Clinical Cancer Research The Future of Cancer Research: Science and Patient Impact Infection and Cancer: Biology, Therapeutics, and Prevention
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Goldsmith, M. E.
Right arrow Articles by Fojo, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Goldsmith, M. E.
Right arrow Articles by Fojo, T.
Clinical Cancer Research Vol. 9, 5394-5401, November 1, 2003
© 2003 American Association for Cancer Research

Experimental Therapeutics, Preclinical Pharmacology

The Histone Deacetylase Inhibitor FK228 Preferentially Enhances Adenovirus Transgene Expression in Malignant Cells

Merrill E. Goldsmith1, Masaki Kitazono1, Patrick Fok, Takashi Aikou, Susan Bates and Tito Fojo2

Cancer Therapeutics Branch, Center for Cancer Research, National Cancer Institute, NIH, Bethesda, Maryland [M. E. G., M. K., P. F., S. B., T. F.], and First Department of Surgery, Faculty of Medicine, Kagoshima University, Kagoshima, Japan [T. A.]


   ABSTRACT
Top
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Purpose: Efficient adenovirus infection requires coxsackie-adenovirus receptor (CAR) and {alpha}v integrin. Whereas many malignant cells express these proteins poorly, normal tissues, especially liver, express high levels and are susceptible to adenovirus infection. Our previous studies showed that treatment of cancer cell lines with low concentrations of the histone deacetylase inhibitor FK228 (FR901228, depsipeptide), a drug in Phase II clinical trials, before infection was associated with an increase in adenovirus transgene expression. The purpose of these studies was to analyze the effects of FK228 on cultured normal human cells before initiating animal studies.

Experimental Design: Cancer and normal cells from the corresponding tissue were treated with FK228 and analyzed for the proteins needed for infection and the infection efficiency.

Results: Treatment of cancer cell lines with 1 ng/ml FK228 increased CAR RNA, {alpha}v integrin RNA, and histone H3 acetylation levels, and was associated with a 4–10-fold increase in the number of infected cells expressing the transgene. Similar treatment of normal human mammary epithelial cells, renal proximal tubule epithelial cells, and hepatocytes had little effect. The insensitivity of cultured normal cells may be explained, in part, by expression of the drug efflux pump P-glycoprotein, because addition of the P-glycoprotein inhibitor XR9576 (tariquidar) with FK228 resulted in increased histone acetylation and CAR expression.

Conclusion: These studies suggest that low concentrations of FK228 preferentially increase the efficiency of adenoviral transgene expression in cancer cells compared with cultured normal cells from the corresponding tissue and may increase the efficiency of adenovirus therapies in vivo.


   INTRODUCTION
Top
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Adenovirus serotypes 2 and 5 require the presence of the CAR3 and the {alpha}v integrin component of integrins {alpha}vß1, {alpha}vß3, or {alpha}vß5 to infect cells efficiently (1, 2, 3, 4) . CAR mediates attachment of adenovirus to cells, and {alpha}v integrin mediates internalization of virus into cells. Several studies have reported correlations between CAR and {alpha}v integrin levels and adenovirus infection (5, 6, 7) . Low levels of CAR in tumors are thought to be one of the reasons for poor adenovirus infection (8 , 9) . To overcome this problem, different strategies have been used to alter adenovirus so that infection occurs through other mechanisms (10, 11, 12, 13) . An alternative approach is to increase CAR or {alpha}v integrin levels (14) . To be successful, such an approach must preferentially affect cancer cells. We have shown previously that the HDAC inhibitor FK228 (FR901228, depsipeptide), a drug currently in Phase II clinical trials for the treatment of patients with peripheral or cutaneous T-cell lymphoma, can increase both CAR and {alpha}v integrin levels in cancer cell lines (15, 16, 17, 18, 19) . This increase in proteins needed for adenovirus infection was associated with an increase in transgene expression from infecting adenovirus when the cells were treated with FK228 before but not during or after infection. In the present study we demonstrate that this increase in adenovirus transgene expression occurs preferentially in cancer cell lines. Low concentrations of FK228 that resulted in a marked increase in adenovirus transgene expression in cancer cell lines from breast, kidney, and liver had little effect on cultured normal cells from these tissues.


   MATERIALS AND METHODS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Drugs.
FK228, a fermentation product from Chromobacterium violaceum, was first isolated by the Fujisawa Company (15) . FK228 was obtained from the Pharmaceutical Management Branch, Cancer Therapy Evaluation Program, National Cancer Institute (Bethesda, MD). XR9576 (tariquidar) was obtained from Xenova Research (Berkshire, United Kingdom).

Cell Lines and Normal Human Cells.
Four human cancer cell lines were used: MCF7 (breast carcinoma; Ref. 20 ), A498 (renal cell carcinoma; Ref. 21 ), HepG2 (hepatocellular carcinoma; Ref. 22 ), and K562 (chronic myelogenous leukemia; Ref. 23 ). The cell lines were obtained from American Type Culture Collection (Manassas, VA) or from the Developmental Therapeutic Branch, National Cancer Institute (Frederick, MD). Normal human cells were obtained from Clonetics (Walkersville, MD). Media and culture conditions recommended by the supplier were used for the normal human mammary epithelial cells, renal proximal tubule cells, and hepatocytes. The hepatocytes were isolated from donor livers and plated on collagen by the supplier.

Adenovirus.
Ad5.CMV-LacZ (referred to as AdCMVßgal) and Ad5.CMV-GFP (AdCMVgfp) are E1 and E3 gene deleted replication-defective type 5 adenoviruses that were obtained from Qbiogene (Carlsbad, CA). Adenoviral vectors were grown in 293A cells and purified according to protocols provided by the manufacturer. The titer was determined using the TCID50 assay as described by the manufacturer.

Cytotoxicity Studies.
Cell lines were plated at 1500–2000 cells/well in 96-well plates. Normal cells were plated at 2400–3200 cells/well. FK228 was added the next day, and the plates were assayed after 4–5 days. The analysis was performed by the SRB assay for the normal and malignant breast and kidney cells, and by the MTT assay for the normal and malignant liver cells. The SRB and MTT assays gave similar results (24 , 25) .

