)Citation . Taken together, these results suggest that inhibition of constitutive RelA/NF{kappa}B activity suppresses the liver metastasis in an orthotropic pancreatic cancer model.



View larger version (60K):
[in this window]
[in a new window]
  		Fig. 2. I{kappa}B{alpha}M-mediated suppression of tumorigenicity and metastasis in an orthotopic nude mouse model. A, incidence of tumorigenesis, ascitic formation, jaundice, and liver or peritoneal metastasis. Six weeks after injection, all groups of mice were sacrificed, and the degree of tumorigenesis and metastasis were investigated. B, resected liver specimens from mice injected with AsPc-1 or AsPc-1/I{kappa}B{alpha}M cells. Large liver metastases are visible in specimens 1, 2, 4, and 5. C, manifestations of jaundice in mice injected with AsPc-1 cells. Specimens 1 and 2 demonstrate icteric skin indicating jaundice. Specimen 3 has ascites, and specimen 4, which was injected with AsPc-1/I{kappa}B{alpha}M cells, demonstrates only a pancreatic tumor. D, summary of the weights of tumors resected from mice injected with AsPc-1 and AsPc-1/I{kappa}B{alpha}M cells; bars, ±SE.

 
To determine whether inhibition of constitutive NF{kappa}B activity down-regulated the expression of NF{kappa}B target genes, we performed immunohistochemical staining to analyze the expression of VEGF and the extent of IMD in the pancreas and livers obtained from the mice injected with AsPc-1 and AsPc-1/I{kappa}B{alpha}M cells (Fig. 3, A and B)Citation . Consistent with the phenotypes of AsPc-1-derived tumors, much higher levels of VEGF expression were found in the tumors derived from AsPc-1 cells, and significantly higher IMDs as indicated by CD-31 immunostainings were detected in the adjacent pancreas tissues as compared with those tumors from the mice injected with AsPc-1/I{kappa}B{alpha}M cells (Fig. 3, A and B)Citation . These results suggest that levels of VEGF or the extent of vascularity might be proportional to the aggressiveness of these tumors, because the process of angiogenesis is essential for the growth of metastatic lesions. Our results have shown that inhibition of NF{kappa}B-inducible VEGF expression remarkably suppresses metastasis.



View larger version (54K):
[in this window]
[in a new window]
  		Fig. 3. Immunohistochemical staining of pancreatic tumors derived from orthotopically injected pancreatic cancer cells. A, anti-VEGF and anti-CD31 immunostaining of tissue sections from mouse pancreatic tumors derived from AsPc-1 and AsPc-1/I{kappa}B{alpha}M cells. B, IMDs of mouse pancreatic tumors derived from AsPc-1 and AsPc-1/I{kappa}B{alpha}M cells. CD-31-immunostained microvessels were counted using a light microscope and IMDs were determined. Data represent the mean; bars, ±SE.

 
Inhibition of VEGF Overexpression by I{kappa}B{alpha}M.
Among a variety of proangiogenic genes, VEGF is one of the potential downstream target genes regulated by NF{kappa}B (33 , 34) . To determine levels of VEGF expression in the different pancreatic cancer cell lines, we carried out Western blot analysis using cell culture supernatant collected from Panc-1, MiaPaCa-2, CaPan-1, MDAPanc-28, and AsPc-1 human pancreatic cancer cell lines, and from murine embryonic fibroblast cells, which served as a positive control. As shown in Fig. 4ACitation , proteins with molecular weights of Mr 23,000, 18,000, and 12–15,000 were detected in these cells, corresponding to VEGF165, VEGF121, and products of processed VEGF, respectively (35) . Interestingly, AsPc-1 cells produced a high level of VEGF, whereas Panc-1 cells express an undetectable level of VEGF. To determine the role of NF{kappa}B activity in the regulation of VEGF expression, we analyzed VEGF promoter activity using a plasmid containing a Luciferase gene regulated by the 1.5-kb VEGF promoter (VEGF-Luc). This reporter-gene construct was transiently transfected into AsPc-1 and AsPc-1/I{kappa}B{alpha}M cells. As shown in Fig. 4BCitation , the expression of I{kappa}B{alpha}M significantly reduced VEGF promoter-mediated transcriptional activity in both AsPc-1 cells. Moreover, consistent with the result obtained by reporter gene analysis, AsPc-1/I{kappa}B{alpha}M cells secreted significantly less VEGF protein into the culture supernatant than did control AsPc-1 cells (Fig. 4C)Citation . Taken together, these results suggest that inhibition of constitutive RelA/NF{kappa}B activity by using I{kappa}B{alpha}M resulted in the down-regulation of VEGF expression in AsPc-1 cells. Furthermore, our results suggest that the level of constitutive RelA/NF{kappa}B activity is associated with the level of VEGF expression, suggesting that RelA/NF{kappa}B regulates VEGF expression.



