
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Oncology, Markers, Clinical Correlates |
1 The Howard Hughes Medical Institute and
2 Department of Medicine and Ireland Cancer Center, University Hospitals of Cleveland and Case Western Reserve University, Cleveland, Ohio, and
3 The Sidney Kimmel Comprehensive Cancer Center, Johns Hopkins Medical Institutions, Baltimore, Maryland
| ABSTRACT |
|---|
|
|
|---|
Experimental Design: We developed modifications of in situ hybridization methods that facilitated the study of paraffin-embedded sections. We also evaluated PRL-3 gene copy numbers using fluorescence in situ hybridization and developed antibodies to assess PRL-3 subcellular localization.
Results: PRL-3 mRNA expression was elevated in nearly all metastatic lesions derived from CRCs, regardless of the site of metastasis (liver, lung, brain, or ovary). Expression was found in neoplastic cells, although tumor endothelium also expressed the gene. In contrast, little or no PRL-3 expression was observed in normal colon, nonmetastatic primary cancers, or metastatic lesions derived from cancers other than those of the colon (pancreas, stomach, or esophagus). Interphase fluorescence in situ hybridization confirmed that gene amplification was not the major cause of PRL-3 overexpression. Immunohistochemical analysis with anti-PRL-3 antibodies showed a cell membrane localization, consistent with the predicted isoprenylation of the protein.
Conclusions: These studies establish an unexpected and unprecedented specificity in metastatic gene expression profiles: PRL-3 is apparently expressed in CRC metastases to any organ but is not expressed in metastases of other cancers to the same organs or in nonmetastatic CRCs. PRL-3 is also expressed in tumor vasculature, regardless of the tumor source. These data raise intriguing questions about the role of protein phosphorylation in angiogenesis and cell-type-specific metastatic processes.
| INTRODUCTION |
|---|
|
|
|---|
Progress in understanding some aspects of metastasis are notable. For example, many studies have shown that proteases that degrade the basement membrane are likely to be essential for invasion (5) . Additionally, cytoskeletal remodeling appears to be required for cancer cell mobility (6) . However, the signaling pathways that control the cytoskeletal changes or the expression and activation of proteases and their inhibitors in metastases are largely unknown. This situation is therefore quite unlike the one investigators face when studying cell birth and cell death in which detailed information about the relevant biochemical networks are available.
On the basis of the above considerations, we were intrigued by the finding that a protein tyrosine phosphatase called PRL-3 was expressed at high levels in liver metastases of CRCs4 (7) . Protein tyrosine kinases and phosphatases constitute critical controls of many cellular activities, and PRL-3 thereby promised to provide new insights into the biochemical pathways controlling various aspects of metastasis (8 , 9) . PRL-3 is a member of a small and recently discovered class of protein tyrosine phosphatases (10) . The family includes only three members (PRL-1, PRL-2, and PRL-3), and overexpression of PRL-1 or PRL-2 can transform cells in vitro when overexpressed (11 , 12) . Among normal human adult tissues, PRL-3 (also known as PTP4A3) is expressed predominantly in muscle and heart (13) . In the current work, we attempted to address several fundamental questions relating PRL-3 to the metastatic process. One of the most interesting and unexpected results described below concerns the specificity of PRL-3 expression among the various metastatic lesions tested.
| MATERIALS AND METHODS |
|---|
|
|
|---|
In Situ Hybridization.
DIG-labeled antisense RNA probes were generated by PCR amplification of multiple PCR products (500800 bp in length) corresponding to the entire PRL-3 transcript. Various sense PRL-3 probes served as negative controls. T7 promoter sequences were incorporated into the antisense primers as described previously (14)
. In vitro transcription was performed with DIG RNA labeling reagents and T7 RNA polymerase according to the manufacturers instructions (Roche, Indianapolis, IN). Six-µm-thick sections obtained from formalin-fixed, paraffin-embedded tissue blocks were deparaffinized, treated with pepsin, blocked with in situ hybridization solution (Dako, Carpinteria, CA) and incubated with RNA probes (100 ng/ml) overnight at 55°C. After washing twice in 2x SSC, then once in TNE buffer [10 mM Tris-HCl (pH 7.5), 500 mM NaCl, 1 mM EDTA], sections were incubated at 37°C with RNase mixture (Ambion, Austin, TX) diluted 135 in TNE. Slides were stringently washed twice in a mixture of one part deionized formamide and one part 2x SSC, pH 7.5, then once with 0.1x SSC at 55°C. Before immunodetection, tissues were treated with peroxidase blocking reagent (Dako) and blocked with 1% blocking reagent (DIG Nucleic Acid Detection kit; Roche) containing purified nonspecific rabbit immunoglobulins (Dako). For signal amplification, a horseradish peroxidase rabbit anti-DIG antibody (Dako) was used to catalyze the deposition of Biotin-Tyramide (GenPoint kit; Dako). Additional amplification was achieved by adding horseradish peroxidase-rabbit anti-biotin (Dako), biotin tyramide, and then alkaline-phosphatase rabbit anti-biotin (Dako). Signal was detected with the alkaline-phosphatase substrate 5-bromo-4-chloro-3-indolyl phosphate/ nitroblue tetrazolium (Sigma, St. Louis, MO). All sections were exposed for 10 min. Cells were counterstained with Nuclear Fast Red (Biogenex, San Ramon, CA) and mounted with Crystal/Mount (Biomeda, Foster City, CA).