Semiquantitative RT-PCR Analysis.
RNA was isolated, and semiquantitative RT-PCR was performed as described previously (17) . Primers used for analysis of human CAR (GenBank accession no. NM_001338; Ref. 1 ), {alpha}v integrin (NM_002210; Ref. 26 ), ß-actin (XM_004814), MDR1 (M14758; Ref. 27 ), and 28S rRNA (M11167; Ref. 28 ) were: CAR 5' (sense): 521GCCTTCAGGTGCGAGATGTTAC542; CAR 3' (antisense): 1152TCGCACCCATTCGACTTAGA1133; {alpha}v integrin 5' (sense): 1567TAAAGGCAGATGGCAAAGGAGT1588; {alpha}v integrin 3' (antisense): 2078CAGTGGAATGGAAACGATGAGC2057; ß-actin 5' (sense): 198TGGGCATGGGTCAGAAGGAT217; ß-actin 3' (antisense): 498GAGGCGTACAGGGATAGCAC479; MDR1 5' (sense): 834GCCTGGCAGCTGGAAGACAAATACACAAAATT865; MDR1 3' (antisense): 1119CAGACAGCAGCTGACAGTCCAAGAACAGGACT1088; 28S 5' (sense): 1542AAACTCTGGTGGAGGTCCGT1561; 28S 3' (antisense): 1847CTTACCAAAAGTGGCCCACTA1827; CAR2 5' (sense): 762GATCAGTGCCTGTTGCGTCTA782; and CAR2 3' (antisense): 1161TCACAGGAATCGCACCCA1144.

The experimental conditions were chosen based on preliminary experiments that indicated that all of the samples would be in the exponential range of amplification to allow for more precise quantitation. The amplification reactions were carried out for 30 cycles except where noted. Comparability of RNA quantities was assured using ß-actin or 28S rRNA as standards.

AdCMVßgal Transduction.
Cancer cell lines were plated at 10,000 cells/well in 24-well plates. Normal cells were plated at 15,000–20,000 cells/well. Cells were treated without or with 1 ng/ml FK228 for 48 h. Cells were washed and transferred to medium without FK228 and maintained in drug-free medium for the remainder of the experiment. Cells were infected with AdCMVßgal at a moi of 100 virus particles/cell (moi = 100) in medium without serum for 1 h, serum was added, and the cells were grown for 48 h. Adenovirus transgene expression was determined using the ß-Gal Staining kit (Invitrogen, Carlsbad, CA), and ßgal positive cells were counted from three nonoverlapping fields.

AdCMVgfp Transduction.
K562 cells were grown without or with various concentrations of FK228. The cells were plated in 24-well dishes at a density of 105 cells/well without serum or FK228 and infected for 60 min with AdCMVgfp at various moi. Medium with serum and FK228 was added, and the infected cells were grown for 24 h. Cells were analyzed by flow cytometry in a Becton-Dickinson FACSort with CELLQuest software. The fluorescence from gfp was determined in the live cell population as determined by propidium iodide staining. The results are the average of triplicate determinations and are plotted as percentage of gfp-positive cells in the live cell population.


   RESULTS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Previous studies from our laboratory indicated that treatment of cancer cells with the HDAC inhibitor FK228 resulted in increased expression of CAR and {alpha}v integrin (17) . This increase was associated with enhanced adenovirus transgene expression after virus infection. To determine whether FK228 might improve the efficiency of adenoviral therapies in vivo, we analyzed the effects on normal breast, liver, and kidney cells in short-term culture. Cytotoxicity studies were performed to determine the sensitivity of the cultured normal cells to FK228 after 4–5 days of exposure to drug. Normal liver and kidney cells with IC50 values >20 ng/ml were less sensitive than normal breast cells with an IC50 of 5 ng/ml. All three of the cultured normal cell types had IC50 values that were higher than the 1 ng/ml IC50 values of the three cancer cell lines used in these studies.

Next, we compared the induction of CAR and {alpha}v integrin in cultured normal cells with that found in cancer cells derived from the same tissue. Because of their higher drug tolerance, cultured normal cells were treated with 1–20 ng/ml FK228, whereas cancer cells were exposed to only 1 ng/ml FK228 for 48 h. We had previously determined this drug concentration to be a minimally cytotoxic dose that induced high levels of CAR and {alpha}v integrin RNA in the cancer cell lines used in this study. As shown in the top three panels of Fig. 1Citation , the basal levels of CAR and {alpha}v integrin RNA expression were low to undetectable in the cancer cell lines using semiquantitative RT-PCR analysis. By comparison the levels in the cultured normal cells were considerably higher than those found in our cell lines. Treatment with 1 ng/ml FK228 increased CAR expression in cancer cell lines to levels higher than those found in the cultured normal cells treated with this same drug concentration. Induction of CAR in the cultured normal cells was observed only at 10 and 20 ng/ml FK228, and even at these concentrations the increase in CAR was only ~2-fold. Similarly, treatment of cancer cell lines with 1 ng/ml FK228 raised the levels of {alpha}v integrin from undetectable to levels similar to those found in untreated cultured normal cells, whereas treatment of cultured normal cells had little effect. These results suggest that treatment of cancer cells and cultured normal cells with 1 ng/ml FK228 preferentially increased the levels of proteins required for adenovirus infection in the cancer cell lines.



View larger version (62K):
[in this window]
[in a new window]
  		Fig. 1. Analysis of CAR and {alpha}v integrin expression and histone H3 acetylation in control and FK228-treated cancer cell lines and cultured normal cells. In the top three panels, cancer cell lines and the corresponding cultured normal cells were incubated without (-) and with 1, 5, 10, or 20 ng/ml FK228 for 48 h. RNA was isolated and semiquantitative RT-PCR performed as described in "Materials and Methods" using ß-actin as a standard. For quantitation, which is shown below the photographs, the density of the band from the cancer cell line incubated with 1 ng/ml FK228 was assigned a value of 100 and the other bands normalized to it. Nd, not detectable. In the two bottom panels, total cellular protein was isolated, and Western blot analysis of histone H3 and acetylated histone H3 performed as described previously (17) . Histone H3 served as a loading control.