View larger version (37K):
[in this window]
[in a new window]
  		Fig. 4. Expression of VEGF in human pancreatic cancer cell lines. A, Western blot analysis of VEGF in the conditional medium (50 µg protein/lane) from indicated human pancreatic cell lines and mouse embryonic fibroblast cells using anti-VEGF antibody. B, VEGF-promoter reporter-gene activity in AsPc-1 and AsPc-1/I{kappa}B{alpha}M cells. Data represent the mean from three different experiments; bars, ±SE. C, Western blot analysis of VEGF secreted by AsPc-1 and AsPc-1/{kappa}B{alpha}M cells. The conditional medium were collected and analyzed (50 µg protein/lane) by Western blot analysis using anti-VEGF antibody.

 
Role of NF{kappa}B Activity on TNF-{alpha}-mediated Proangiogenic Gene Induction.
TNF-{alpha} has been suggested to play an important role in tumor angiogenesis and cancer progression (35, 36, 37, 38, 39, 40) ; therefore, we investigated the role of NF{kappa}B activity in regulating TNF-{alpha}-mediated VEGF and IL-8 expression. AsPc-1 and AsPc-1/I{kappa}B{alpha}M cells were stimulated with TNF-{alpha}, and total RNA was extracted from the cells at various time points. Northern blot analysis for VEGF and IL-8 were performed. As shown in Fig. 5ACitation , AsPc-1 cells constitutively expressed a detectable level of VEGF mRNA (Fig. 5Citation , Lane 1), which is in agreement with the high levels of VEGF protein secreted into culture medium (Fig. 4, A and C)Citation . In response to TNF-{alpha} stimulation, expression of VEGF was increased and peaked at 1 h in AsPc-1 cells (Fig. 5Citation , Lanes 2 and 3). This constitutive and TNF-{alpha}-induced VEGF mRNA expression was effectively inhibited by overexpression of I{kappa}B{alpha}M in AsPc-1 cells (Fig. 5Citation , Lanes 7–10), which were in accordance with results from previous EMSA analysis (Fig. 1A)Citation . AsPc-1 cells expressed undetectable level of IL-8 mRNA; however, TNF-{alpha} remarkably induced expression of IL-8 (Fig. 5Citation , Lanes 2–4). I{kappa}B{alpha}M effectively inhibited TNF-{alpha}-mediated IL-8 expression although a weak induction was still observed (Fig. 5Citation , Lanes 7–9). Taken together, these results indicate that TNF-{alpha}-mediated expression of VEGF and IL-8 is NF{kappa}B-dependent. However, induction of TNF-{alpha}-mediated IL-8 mRNA expression is only partially inhibited by I{kappa}B{alpha}M in AsPc-1 cells, implying the involvement of an alternative signal activation in IL-8 gene regulation.



View larger version (48K):
[in this window]
[in a new window]
  		Fig. 5. I{kappa}B{alpha}M-mediated inhibition of TNF-{alpha}-induced proangiogenic gene regulation. AsPc-1 and AsPc-1/I{kappa}B{alpha}M cells were stimulated with TNF-{alpha} as indicated, and expression of VEGF and IL-8 was determined by Northern blot analysis. GAPDH was used as a loading control.