Real-Time PCR.
Total RNA was isolated using RNAgents (Promega, Madison, WI), and mRNA was selected using the MessageMaker Reagent Assembly (Life Technologies, Inc.). Single-stranded cDNA was generated using Superscript II Reverse Transcriptase (Life Technologies, Inc.) following the manufacturers directions. Mock template preparations were prepared in parallel without the addition of reverse transcriptase. Quantitative PCR was performed with an iCycler (Bio-Rad, Hercules, CA) using Sybr Green I dye (Molecular Probes, Eugene, OR), and threshold cycle numbers were obtained using iCycler software version 2.3. Primer sets were described previously (7)
. Conditions for amplification were: one cycle of 95°C, 2 min followed by 35 cycles of 95°C, 15 s, 58°C, 15 s, and 72°C, 15 s.
Expression Constructs and Immunofluorescence.
HA-tagged PRL-1, PRL-2, and PRL-3 expression vectors were constructed by PCR amplification of the corresponding cDNA. PCR products were cloned into pHAHA (15)
. Expression constructs were transfected into HCT-116 CRC cells seeded on glass chamber slides (Nalge Nunc; Lab-Tek, Christchurch, New Zealand). The expression of fusion proteins was detected by fluorescence microscopy and immunoblotting with a monoclonal anti PRL-3 antibody (MA no. 14) as described previously (15)
. Nuclei were counterstained with 1 µg/ml 4',6-diamidino-2-phenylindole.
Antibodies.
Rabbit polyclonal antibodies were raised against a PRL-3 COOH-terminal peptide (DPHTHKTRCCVM). Immunoreactive sera were affinity purified with the antigenic peptide. Monoclonal antibodies were raised against His and glutathione S-transferase-tagged recombinant PRL-3 produced in bacteria and purified using glutathione and nickel resin respectively (Ivratech, Inc., Kyiv, Ukraine). Specificity of the anti-PRL-3 antibodies was evaluated by ELISA assays and Western immunoblotting using recombinant PRL-1, PRL-2, and PRL-3 produced in CRC cells.
FISH Analysis.
The c-myc and the chromosome 8 centromeric probe (both labeled with Spectrum Orange) were obtained from Vysis (Downers, IL). PRL-3 probe was prepared by PCR amplification of the corresponding genomic locus using the following set of primers: PRL3-3F, CCAGGCTTTGTGACAGGACT; PRL3-3R, CTGGTTCAACCCCTCAATGT; PRL3-4F, TCTACAGCCCTGTCCTGCT; PRL3-4R GATCATTTCCCTGCCTGAGA; PRL3-5F, TTCTCTCAGGCAGGGAAATG; PRL3-5R, TCTCTGGTGTCCCTGAGGAT; PRL3-6F, CCACAGAGCTTGGTTGCATA; PRL3-6R, AACCAGGTGTCCACATTTCC; PRL3-7F, GAGGGAAGCAGACATGAGGA; PRL3-7R, ATGTCCAAGTCCTGGGTGAC; PRL3-8F, GGTGTCCCCACCTACATTCA; PRL3-8R, CCTTTGCTGTCCCAGATGTT; PRL3-9F, GGGACACGACCTGAGAAGTC; PRL3-9R, CCTTGGGTAGCAGGCAGTAG; PRL3-10F, TCTCCCCTTGCTATGTGTCC; PRL3-10R, AGTCCTGACTGCCGTGGTT; PRL3-11F, GGGCTAAGCTTGGGAGATTC PRL3-11R, CATAGGCTTGGGTCTGTGGT; PRL3-12F, GAGACCCAGGCCCTGTAGTT; PRL3-12R, CAGGTAGACCTGGCTTCTGG; PRL3-13F, CTTCTGTGCCACACACCAGT; PRL3-13R, AGGGTCACAGGAGCTGAAGA; PRL3-14F, TGGGTACATCCCTCAACCTC; and PRL3-14R, GTGGTCCCAGCTACTCAGGA.