 
The bottom two panels of Fig. 1Citation show immunoblot results using antibodies against histone H3 or acetylated histone H3. Very little, if any, acetylated histone H3 was detected in the untreated cancer cell lines but the amounts increased in all three of the cancer cell lines after treatment with 1 ng/ml FK228. In cultured normal cells increases in histone H3 acetylation were seen only at higher concentrations of FK228. FK228 caused no change in total histone H3 levels. These studies indicate that FK228 caused an increase in histone acetylation at the concentrations used in this study. We showed previously that sodium butryate (29) and trichostatin A (30) , two other HDAC inhibitors, caused modest increases in the levels of CAR and {alpha}v integrin RNA in MCF7 cells (17) . These results suggest that FK228 may function in these experiments through inhibition of histone deacetylation.

Because treatment with 1 ng/ml FK228 increased CAR and {alpha}v integrin expression in cancer cell lines but not cultured normal cells, we sought to determine whether this treatment resulted in an increase in the level of adenovirus infection of cancer cell lines but not cultured normal cells. Cells were incubated for 48 h in medium without or with 1 ng/ml FK228. The cells were washed to remove the drug and remained drug-free for the remainder of the experiment. The cells were infected with an adenovirus carrying the ßgal gene under the direction of the CMV promoter (moi = 100), which allowed for identification of infected cells after a 48-h incubation period. Photographs of adenovirus-infected cells are shown on the left of Fig. 2Citation . The intensity of blue staining reflects the extent of transgene expression after adenovirus infection. After FK228 treatment, a marked increase in ßgal expression was seen in all of the cancer cell lines tested. A quantitation of ßgal-positive cells is shown on the right side of Fig. 2Citation . It indicates a 4–10-fold increase in the number cells expressing the transgene in the FK228-treated cancer cell lines after adenovirus infection. Approximately 75–85% of the treated cancer cells expressed ßgal. In contrast, the percent of ßgal-positive cells was higher in the untreated cultured normal cells with 20–40% of cells stained blue. However, after treatment with 1 ng/ml FK228 the percentage of positive cultured normal cells did not increase. Thus, treatment with 1 ng/ml FK228 before infection increased adenovirus transgene expression after virus infection in the cancer cell lines but not in the corresponding cultured normal cells.



View larger version (80K):
[in this window]
[in a new window]
  		Fig. 2. Expression of AdCMVßgal in adenovirus-infected control and FK228-treated cells. The left panel shows photographs of cancer cell lines and the corresponding cultured normal cells treated without (no treatment) or with 1 ng/ml FK228 for 48 h before infection with AdCMVßgal (moi = 100). The infected cells were grown for 48 h without FK228 and stained for ßgal activity. Each pair of FK228-treated and untreated control had a similar numbers of cells, because 1 ng/ml FK228 has minimal cytotoxicity in a 48-h incubation. The data are presented graphically in the right panel.

 
To help elucidate the mechanisms by which FK228 can increase adenovirus transgene expression, the K562 human erythroleukemia cell line was used. Because K562 cells are not adherent, experiments can be easily analyzed by flow cytometry after infection with an adenovirus carrying a gfp transgene under the control of the CMV promoter. Previous work from our laboratory showed that like other cancer cell lines, the K562 cell line is responsive to FK228 (31) . Fig. 3ACitation shows the levels of CAR and {alpha}v integrin RNA by semiquantitative RT-PCR analysis after a 48-h incubation in FK228. This analysis shows that there was a marked increase in CAR RNA levels, whereas the {alpha}v integrin levels were essentially unchanged after FK228 treatment. Fig. 3BCitation shows a Western blot analysis of FK228-treated samples after a 48-h incubation. The levels of CAR protein increased with FK228 treatment, whereas the levels of {alpha}v integrin were little changed. Thus, FK228 treatment of cancer cell lines can increase the levels of CAR protein, the primary receptor for adenovirus attachment to cells.



View larger version (26K):
[in this window]
[in a new window]
  		Fig. 3. Expression in K562 cells. A, analysis of CAR and {alpha}v integrin RNA levels. Semiquantitative RT-PCR analysis using the CAR2 and {alpha}v integrin primers was performed as described in the legend to Fig. 1Citation after incubation of K562 cells in the indicated concentrations of FK228 for 48 h. The amplification reactions were carried out for 30 cycles for CAR, 25 cycles for {alpha}v integrin, and 12 cycles for 28S rRNA. The standard was 28S rRNA. B, analysis of CAR and {alpha}v integrin proteins levels. Proteins were isolated and Western blot analysis performed as described in the legend to Fig. 1Citation except that 50 µg of cellular lysate was loaded onto 4–20% gels in an equal volume of Lacy buffer with 5% ß-mercaptoethanol (58 , 59) . The antibodies used were CAR (Santa Cruz Biotechnology, Santa Cruz, CA), {alpha}v integrin (Santa Cruz Biotechnology), and glyceraldehyde-3-phosphate dehydrogenase (ARP, Belmont, MA). C, expression of AdCMVgfp in control and FK228-treated cells. K562 cells were treated with the indicated concentrations of FK228 before infection. The cells were infected with adenovirus at various moi and analyzed as described in "Materials and Methods." D, expression of AdCMVgfp in cells treated with FK228 before and after infection. The experiment was performed described as in C but cells were treated with only 1 ng/ml FK228. Untreated cells (before-/after-) were compared with cells treated after infection (before-/after+), before infection (before+/after-), or both before and after infection (before+/after+). Live cells were 74–93% of the total population.