 
Suppression of RelA/NF{kappa}B Activity and VEGF Expression by the Proteasome Inhibitor PS-341.
Our results indicated that specific NF{kappa}B inhibition by I{kappa}B{alpha}M remarkably attenuated VEGF expression. To support these observations, we used the pharmacological NF{kappa}B proteasome inhibitor PS-341 to block activation of NF{kappa}B, as proteasome-mediated degradation of phosphorylated I{kappa}B{alpha} is required for NF{kappa}B activation (1, 2, 3) . AsPc-1 cells were pretreated with 100 nM of PS-341 for 2 h and then stimulated with 10 ng/ml TNF-{alpha} for 30 min. Nuclear extracts were prepared, and NF{kappa}B DNA binding activity was determined by EMSA. Both constitutive and TNF-{alpha}-inducible NF{kappa}B DNA binding activities were remarkably inhibited by PS-341 (Fig. 6ACitation , Lanes 2 and 4). Next, we investigated the effect of PS-341 on the expression of VEGF. Total RNA and whole cell extracts were prepared for Northern and Western blot analyses of VEGF, respectively. AsPc-1 and AsPc-1/I{kappa}B{alpha}M cells were pretreated with 100 nM of PS-341 followed by TNF-{alpha} (10 ng/ml) stimulation for various time intervals. Constitutive VEGF expression was down-regulated significantly by PS-341 (Fig. 6BCitation , Lanes 1 and 6). Moreover, TNF-{alpha}-inducible VEGF expression, observed in (Fig. 6BCitation , Lanes 2 and 3), was completely inhibited by PS-341. In PS-341-mediated down-regulation of VEGF expression, the level of VEGF protein was undetectable at 24 h, and this inhibitory effect lasted until 72 h (Fig. 6CCitation , Lanes 1–5). These results demonstrate that blocking of RelA/NF{kappa}B activity by PS-341 inhibits VEGF expression in AsPc-1 cells, suggesting that PS-341 is a potential antiangiogenesis agent for treating pancreatic cancer.



View larger version (66K):
[in this window]
[in a new window]
  		Fig. 6. Inhibition of RelA/p50 DNA binding activity and VEGF expression by proteasome inhibitor PS341. A, NF{kappa}B EMSA of nuclear extracts from AsPc-1 cells preincubated with 100 nM PS-341 for 24 h and followed by stimulation with TNF-{alpha} (10 ng/ml) for 0 min and 30 min. as indicated. A probe containing the Oct-1 motif was used as a control for quality and quantity of cell extract. Arrows indicate migration of DNA-binding complexes. NS, nonspecific band; FP, free probe. B, Northern blot analysis of the VEGF expression induced by TNF-{alpha} in AsPc-1 cells pretreated with PS-341 as indicated. GAPDH was used as a loading control. C, Western blot analysis of VEGF expression in AsPc-1 cells treated with PS-341 for various time points as indicated. ß-Actin was used as a loading control.

 

   DISCUSSION
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
In this study, we investigated the effect of blocking NF{kappa}B signaling on the tumorigenesis, metastasis, and angiogenesis of AsPc-1 human pancreatic cancer cell line. We inhibited constitutive NF{kappa}B activity by stable expression of a phosphorylation-defective I{kappa}B{alpha} mutant (S32, 36A). This inhibition effectively suppressed liver metastasis from the metastatic human pancreatic tumor cell line AsPc-1 in an orthotopic nude mouse model. Furthermore, ectopic expression of I{kappa}B{alpha}M significantly inhibited constitutive RelA/NF{kappa}B activity and expression of the major proangiogenic molecules VEGF and IL-8, hence decreasing neoplastic angiogenesis. Inhibition of NF{kappa}B signaling by ectopic expression of I{kappa}B{alpha}M or by using pharmacologic NF{kappa}B inhibitor PS-341 also significantly reduced TNF-{alpha}-induced VEGF and IL-8 expression in the AsPc-1/I{kappa}B{alpha}M pancreatic cancer cells. These results suggest that the blocking of NF{kappa}B signaling reduces angiogenic potential, tumorigenesis, and metastasis of pancreatic cancer.

The suppression of tumor aggressiveness represented as jaundice and metastatic formation in AsPc-1 cells that we found are consistent with the previous report that blocking of constitutive NF{kappa}B activity by overexpression of I{kappa}B{alpha}M decreases tumorigenicity and malignant ascites in an ovarian cancer model (14) . Expression of I{kappa}B{alpha}M also decreases tumor growth and regional lymph node metastasis in a prostate cancer model (15) . However, constitutive NF{kappa}B activation has not been reported in these tumors. Therefore, the activation of NF{kappa}B may be specific to these two tumor cell lines. Interestingly, the tumorigenicity of Panc-1, a well-differentiated pancreatic cancer cell line, was inhibited by the overexpression of IkB{alpha}M,4 whereas the tumorigenicity in this poorly differentiated and metastatic AsPc-1 cell was not suppressed by overexpression of I{kappa}B{alpha}M. We showed previously that Panc-1 expressed constitutively activated NF{kappa}B and retained wild-type Smad4/DPC4 gene (11 , 30) . Collectively, these results suggest that additional genetic alterations in AsPc-1 cells may preclude I{kappa}B{alpha}M-mediated tumor suppression observed in Panc-1 cells.