Cycling conditions using Platinum Taq (Invitrogen) were: 94°C for 2 min, followed by 35 cycles of 94°C for 10 s, 58°C for 60 s, and 68°C for 30 s. PCR products were purified using the QiaQuick PCR purification kit (Qiagen, Valencia, CA) and labeled with biotin dUTP using nick translation as described previously (16) . Tissue sections were deparaffinized with xylene for 60 min three times and then washed in 100% ethanol for 10 min. Sections were dried completely and then incubated with 1 M NaSCN at 80°C for 15 min. Slides were then washed with water and treated with the protease solution (Vysis 32-801210) for 10 min at 45°C50°C. After digestion, the sections were rinsed 13 min in water and fixed with 10% buffered formalin for 10 min at room temperature. Sections were washed with 70% ethanol and then aged in 70% ethanol for 24 h at -20°C. FISH hybridization and detection were performed as previously described (16) with the following modifications. Aged slides were washed three times with water and immersed for 5 min in denaturing solution: 7 parts deionized formamide (American Bioanalytical, Natick, MA) three parts 2x SSC, pH 7.5) for 15 min at 73°C. At the end of the hybridization, slides were immersed in washing solution: 0.1% IGEPAL CA-630 (Sigma) and 2x SSC, final pH 7.5 for 2 min at 73°C.
Cell Culture.
The human colon cancer cell lines and their derivatives were cultured in McCoys 5A medium supplemented with 10% FCS and penicillin/streptomycin (Invitrogen Corp.).
Immunoprecipitation and Immunoblotting.
Cells were lysed with EB buffer [100 mM Tris (pH 7.4), 150 mM NaCl, 5 mM EDTA, 10% glycerol, 1% Triton X-100, and 1 mM sodium orthovanadate], and immunoprecipitation was performed with the indicated antibodies. Protein extracts were resolved via SDS-PAGE and transferred to polyvinylidene difluoride membranes by high-intensity wet blotting. Filters were probed with the indicated antibodies, and specific binding was detected by enhanced chemiluminescence system (Amersham).
| RESULTS |
|---|
|
|
|---|
|
|
|
|
2 test).
Evaluation of the PRL-3 Genomic Locus.
To assess the status of the PRL-3genomic locus in situ, we identified a bacterial artificial chromosome from chromosome 8q24.3 containing the entire gene and used it for FISH analyses of liver metastases derived from CRC. No true gene amplification was detected among 20 such cases. This is consistent with previous data showing that gene amplification is not a major cause of PRL-3 overexpression (7)
. However, we found that 9 of 20 cases had significantly increased copy numbers of PRL-3(i.e., >4 copies/cell; examples in Fig. 3, AC
). In all of these cases, the increases were associated with extra copies of chromosome 8q but not the entire chromosome 8. This was demonstrated through hybridization with a probe for chromosome 8 centromeric sequences (Fig. 3B)
. Through hybridization of adjacent slides to a bacterial artificial chromosome containing the c-myc gene, we found that a relatively large segment of chromosome 8q24, of size at least 12 Mb, was involved in all these cases (example in Fig. 3C
). This situation is different from that expected to result from gene amplification, wherein only a relatively small region, <2 Mb, is present at increased copy number.
|
Expression of PRL-3 in Cancer Cell Lines.
Additional studies of the role of PRL-3 in neoplasia would be facilitated if cancer cell lines expressing this gene were available. We therefore analyzed colorectal tissue samples as well as cell lines (passaged in vitro or as xenografts in nude mice) to determine whether any expressed high levels of PRL-3. We identified two cancer cell lines, V9P and V9M, respectively, derived from a CRC and a liver metastasis of the same patient, that exhibited relatively high levels of PRL-3 expression (Fig. 4, A and B)
. Five other lines that expressed somewhat lower levels of PRL-3 were also identified; each of these was derived from a CRC that had metastasized to lymph nodes or to the liver (Fig. 4B
and data not shown). In contrast, PRL-3 expression, as assessed by Northern blotting, was very low or absent in normal colonic epithelium.