 
To investigate the effect of the increase in CAR protein levels after FK228 treatment on adenovirus infection, the experiment shown in Fig. 3CCitation was performed. K562 cells were treated with different concentrations of FK228 for 48 h, infected with various multiplicities of AdCMVgfp, and analyzed for gfp expression 24 h after infection by flow cytometry. Untreated cells exhibited a very low level of infection as determined by gfp transgene expression, whereas cells treated with as little as 0.66 ng/ml FK228 showed a clear increase. A maximum of 60–70% of K562 cells was infected with adenovirus after FK228 treatment. Because there is evidence that HDAC inhibitors can increase expression from genes under the control of the CMV promoter (32 , 33) , in all of our experiments FK228 was not included during or after infection to avoid any effect on adenovirus transgene expression caused by activation of the CMV promoter. The validity of this approach is evidenced by the experiment shown in Fig. 3DCitation , which demonstrates the effects of adding FK228 after adenovirus infection. In this experiment K562 cells were incubated without or with 1 ng/ml FK228 for 48 h, infected with various multiplicities of AdCMVgfp, then incubated without or with 1 ng/ml FK228 for 24 h, before analyzing the cells for gfp expression. These studies showed that adding FK228 before infection as we did in all of our experiments increased expression compared with untreated cells 8–12-fold. Adding FK228 only after adenovirus infection increased expression only 3–4-fold. Similarly adding FK228 after adenovirus infection to cells treated previously with FK228 before adenovirus infection increased transgene expression an additional 3-fold above the 8–12-fold value obtained when only pretreatment was used to a level of 26–40-fold above untreated levels. Thus, whereas treatment after adenovirus infection can increase expression a few fold, the greatest fold increase is observed by treating cells with FK228 before adenovirus infection.

In summary, our studies suggest that the presence of FK228 before adenovirus infection increases the level of CAR protein that can cause increased adenovirus attachment, infection, and transgene expression. The presence of an HDAC inhibitor after infection functions through other mechanisms such as transactivation of the CMV promoter that drives transcription of the adenoviral transgene.

These data demonstrate that cultured normal cells are less sensitive to the effects of FK228. Whereas this reduced sensitivity is likely to be multifactorial, one factor may be the expression of the ABC transporter Pgp, which has been shown to avidly transport FK228 (34) . Pgp is expressed at high levels in normal liver and kidney, and at lower levels in normal breast epithelium. Fig. 4ACitation shows the results of semiquantitative RT-PCR analysis, which confirmed the higher levels of expression of this drug transporter in cultured normal cells compared with their respective cancer cell lines. That Pgp shields cultured normal cells from the effects of FK228 is shown in Fig. 4BCitation , which compares CAR and {alpha}v integrin expression and histone acetylation in cultured normal cells treated with FK228 in the absence or presence of the potent Pgp inhibitor XR9576 (tariquidar; Refs. 35 , 36 ). The addition of 100 ng/ml XR9576 resulted in increased CAR expression and histone acetylation at 1 and 5 ng/ml FK228. Thus, in this case, the drug transporter Pgp appeared to be protecting cultured normal cells from the effects of FK228 by pumping the HDAC inhibitor of the cells.



View larger version (61K):
[in this window]
[in a new window]
  		Fig. 4. Influence of Pgp on FK228 treatment. A, expression of MDR1/Pgp in cultured normal cells from breast, kidney, and liver. RNA was isolated and semiquantitative RT-PCR performed as described in "Materials and Methods." B, effect of the Pgp inhibitor XR9576 on CAR and {alpha}v integrin RNA expression and histone H3 acetylation in cultured normal cells. Cells were incubated, and analyses were performed as described in the legend to Fig. 1Citation except that the quantitation was normalized to the 5 ng/ml sample. The XR9576 (100 ng/ml) was added at the same time as FK228.

 

   DISCUSSION
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
In the present study we compared CAR, {alpha}v integrin, and adenovirus transgene expression levels in cells cultured from normal tissues (breast, kidney, and liver) with cancer cell lines derived from those tissues and were able to demonstrate that the cancer cell lines are more sensitive to FK228. The observation that 1 ng/ml FK228 preferentially increased the number of infected cells expressing the transgene in cancer cell lines suggests a strategy that may render malignant cells more susceptible to adenoviral infection than normal cells in vivo. Such an approach could be used to increase the effectiveness of adenoviral infection, whereas reducing undesirable side effects that may result to normal tissue from high levels of adenovirus infection.

The mechanism by which FK228 exerts it effect is most likely through an alteration of histone acetylation. FK228 has been shown to be a HDAC inhibitor, and we have demonstrated an increase in histone H3 acetylation in this study after FK228 treatment (16) . HDAC inhibitors have been shown to induce a small fraction of cellular genes in treated cells (37 , 38) . The addition of HDAC inhibitors after adenovirus infection is known to increase viral protein and transgene expression (39 , 40) . In our studies the FK228 was added before but not during or after the adenovirus infection, and we demonstrated an increase in the number of infected cells expressing the viral transgene. Another laboratory has reported that the addition of a different HDAC inhibitor, sodium butyrate, increased the transduction of adenovirus (41) . Differences in CAR levels in cell lines and tumor samples have been reported by many laboratories (42 , 43) . These differences affect their ability to be infected by adenovirus and can be enhanced at least in part by the addition of a HDAC inhibitor (41) . In fact, an inverse correlation has been noted between CAR expression and tumor grade (9 , 44) . This observation suggests that the most highly malignant cells may be the ones most difficult to infect with adenovirus.

Attempts to develop adenoviral vectors for therapies have been hampered by toxicity to normal tissues, most notably liver, and low infectivity of malignant cells (45 , 46) . This unfavorable therapeutic outcome may be a consequence of the high levels of CAR expression in many normal tissues, including liver, and the low levels of CAR expression found in many human tumors (2 , 8 , 9) . However, the results in the present study suggest that the use of FK228 could improve the therapeutic index of adenovirus therapy by increasing CAR and {alpha}v integrin expression in malignant cells, thus making them more susceptible to adenovirus infection. If the cells are more susceptible to adenovirus infection, less virus should be required for treatment. A reduction in the virus used would help reduce toxicity in patients. We have demonstrated previously that in the presence of FK228, much less adenovirus is required in vitro (17) . The experiments with the Pgp inhibitor XR9576 (tariquidar) showed that the relative insensitivity of cultured normal cells was mediated at least in part by Pgp, a drug transporter that has been shown previously to transport FK228 (34) . Ongoing clinical trials using FK228 suggest that the concentrations used in the present study are well within the therapeutic range and could potentially be used to enhance adenoviral infection of malignant cells in patients (18 , 19) .