Our results provided evidence that blocking NF{kappa}B activity, which has been shown to be constitutive in 70% of pancreatic cancers, clearly decreases the clinical manifestation, such as jaundice, hepatic and peritoneal metastasis, and ascites accumulation, which all resembles the advanced clinical stages in patients with pancreatic cancer. These findings may provide therapeutic significance for inhibition of NF{kappa}B for patients with pancreatic cancer, because most of these patients die from metastatic disease to the lymph nodes, liver, lungs, or peritoneum. For these reasons, our results may provide a molecular basis for novel therapeutic strategies targeting NF{kappa}B activity in patients with metastatic pancreatic cancer.

Our results showed that AsPc-1 cells produce rapidly growing and highly vascularized tumors, accumulated ascites, and extensive liver and peritoneal metastasis. The inhibition of constitutive NF{kappa}B activity by using I{kappa}B{alpha}M resulted in a significant reduction of metastatic potential and clinical manifestation in AsPc-1 cells. Our findings suggest that the overexpression of VEGF may correlate with tumor aggressiveness, indicated by clinical manifestations such as jaundice, ascites accumulation, tumorigenesis, and liver metastasis in a mouse orthotopic pancreatic cancer model. These results are consistent with previous reports that VEGF is commonly overexpressed in human pancreatic cancers, and that this factor may contribute to the angiogenesis and metastasis in this disease (41 , 42) . Recent studies suggest that VEGF is the best validated target for antiangiogenesis therapies. Overwhelming genetic, mechanistic, and animal efficacy data show that blocking VEGF accomplished by using antisense VEGF or an anti-VEGF neutralizing antibody results in an inhibition of angiogenesis and tumor growth in pancreatic cancer (43 , 44) .

In the current study we also used the proteasome inhibitor PS-341, a dipeptidyl boronic acid that specifically inhibits the 26S proteasome, and, hence, blocked I{kappa}B protein degradation and subsequent NF{kappa}B activation (45 , 46) . PS-341 inhibited constitutive and TNF-{alpha}-induced RelA/NF{kappa}B activity, and suppressed VEGF expression. These results strongly indicate that NF{kappa}B inhibition blocks VEGF expression, which may provide therapeutic strategies, directly linking targeting NF{kappa}B inhibition with antiangiogenesis therapy in patients with pancreatic cancer. TNF-{alpha} has been reported to function as an angiogenic factor, inducing angiogenesis in the cornea and chorioallantoic membrane in vivo (36 , 37) . TNF-{alpha} activates NF{kappa}B and enhances several angiogenesis-promoting factors, such as basic fibroblast growth factor, IL-6, VEGF, and IL-8 (35) . Our results also revealed that TNF-{alpha} enhances NF{kappa}B DNA-binding activity with subsequent transactivation of major proangiogenic molecules, such as VEGF and IL-8, in pancreatic cancer cell lines. Furthermore, expression of I{kappa}B{alpha}M efficiently inhibited TNF-{alpha}-mediated NF{kappa}B activation and subsequent induction of VEGF and IL-8 expression. Yoshida et al. (35) demonstrated that TNF-{alpha} enhances production of IL-8 and VEGF in endothelial cells, and induces angiogenesis in rabbit corneas that are blocked by anti-IL-8 or anti-VEGF antibodies. Moreover, they have reported that NF{kappa}B antisense oligonucleotides block TNF-{alpha}-dependent induction of IL-8 and VEGF expression, and inhibit TNF-{alpha}-induced tubular morphogenesis in endothelial cells. Consistent with these reported data, our present study indicated that NF{kappa}B plays an important role in TNF-{alpha}-mediated transactivation of VEGF and IL-8 in pancreatic cancer cells. Our findings provide important implications for the therapeutic usefulness of NF{kappa}B inhibition to antiangiogenesis therapy in patients with pancreatic cancer.


   ACKNOWLEDGMENTS
 
We thank Dr. Inder M. Verma for generously providing the CMV-I{kappa}B{alpha}M and Dr. David McConkey for kindly providing PS-341. We also thank Kerry Wright and Pat Thomas for editorial assistance.


   FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported in part by Grants CA73675, CA78778, and CA 75517 from the National Cancer Institute, and a grant from the Lockton Fund for Pancreatic Cancer Research. W. A. F. is a recipient of the National Cancer Institute T32 Training Grant Fellowship G. M. S. is from Department of Visceral and Transplantion Surgery, Inselspital, University of Bern, Bern, Switzerland, and a recipient of a Fellowship of the Bern Cancer League (Switzerland). Back

2 To whom requests for reprints should be addressed, at Departments of Molecular and Cellular Oncology and Surgical Oncology, Box 107, The University of Texas M. D. Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, TX 77030. Phone: (713) 794-1030, Fax: (713) 794-4830, E-mail: pjchiao{at}notes.mdacc.tmc.edu Back

3 The abbreviations used are: NF{kappa}B, nuclear factor {kappa}B; CTL, control; CMV, cytomegalovirus; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; EMSA, electrophoretic mobility shift assay; IL, interleukin; TNF-{alpha}, tumor necrosis factor {alpha}; VEGF, vascular endothelial growth factor; I{kappa}B, inhibitor of nuclear factor-{kappa}B; I{kappa}B{alpha}M, inhibitor of nuclear factor-{kappa}B phosphorylation mutant; IMD, intratumoral microvessel density. Back

4 S. Fujioka G.M. Sclabas, C. Schmidt, J. Niu, W.A. Frederick, Q.G. Dong, J.A. Abbruzzese, D.B. Evans, C. Baker, and P.J. Chiao. Inhibition of constitutive NF-{kappa}B activity by I{kappa}-B{alpha} M suppresses tumorigenesis, submitted for publication. Back

Received 5/29/02; revised 8/13/02; accepted 8/20/02.