Increases in the efficiency of adenovirus infection into malignant cells in vivo would improve the efficacy of many existing adenoviral vectors that use CAR and {alpha}v integrin to infect cells. Numerous adenoviruses have been made that produce a variety of transgene products such as p53 that are cytotoxic to many cancer cells (47 , 48) . Some adenoviral vectors have been constructed with promoters that preferentially function in tumor cells or specific cell types and direct the synthesis of a cytotoxic product (49, 50, 51) . In addition, replication-competent adenoviruses that preferentially replicate in tumor cells or other specific cell types have also been developed (52 , 53) . Whereas many adenoviral vectors tried in mouse xenograft model systems are efficacious, they have not been able to completely eliminate the tumors (49) . Adenovirus therapies are currently in clinical trials; however, adenovirus treatment has not yet become an accepted therapeutic modality for any type of cancer (54 , 55) . Studies comparing adenoviruses that use CAR with adenoviruses modified to target different, more prevalent, receptors suggest that adenoviral vectors are more effective when there are a greater number of high-affinity receptors (56 , 57) . Therefore, a strategy to increase the number of CAR high-affinity adenoviral receptors on tumor cells should greatly improve the effectiveness of adenoviral gene therapies in vivo.

In summary, we have demonstrated that nontoxic doses of FK228, a HDAC inhibitor, can result in marked increases in expression of CAR and {alpha}v integrin in cancer cell lines, whereas having little effect on cultured normal cells. These increases mediated enhanced transgene expression after adenovirus infection in cancer cell lines but not in cultured normal cells. These studies suggest a simple, clinically practical method for increasing the sensitivity of tumor cells to adenoviral gene therapy vectors, whereas potentially reducing unwanted toxicity in patients.


   ACKNOWLEDGMENTS
 
We thank Dr. Fariba Navid for sharing results with us before publication, and Drs. Marianne Poruchynsky and Daniel L. Sackett for helpful discussions.


   FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 These authors contributed equally to this article. Back

2 To whom requests for reprints should be addressed, at Cancer Therapeutics Branch, Center for Cancer Research, National Cancer Institute, Building 10, Room 12C103, MSC 1903, 9000 Rockville Pike, Bethesda, MD 20892. Phone: (301) 496-2631; Fax: (301) 402-1608; E-mail: tfojo{at}helix.nih.gov Back

3 The abbreviations used are: CAR, coxsackie-adenovirus receptor; CMV, cytomegalovirus, ßgal, ß-galactosidase; gfp, green fluorescent protein; HDAC, histone deacetylase; moi, multiplicity of infection; Pgp, P-glycoprotein; RT-PCR, reverse transcription-PCR. Back

Received 10/ 4/02; revised 6/19/03; accepted 7/ 2/03.