   REFERENCES
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Verma I. M., Stevenson J. K., Schwarz E. M., Antwerp D. V., Miyamoto S. Rel/NF-{kappa}B/I{kappa}B family: intimate tales of association and dissociation. Genes Dev., 9: 2723-2735, 1995.[Free Full Text]
  2. Baldwin A., Jr. The NF-{kappa}B and I{kappa}B proteins: new discoveries and insights. Annu. Rev. Immunol., 14: 694-681, 1996.
  3. Gilmore T. D., Koedood M., Piffat K. A., White D. Rel/NF-{kappa}B/I{kappa}B proteins and cancer. Oncogene, 14: 1367-1378, 1997.
  4. Moore B. E., Bose H. R. J. Expression of the v-rel oncogene in reticuloendotheliosis virus-transformed fibroblasts. Virology, 162: 377-387, 1988.[CrossRef][Medline]
  5. Sylla B. S., Temin H. M. Activation of oncogenicity of the c-rel proto-oncogene. Mol. Cell. Biol., 6: 4709-4716, 1986.[Abstract/Free Full Text]
  6. Kitajima I., Shinohara T., Bilakovics J. D. A. B., Xu X., Nerenberg M. Ablation of transplanted HTLV-I Tax-transformed tumors in mice by antisense inhibition of NF-{kappa}B. Science (Wash. DC), 258: 1792-1795, 1992.[Abstract/Free Full Text]
  7. Neri A., Chang C. C., Lombardi L., Salina M., Corradini P., Maiolo A. T., Chaganti R. S. K., Dalla-Favera R. B cell lymphoma-associated chromosomal translocation involves candidate oncogene lyt-10, homologous to NF-{kappa}B p50. Cell, 67: 1075-1087, 1991.[CrossRef][Medline]
  8. Ohno H., Takimoto G., McKeithan T. W. The candidate proto-oncogene bcl-3 is related to genes implicated in cell lineage determination and cell cycle control. Cell, 60: 991-997, 1990.[CrossRef][Medline]
  9. Lu D., Thompson J. D., Gorski G. K., Rice N. R., Mayer M. G., Yunis J. J. Alterations of the rel locus in human lymphoma. Oncogene, 6: 1235-1241, 1991.[Medline]
  10. Dejardin E., Bonizzi G., Bellahcene A., Castronovo V., Merville M. P., Bour V. Highly-expressed p100/p52 (NF-{kappa}B2) sequesters other NF-{kappa}B-related proteins in the cytoplasm of human breast cancer cells. Oncogene, 11: 1835-1841, 1995.[Medline]
  11. Wang W., Abbruzzese J. L., Evans D. B., Larry L., Cleary K. R., Chiao P. J. The nuclear factor-{kappa} B RelA transcription factor is constitutively activated in human pancreatic adenocarcinoma cells. Clin. Cancer Res., 5: 119-127, 1999.[Abstract/Free Full Text]
  12. Wang W., Abbruzzese J. L., Evans D. B., Chiao P. J. Overexpression of urokinase-type plasminogen activator in pancreatic adenocarcinoma is regulated by constitutively activated RelA. Oncogene, 18: 4554-4563, 1999.[CrossRef][Medline]
  13. Yoshida A., Yoshida S., Ishibashi T., Kuwano M., Inomata H. Suppression of retinal neovascularization by the NF-{kappa}B inhibitor pyrrolidine dithiocarbamate in mice. Investig. Ophthalmol. Vis. Sci., 40: 1624-1629, 1999.[Abstract/Free Full Text]
  14. Huang S., Robinson J. B., DeGuzman A., Bucana C. D., Fidler I. J. Blockage of nuclear factor-{kappa}B signaling inhibits angiogenesis and tumorigenicity of human ovarian cancer cells by suppressing expression of vascular endothelial growth factor and interleukin 8. Cancer Res., 60: 5334-5339, 2000.[Abstract/Free Full Text]
  15. Huang S., Pettaway C. A., Uehara H., Bucana C. D., Fidler I. J. Blockage of NF-{kappa}B activity in human prostate cancer is associated with suppression of angiogenesis, invasion, and metastasis. Oncogene, 20: 4188-4197, 2001.[CrossRef][Medline]
  16. Folkman J., Watson K., Ingber D., Hanahan D. Induction of angiogenesis during the transition from hyperplasia to neoplasia. Nature (Lond.), 339: 58-61, 1989.[CrossRef][Medline]
  17. Folkman J. What is the evidence that tumors are angiogenesis dependent?. J. Natl. Cancer Inst., 82: 4-6, 1990.[Free Full Text]
  18. Folkman J. The role of angiogenesis in tumor growth. Semin. Cancer Biol., 3: 65-71, 1992.[Medline]
  19. Liotta L. A., Steeg P. S., Stetlet-Stevenson W. G. Cancer metastasis and angiogenesis: an imbalance of positive and negative regulation. Cell, 64: 327-336, 1991.[CrossRef][Medline]
  20. Ferrara N. The role of vascular endothelial growth factor in pathological angiogenesis. Breast Cancer Res. Treat., 36: 127-137, 1995.[CrossRef][Medline]
  21. Yoshimura T., Matsushima K., Oppenheim J. J., Leonard E. J. Neutrophil chemotactic factor produced by lipopolysaccharide (LPS)-stimulated human blood mononuclear leukocytes: partial characterization and separation from interleukin 1 (IL-1). J. Immunol., 139: 788-793, 1987.[Abstract]
  22. Koch A. E., Polverini P. J., Kunkel S. L., Harlow L. A., DiPietro L. A., Elner V. M., Elner S. G., Strieter R. M. Interleukin-8 as a macrophage-derived mediator of angiogenesis. Science (Wash. DC), 258: 1798-1801, 1992.[Abstract/Free Full Text]
  23. Hu D. E., Hori Y., Fan T. P. Interleukin-8 stimulates angiogenesis in rats. Inflammation, 17: 135-143, 1993.[CrossRef][Medline]
  24. Strieter R. M., Kunkel S. L., Elner V. M., Martonyi C. L., Koch A. E., Polverini P. J., Elner S. G. Interleukin-8: a corneal factor that induces neovascularization. Am. J. Pathol., 141: 1279-1284, 1992.[Abstract]
  25. Nitecki S. S., Sarr M. G., Colby T. V., van Heerden J. A. Long-term survival after resection for ductal adenocarcinoma of the pancreas. Is it really improving?. Ann. Surg., 221: 59-66, 1995.[Medline]
  26. Bramhall S. R., Allum W. H., Jones A. G., Allwood A., Cummins C., Neoptolemos J. P. Treatment and survival in 13, 560 patients with pancreatic cancer, and incidence of the disease, in the West Midlands: an epidemiological study. Br. J. Surg., 82: 111-115, 1995.[Medline]
  27. Breslin T. M., Hess K. R., Harbison D. B., Jean M. E., Cleary K. R., Dackiw A. P., Wolff R. A., Abbruzzese J. L., Janjan N. A., Crane C. H., Vauthey J. N., Lee J. E., Pisters P. W., Evans D. B. Neoadjuvant chemoradiotherapy for adenocarcinoma of the pancreas: treatment variables and survival duration. Ann. Surg. Oncol., 8: 123-132, 2001.[Abstract/Free Full Text]
  28. Naviaux R. K., Costanzi E., Haas M., Verma I. M. The pCL vector system: rapid production of helper-free, high-titer, recombinant retroviruses. J. Virol., 70: 5701-5705, 1996.[Abstract/Free Full Text]
  29. Chiao P. J., Miyamoto S., Verma I. M. Autoregulation of I{kappa}B{alpha} activity. Proc. Natl. Acad. Sci. USA, 91: 28-32, 1994.[Abstract/Free Full Text]
  30. Grau A. M., Zhang L., Wang W., Ruan S., Evans D. B., Abbruzzese L. L., Zhang W., Chiao P. J. Induction of p21waf1 expression and growth inhibition by transforming growth factor ß involve the tumor suppressor gene DPC4 in human pancreatic adenocarcinoma cells. Cancer Res., 57: 3929-3934, 1997.[Abstract/Free Full Text]
  31. Laemmli U. K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (Lond.), 227: 680-685, 1970.[CrossRef][Medline]
  32. Weidner N., Folkman J., Pozza F., Bevilacqua P., Allred E. N., Moore D. H., Meli S., Gasparini G. Tumor angiogenesis: a new significant and independent prognostic indicator in early-stage breast carcinoma. J. Natl. Cancer Inst., 84: 1875-1887, 1992.[Abstract/Free Full Text]
  33. Roebuck K. A. Regulation of interleukin-8 gene expression. J. Interferon Cytokine Res., 19: 429-438, 1999.[CrossRef][Medline]
  34. Frater-Schroder M., Risau W., Hallmann R., Gautschi P., Bohlen P. Tumor necrosis factor type {alpha}, a potent inhibitor of endothelial cell growth in vitro, is angiogenic in vivo. Proc. Natl. Acad. Sci. USA, 84: 5277-5281, 1987.[Abstract/Free Full Text]
  35. Yoshida S., Ono M., Shono T., Izumi H., Ishibashi T., Suzuki H., Kuwano M. Involvement of interleukin-8, vascular endothelial growth factor, and basic fibroblast growth factor in tumor necrosis factor {alpha}-dependent angiogenesis. Mol. Cell. Biol., 17: 4015-4023, 1997.[Abstract]
  36. Leibovich S. J., Polverini P. J., Shepard H. M., Wiseman D. M., Shively V., Nuseir N. Macrophage-induced angiogenesis is mediated by tumour necrosis factor-{alpha}. Nature (Lond.), 329: 630-632, 1987.[CrossRef][Medline]
  37. Passaniti A., Taylor R. M., Pill R., Guo Y., Long P. V., Haney J. A., Pauly R. R., Grant D. S., Martin G. R. A simple, quantitative method for assessing angiogenesis and antiangiogenic agents using reconstituted basement membrane, heparin, and fibroblast growth factor. Lab. Investig., 67: 519-528, 1992.[Medline]
  38. Shono T., Ono M., Izumi H., Jimi S., Matsushima K., Okamoto T., Kohno K., Kuwano M. Involvement of the transcription factor NF-{kappa}B in tubular morphogenesis of human microvascular endothelial cells by oxidative stress. Mol. Cell. Biol., 16: 4231-4239, 1996.[Abstract]
  39. Leek R. D., Lewis C. E., Whitehouse R., Greenall M., Clarke J., Harris A. L. Association of macrophage infiltration with angiogenesis and prognosis in invasive breast carcinoma. Cancer Res., 56: 4625-4629, 1996.[Abstract/Free Full Text]
  40. Yancopoulos G. D., Davis S., Gale N. W., Rudge J. S., Wiegand S. J., Holash J. Vascular-specific growth factors and blood vessel formation. Nature (Lond.), 407: 242-248, 2000.[CrossRef][Medline]
  41. Tang R. F., Itakura J., Aikawa T., Matsuda K., Fujii H., Korc M., Matsumoto Y. Overexpression of lymphangiogenic growth factor VEGF-C in human pancreatic cancer. Pancreas, 3: 285-292, 2001.
  42. Itakura J., Ishiwata T., Friess H., Fujii H., Matsumoto Y., Buchler M. W., Korc M. Enhanced expression of vascular endothelial growth factor in human pancreatic cancer correlates with local disease progression. Clin. Cancer Res., 8: 1309-1316, 1997.
  43. Luo J., Guo P., Matsuda K., Truong N., Lee A., Chun C., Cheng S. Y., Korc M. Pancreatic cancer cell-derived vascular endothelial growth factor is biologically active in vitro and enhances tumorigenicity in vivo. Int. J. Cancer, 92: 361-369, 2001.[CrossRef][Medline]
  44. Tsuzuki Y., Carreira C. M., Bockhorn M., Xu L., Jain R. K., Fukumura D. Pancreas microenvironment promotes VEGF expression and tumor growth: novel window models for pancreatic tumor angiogenesis and microcirculation. Lab. Investig., 81: 1439-1451, 2001.[Medline]
  45. Grisham M. B., Palombella V. J., Elliott P. J., Conner E. M., Brand S., Wong H. L., Pien C., Mazzola L. M., Destree A., Parent L., Adams J. Inhibition of NF-{kappa} B activation in vitro and in vivo: role of 26S proteasome. Methods Enzymol., 300: 345-363, 1999.[Medline]
  46. Russo S. M., Tepper J. E., Baldwin A. S., Jr., Liu R., Adams J., Elliott P., Cusack J. C., Jr. Enhancement of radiosensitivity by proteasome inhibition: implications for a role of NF-{kappa}B. Int. J. Radiat. Oncol. Biol. Phys., 50: 183-193, 2001.[CrossRef][Medline]