   REFERENCES
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Bergelson J. M., Cunningham J. A., Droguett G., Kurt-Jones E. A., Krithivas A., Hong J. S., Horwitz M. S., Crowell R. L., Finberg R. W. Isolation of a common receptor for coxsackie B viruses and adenoviruses 2 and 5. Science (Wash. DC), 275: 1320-1323, 1997.[Abstract/Free Full Text]
  2. Tomko R. P., Xu R., Philipson L. HCAR and MCAR: the human and mouse cellular receptors for subgroup C adenoviruses and group B coxsackieviruses. Proc. Natl. Acad. Sci. USA, 94: 3352-3356, 1997.[Abstract/Free Full Text]
  3. Wickham T. J., Mathias P., Cheresh D. A., Nemerow G. R. Integrins {alpha}vß3 and {alpha}vß5 promote adenovirus internalization but not virus attachment. Cell, 73: 309-319, 1993.[CrossRef][Medline]
  4. Li E., Brown S. L., Stupack D. G., Puente X. S., Cheresh D. A., Nemerow G. R. Integrin {alpha}vß1 is an adenovirus coreceptor. J. Virol., 75: 5405-5409, 2001.[Abstract/Free Full Text]
  5. Hemmi S., Geertsen R., Mezzacasa A., Peter I., Dummer R. The presence of human coxsackievirus and adenovirus receptor is associated with efficient adenovirus-mediated transgene expression in human melanoma cell cultures. Hum. Gene Ther., 9: 2363-2373, 1998.[Medline]
  6. Rebel V. I., Hartnett S., Denham J., Chan M., Finberg R., Sieff C. A. Maturation and lineage-specific expression of the coxsackie and adenovirus receptor in hematopoietic cells. Stem Cells, 18: 176-182, 2000.[Abstract/Free Full Text]
  7. Minaguchi T., Mori T., Kanamori Y., Matsushima M., Yoshikawa H., Taketani Y., Nakamura Y. Growth suppression of human ovarian cancer cells by adenovirus-mediated transfer of the PTEN gene. Cancer Res., 59: 6063-6067, 1999.[Abstract/Free Full Text]
  8. Miller C. R., Buchsbaum D. J., Reynolds P. N., Douglas J. T., Gillespie G. Y., Mayo M. S., Raben D., Curiel D. T. Differential susceptibility of primary and established human glioma cells to adenovirus infection: Targeting via the epidermal growth factor receptor achieves fiber receptor-independent gene transfer. Cancer Res., 58: 5738-5748, 1998.[Abstract/Free Full Text]
  9. Okegawa T., Pong R. C., Li Y., Bergelson J. M., Sagalowsky A. I., Hsieh J. T. The mechanism of the growth-inhibitory effect of coxsackie and adenovirus receptor (CAR) on human bladder cancer: a functional analysis of CAR protein structure. Cancer Res., 61: 6592-6600, 2001.[Abstract/Free Full Text]
  10. Byk T., Haddada H., Vainchenker W., Louache F. Lipofectamine and related cationic lipids strongly improves adenoviral infection efficiency of primitive human hematopoietic cells. Hum. Gene Ther., 9: 2493-2502, 1998.[CrossRef][Medline]
  11. Takahashi T., Yamada K., Tanaka T., Kumano K., Kurokawa M., Hirano N., Honda H., Chiba S., Tsuji K., Yazaki Y., Nakahata T., Hirai H. A potential molecular approach to ex vivo hematopoietic expansion with recombinant epidermal growth factor receptor-expressing adenovirus vector. Blood, 91: 4509-4515, 1998.[Abstract/Free Full Text]
  12. Shayakhmetov D. M., Papayannopoulou T., Stamatoyannopoulos G., Lieber A. Efficient gene transfer into human CD34(+) cells by a retargeted adenovirus vector. J. Virol., 74: 2567-2583, 2000.[Abstract/Free Full Text]
  13. Krasnykh V., Dmitriev I., Navarro J. G., Belousova N., Kashentseva E., Xiang J., Douglas J. T., Curiel D. T. Advanced generation adenoviral vectors possess augmented gene transfer efficiency based upon coxsackie adenovirus receptor-independent cellular entry capacity. Cancer Res., 60: 6784-6787, 2000.[Abstract/Free Full Text]
  14. Huang S., Endo R. I., Nemerow G. R. Upregulation of integrins {alpha}vß3 and {alpha}vß5 on human monocytes and T lymphocytes facilitates adenovirus-mediated gene delivery. J. Virol., 69: 2257-2263, 1995.[Abstract]
  15. Ueda H., Nakajima H., Hori Y., Fujita T., Nishimura M., Goto T., Okuhara M. FR901228, a novel antitumor bicyclic depsipeptide produced by Chromobacterium violaceum No. 968. I. Taxonomy, fermentation, isolation, physico-chemical and biological properties, and antitumor activity. J. Antibiot. (Tokyo), 47: 301-310, 1994.[Medline]
  16. Nakajima H., Kim Y. B., Terano H., Yoshida M., Horinouchi S. FR901228, a potent antitumor antibiotic, is a novel histone deacetylase inhibitor. Exp. Cell Res., 241: 126-133, 1998.[CrossRef][Medline]
  17. Kitazono M., Goldsmith M. E., Aikou T., Bates S., Fojo T. Enhanced adenovirus transgene expression in malignant cells treated with the histone deacetylase inhibitor FR901228. Cancer Res., 61: 6328-6330, 2001.[Abstract/Free Full Text]
  18. Piekarz R. L., Robey R., Sandor V., Bakke S., Wilson W. H., Dahmoush L., Kingma D. M., Turner M. L., Altemus R., Bates S. E. Inhibitor of histone deacetylation, depsipeptide (FR901228), in the treatment of peripheral and cutaneous T-cell lymphoma: a case report. Blood, 98: 2865-2868, 2001.[Abstract/Free Full Text]
  19. Sandor V., Bakke S., Robey R. W., Kang M. H., Blagosklonny M. V., Bender J., Brooks R., Piekarz R. L., Tucker E., Figg W. D., Chan K. K., Goldspiel B., Fojo A. T., Balcerzak S. P., Bates S. E. Phase I trial of the histone deacetylase inhibitor, depsipeptide (FR901228, NSC 630176), in patients with refractory neoplasms. Clin. Cancer Res., 8: 718-728, 2002.[Abstract/Free Full Text]
  20. Soule H. D., Vazquez J., Long A., Albert S., Brennan M. A human cell line from a pleural effusion derived from a breast carcinoma. J. Natl. Cancer Inst., 51: 1409-1416, 1973.
  21. Giard D. J., Aaronson S. A., Todaro G. J., Arnstein P. A., Kersey J. H., Dosik H., Parks W. P. In vitro cultivation of human tumors: Establishment of cell lines derived from a series of solid tumors. J. Natl. Cancer Inst., 51: 1417-1423, 1973.
  22. Knowles B. B., Howe C. C., Aden D. P. Human hepatocellular carcinoma cell lines secrete the major plasma proteins and hepatitis B surface antigen. Science (Wash. DC), 209: 497-499, 1980.[Abstract/Free Full Text]
  23. Lozzio C. B., Lozzio B. B. Human chronic myelogenous leukemia cell line with positive Philadelphia chromosome. Blood, 45: 321-324, 1975.[Abstract/Free Full Text]
  24. Mosmann T. Rapid colorimetric assay for cellular growth and survival: Application to proliferation and cytotoxicity assays. J. Immunol. Methods, 65: 55-63, 1983.[CrossRef][Medline]
  25. Skehan P., Storeng R., Scudiero S., Monks A., McMahon J., Vistica D., Warren J. T., Bokesch H., Kenney S., Boyd M. R. New colorimetric cytotoxicity assay for anticancer-drug screening. J. Natl. Cancer Inst., 82: 1107-1112, 1990.[Abstract/Free Full Text]
  26. Suzuki S., Argraves W. S., Pytela R., Arai H., Krusius T., Pierschbacher M. D., Ruoslahti E. cDNA and amino acid sequences of the cell adhesion protein receptor recognizing vitronectin reveal a transmembrane domain and homologies with other adhesion protein receptors. Proc. Natl. Acad. Sci. USA, 83: 8614-8618, 1986.[Abstract/Free Full Text]
  27. Chen C. J., Chin J. E., Ueda K., Clark D. P., Pastan I., Gottesman M. M., Roninson I. B. Internal duplication and homology with bacterial transport proteins in the mdr1 (p-glycoprotein) gene from multidrug-resistant human cells. Cell, 47: 381-389, 1986.[CrossRef][Medline]
  28. Naito E., Dewa K., Yamanouchi H., Kominami R. Ribosomal ribonucleic acid (rRNA) gene typing for species identificaiton. J. Forensic. Sci., 37: 396-403, 1992.[Medline]
  29. Candido E. P., Reeves R., Davie J. R. Sodium butyrate inhibits histone deacetylation in cultured cells. Cell, 14: 105-113, 1978.[CrossRef][Medline]
  30. Yoshida M., Kijima M., Akita M., Beppu T. Potent and specific inhibition of mammalian histone deacetylase both in vivo and in vitro by trichostatin A. J. Biol. Chem., 265: 17174-17179, 1990.[Abstract/Free Full Text]
  31. Kitazono M., Rao V. K., Robey R., Aikou T., Bates S., Fojo T., Goldsmith M. E. Histone deacetylase inhibitor FR901228 enhances adenovirus infection of hematopoietic cells. Blood, 99: 2248-2251, 2002.[Abstract/Free Full Text]
  32. Palermo D. P., DeGraaf M. E., Marotti K. R., Rehberg E., Post L. E. Production of analytical quantities of recombinant proteins in Chinese hamster ovary cells using sodium butyrate to elevate gene expression. J. Biotechnol., 19: 35-47, 1991.[CrossRef][Medline]
  33. Chen W. Y., Bailey E. C., McCune S. L., Dong J. Y., Townes T. M. Reactivation of silenced, virally transduced genes by inhibitors of histone deacetylase. Proc. Natl. Acad. Sci. USA, 94: 5798-5803, 1997.[Abstract/Free Full Text]
  34. Lee J. S., Paull K., Alvarez M., Hose C., Monks A., Grever M., Fojo A. T., Bates S. E. Rhodamine efflux patterns predict P-glycoprotein substrates in the National Cancer Institute drug screen. Mol. Pharmacol., 46: 627-638, 1994.[Abstract]
  35. Roe M., Folkes A., Ashworth P., Brumwell J., Chima L., Hunjan S., Pretswell I., Dangerfield W., Ryder H., Charlton P. Reversal of P-glycoprotein mediated multidrug resistance by novel anthranilamide derivatives. Bioorg. Med. Chem. Lett., 9: 595-600, 1999.[CrossRef][Medline]
  36. Mistry P., Stewart A. J., Dangerfield W., Okiji S., Liddle C., Bootle D., Plumb J. A., Templeton D., Charlton P. In vitro and in vivo reversal of P-glycoprotein-mediated multidrug resistance by a novel potent modulator, XR9576. Cancer Res., 61: 749-758, 2001.[Abstract/Free Full Text]
  37. Van Lint C., Emiliani S., Verdin E. The expression of a small fraction of cellular genes is changed in response to histone hyperacetylation. Gene Expr., 5: 245-253, 1996.[Medline]
  38. Della Ragione F., Criniti V., Della Pietra V., Borriello A., Oliva A., Indaco S., Yamamoto T., Zappia V. Genes modulated by histone acetylation as new effectors of butyrate activity. FEBS Lett., 499: 199-204, 2001.[CrossRef][Medline]
  39. Dion L. D., Goldsmith K. T., Tang D. C., Engler J. A., Yoshida M., Garver R. I. Amplification of recombinant adenoviral transgene products occurs by inhibition of histone deacetylase. Virology, 231: 201-209, 1997.[CrossRef][Medline]
  40. Gaetano C., Catalano A., Palumbo R., Illi B., Orlando G., Ventoruzzo G., Serino F., Capogrossi M. C. Transcriptionally active drugs improve adenovirus vector performance in vitro and in vivo. Gene Ther., 7: 1624-1630, 2000.[CrossRef][Medline]
  41. Lee C. T., Seol J. Y., Park K. H., Yoo C. G., Kim Y. W., Ahn C., Song Y. W., Han S. K., Han J. S., Kim S., Lee J. S., Shim Y. S. Differential effects of adenovirus-p16 on bladder cancer cell lines can be overcome by the addition of butyrate. Clin. Cancer Res., 7: 210-214, 2001.[Abstract/Free Full Text]
  42. Li D., Duan L., Freimuth P., O’Malley B. W. Variability of adenovirus receptor density influences gene transfer efficiency and therapeutic response in head and neck cancer. Clin. Cancer Res., 5: 4175-4181, 1999.[Abstract/Free Full Text]
  43. You Z., Fischer D. C., Tong X., Hasenburg A., Aguilar-Cordova E., Kieback D. G. Coxsackievirus-adenovirus receptor expression in ovarian cancer cell lines is associated with increased adenovirus transduction efficiency and transgene expression. Cancer Gene Ther., 8: 168-175, 2001.[Medline]
  44. Rauen K. A., Sudilovsky D., Le J. L., Chew K. L., Hann B., Weinberg V., Schmitt L. D., McCormick F. Expression of the coxsackie adenovirus receptor in normal prostate and in primary and metastatic prostate carcinoma: Potential relevance to gene therapy. Cancer Res., 62: 3812-3818, 2002.[Abstract/Free Full Text]
  45. Wood M., Perrotte P., Onishi E., Harper M. E., Dinnery C., Pagliaro L., Wilson D. R. Biodistribution of an adenoviral vector carrying the luciferase reporter gene following intravesical or intravenous administration to a mouse. Cancer Gene Ther., 6: 367-372, 1999.[CrossRef][Medline]
  46. Printz M. A., Gonzalez A. M., Cunningham M., Gu D. L., Ong M., Pierce G. F., Aukerman S. L. Fibroblast growth factor 2-retargeted adenoviral vectors exhibit a modified biolocalization pattern and display reduced toxicity relative to native adenoviral vectors. Hum. Gene Ther., 11: 191-204, 2000.[CrossRef][Medline]
  47. Zhang W. W., Fang X., Mazur W., French B. A., Georges R. N., Roth J. A. High-efficiency gene transfer and high-level expression of wild-type p53 in human lung cancer cells mediated by recombinant adenovirus. Cancer Gene Ther., 1: 5-13, 1994.[Medline]
  48. Wills K. N., Maneval D. C., Menzel P., Harris M. P., Sutjipto S., Vaillancourt M. T., Huang W. M., Johnson D. E., Anderson S. C., Wen S. F., Bookstein R., Shepard H. M., Gregory R. J. Development and characterization of recombinant adenoviruses encoding human p53 for gene therapy of cancer. Hum. Gene. Ther., 5: 1079-1088, 1994.[Medline]
  49. Vandier D., Rixe O., Besnard F., Kim M., Rikiyama T., Goldsmith M., Brenner M., Gouyette A., Cowan K. H. Inhibition of glioma cells in vitro and in vivo using a recombinant adenoviral vector containing an astrocyte-specific promoter. Cancer Gene. Ther., 7: 1120-1126, 2000.[CrossRef][Medline]
  50. Kitazono M., Chuman Y., Aikou T., Fojo T. Adenovirus HSV-TK construct with thyroid-specific promoter: enhancement of activity and specificity with histone deacetylase inhibitors and agents modulating the cAMP pathway. Int. J. Cancer, 99: 453-459, 2002.[CrossRef][Medline]
  51. Peng X. Y., Won J. H., Rutherford T., Fujii T., Zelterman D., Pizzorno G., Sapi E., Leavitt J., Kacinski B., Crystal R., Schwartz P., Deisseroth A. The use of the L-plastin promoter for adenoviral-mediated, tumor-specific gene expression in ovarian and bladder cancer cell lines. Cancer Res., 61: 4405-4413, 2001.[Abstract/Free Full Text]
  52. Heise C., Sampson-Johannes A., Williams A., McCormick F., Von Hoff D. D., Kirn D. H. ONYX-015, an E1B gene-attenuated adenovirus, causes tumor-specific cytolysis and antitumoral efficacy that can be augmented by standard chemotherapeutic agents. Nat. Med., 3: 639-645, 1997.[CrossRef][Medline]
  53. Zhang L., Akbulut H., Tang Y., Peng X., Pizzorno G., Sapi E., Manegold S., Deisseroth A. Adenoviral vectors with E1A regulated by tumor-specific promoters are selectively cytolytic for breast cancer and melanoma. Mol. Ther., 6: 386-393, 2002.[CrossRef][Medline]
  54. Roth J. A., Grammer S. F., Swisher S. G., Komaki R., Nemunaitis J., Merritt J., Fujiwara T., Meyn R. E. Gene therapy approaches for the management of non-small cell lung cancer. Semin. Oncol., 284(Suppl.14): 50-56, 2001.
  55. Biederer C., Ries S., Brandts C. H., McCormick F. Replication-selective viruses for cancer therapy. J. Mol. Med., 80: 163-175, 2002.[CrossRef][Medline]
  56. Dmitriev I., Krasnykh V., Miller C. R., Wang M., Kashentseva E., Mikheeva G., Belousova N., Curiel D. T. An adenovirus vector with genetically modified fibers demonstrates expanded tropism via utilization of a coxsackievirus and adenovirus receptor-independent cell entry mechanism. J. Virol., 72: 9706-9713, 1998.[Abstract/Free Full Text]
  57. Suzuki K., Fueyo J., Krasnykh V., Reynolds P. N., Curiel D. T., Alemany R. A conditionally replicative adenovirus with enhanced infectivity shows improved oncolytic potency. Clin. Cancer Res., 7: 120-126, 2001.[Abstract/Free Full Text]
  58. Ebbinghaus C., Al-Jaibaji a., Operschall E., Schoffel A., Peter I., Greber U. F., Hemmi S. Functional and selective targeting of adenovirus to high-affinity Fc{gamma} receptor I-positive cells by using a bispecific hybrid adapter. J. Virol., 75: 480-489, 2001.[Abstract/Free Full Text]
  59. Lacey E., Snowdon K. L. Isolation of mammalian brain tubulin by amino-activated gel chromatography. J. Chromatogr., 525: 71-84, 1990.[Medline]