This article has been cited by other articles:


Home page
 CarcinogenesisHome page
J. L. Williams, P. Ji, N. Ouyang, X. Liu, and B. Rigas
NO-donating aspirin inhibits the activation of NF-{kappa}B in human cancer cell lines and Min mice
Carcinogenesis, February 1, 2008; 29(2): 390 - 397.
[Abstract] [Full Text] [PDF]

Home page
 Exp. Biol. Med.Home page
G. Sethi, B. Sung, and B. B. Aggarwal
Nuclear Factor-{kappa}B Activation: From Bench to Bedside
Experimental Biology and Medicine, January 1, 2008; 233(1): 21 - 31.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
M. Wu, C. Min, X. Wang, Z. Yu, K. H. Kirsch, P. C. Trackman, and G. E. Sonenshein
Repression of BCL2 by the Tumor Suppressor Activity of the Lysyl Oxidase Propeptide Inhibits Transformed Phenotype of Lung and Pancreatic Cancer Cells
Cancer Res., July 1, 2007; 67(13): 6278 - 6285.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
A. B. Kunnumakkara, S. Guha, S. Krishnan, P. Diagaradjane, J. Gelovani, and B. B. Aggarwal
Curcumin Potentiates Antitumor Activity of Gemcitabine in an Orthotopic Model of Pancreatic Cancer through Suppression of Proliferation, Angiogenesis, and Inhibition of Nuclear Factor-{kappa}B-Regulated Gene Products
Cancer Res., April 15, 2007; 67(8): 3853 - 3861.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J. Niu, Z. Chang, B. Peng, Q. Xia, W. Lu, P. Huang, M.-S. Tsao, and P. J. Chiao
Keratinocyte Growth Factor/Fibroblast Growth Factor-7-regulated Cell Migration and Invasion through Activation of NF-{kappa}B Transcription Factors
J. Biol. Chem., March 2, 2007; 282(9): 6001 - 6011.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
Y. Kishida, H. Yoshikawa, and A. Myoui
Parthenolide, a Natural Inhibitor of Nuclear Factor-{kappa}B, Inhibits Lung Colonization of Murine Osteosarcoma Cells
Clin. Cancer Res., January 1, 2007; 13(1): 59 - 67.
[Abstract] [Full Text] [PDF]

Home page