This article has been cited by other articles:


Home page
 Molecular Cancer TherapeuticsHome page
Y. Sasaki, H. Negishi, M. Idogawa, H. Suzuki, H. Mita, M. Toyota, Y. Shinomura, K. Imai, and T. Tokino
Histone deacetylase inhibitor FK228 enhances adenovirus-mediated p53 family gene therapy in cancer models
Mol. Cancer Ther., April 1, 2008; 7(4): 779 - 787.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
J. Fan, J. Stanfield, Y. Guo, J. A. Karam, E. Frenkel, X. Sun, and J.-T. Hsieh
Effect of Trans-2,3-Dimethoxycinnamoyl Azide on Enhancing Antitumor Activity of Romidepsin on Human Bladder Cancer
Clin. Cancer Res., February 15, 2008; 14(4): 1200 - 1207.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
S. Libertini, I. Iacuzzo, A. Ferraro, M. Vitale, M. Bifulco, A. Fusco, and G. Portella
Lovastatin Enhances the Replication of the Oncolytic Adenovirus dl1520 and Its Antineoplastic Activity against Anaplastic Thyroid Carcinoma Cells
Endocrinology, November 1, 2007; 148(11): 5186 - 5194.
[Abstract] [Full Text] [PDF]

Home page
 Molecular Cancer TherapeuticsHome page
M. E. Goldsmith, A. Aguila, K. Steadman, A. Martinez, S. M. Steinberg, M. C. Alley, W. R. Waud, S. E. Bates, and T. Fojo
The histone deacetylase inhibitor FK228 given prior to adenovirus infection can boost infection in melanoma xenograft model systems
Mol. Cancer Ther., February 1, 2007; 6(2): 496 - 505.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
A. Keriel, C. Rene, C. Galer, J. Zabner, and E. J. Kremer
Canine Adenovirus Vectors for Lung-Directed Gene Transfer: Efficacy, Immune Response, and Duration of Transgene Expression Using Helper-Dependent Vectors
J. Virol., February 1, 2006; 80(3): 1487 - 1496.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
M. D. Lacher, M. I. Tiirikainen, E. F. Saunier, C. Christian, M. Anders, M. Oft, A. Balmain, R. J. Akhurst, and W. M. Korn
Transforming Growth Factor-{beta} Receptor Inhibition Enhances Adenoviral Infectability of Carcinoma Cells via Up-Regulation of Coxsackie and Adenovirus Receptor in Conjunction with Reversal of Epithelial-Mesenchymal Transition
Cancer Res., February 1, 2006; 66(3): 1648 - 1657.
[Abstract] [Full Text] [PDF]

Home page
 JNCI J Natl Cancer InstHome page
L.-C. Li, P. R. Carroll, and R. Dahiya
Epigenetic Changes in Prostate Cancer: Implication for Diagnosis and Treatment
J Natl Cancer Inst, January 19, 2005; 97(2): 103 - 115.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Goldsmith, M. E.
Right arrow Articles by Fojo, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Goldsmith, M. E.
Right arrow Articles by Fojo, T.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online