|
To test the specificity of these antibodies, we also generated mammalian expression vectors for each of the PRL-3 family members and used them to transfect HCT-116 cells. The PRL-3 expression vectors were HA-tagged at their NH2 terminus to ensure equal levels of proteins in the transfected cell extracts (Fig. 5A)
. Western blotting performed with the various antibodies described above showed that the polyclonal antibody displayed specific reactivity with PRL-3 but not with PRL-1 or PRL-2 (Fig. 5A)
. Similarly, of 13 different monoclonal antibodies reactive with PRL-3, 1 (mAb MA no. 14) reacted with PRL-3 and PRL-2 and did not react with PRL-1. We first used these antibodies to determine whether PRL-3 protein was expressed at the expected levels in extracts of the CRC cell lines described above. We found that the levels of PRL-3 protein were consistent with the levels of PRL-3 mRNA, with the highest levels of protein found in cell line V9P (Fig. 5B)
.
|
|
| DISCUSSION |
|---|
|
|
|---|
The genomic FISH results show that increased copy numbers of PRL-3were present in 45% of the liver metastatic lesions but rarely in nonmetastatic primary lesions. This result is consistent with the idea that part of the increased PRL-3 expression is derived from the increased number of PRL-3 genes in the cell. However, this cannot be the whole story because elevated PRL-3 expression is observed in a much higher fraction (>95%) of metastases than is increased PRL-3 gene copy numbers. Nevertheless, it is possible that the increased copy number of PRL-3 accounts for a portion of the increased expression in a subset of tumors.
We previously identified a small amplicon containing the PRL-3 gene in a fraction of metastases [3 of 18 metastases analyzed, unpublished data and (7)
]. In these cases, there was >10-fold amplification of the gene (>20 copies/cell). Interestingly, we could not identify such amplifications through FISH. Although increased copy numbers of PRL-3 were observed in 45% of the cancers, these were always associated with increases of a large part of the telomeric region of chromosome 8q, encompassing
12 Mb, including c-myc and PRL-3, rather than localized to the PRL-3 gene itself. It is statistically possible that the cases we analyzed did not contain high level amplifications because these events are not common. However, we were able to perform FISH on one metastasis in which quantitative PCR results, as well as Southern blot hybridizations, demonstrated PRL-3 amplification, and only two signals for PRL-3/nucleus were observed in this case. One explanation for these results is that the small amplicon in these tumor cells, containing only 4050 Kb of sequence, was arranged in tandem form on chromosome 8q24.3 and therefore might not be resolvable as separate signals. Regardless, the new data are consistent with our previous data and definitively show that classic gene amplification is not the general cause of PRL-3 overexpression in CRC metastases.
Our Northern blotting results on cancer cell lines were consistent with previous quantitative PCR data showing that PRL-3 was expressed in metastatic cancer cells but not in earlier stages of tumorigenesis. However, quantitative PCR experiments showed that the level of PRL-3 expression in the metastatic cancer cell lines was still significantly less than that generally observed in metastatic cancer cells in vivo (data not shown). This agrees with previous data showing that the gene expression patterns in cancers in their natural setting can be considerably different from those of cell lines grown in artificial environments (17) .
In situ hybridization also revealed that PRL-3 was expressed in nearly all CRC metastases analyzed, whether these lesions were located in the liver or other tissues (Figs. 1
and 2
). In contrast, liver metastases derived from cancers which did not originate in the colon or rectum did not express PRL-3 at detectable levels. These results have two important implications. First, they demonstrate that the process of metastasis is associated with cell-type-specific gene expression. The earlier phases of tumorigenesis have been associated with cell-specific patterns of gene expression or mutation (18, 19, 20)
. However, this point has not been previously established for the late stages of tumorigenesis. It is important to note that PRL-3 is not expressed in normal colorectal epithelium or in nonmetastatic CRCs so that the expression of PRL-3 in metastases does not simply reflect the expression of the tissue of origin. Second, our results show that PRL-3 expression is not the result of residence of the metastatic cells in the liver. One might have imagined that the liver microenvironment induces the specific expression of PRL-3 in the same way as regenerating liver induces the expression of PRL-1 in hepatocytes (11
, 21)
. However, the new in situ data demonstrating PRL-3 expression in metastases to the lung, brain, and ovary exclude this possibility.
One possibility is that PRL-3 expression is required for the earlier phases of the metastatic process such as those required for invasion into the lymphatics or vasculature. The cell lines, expression vectors, and antibodies described here should considerably facilitate future studies to address this and related questions.
Note added in proof: Zeng et al. have recently reported that PRL-3 expression promotes cell migration, invasion, and metastasis in experimental systems (22).
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
A. B. and S. S. contributed equally to this work.
A. B. is on leave from the University of Torino, Medical School, Institute For Cancer Research, Candiolo, 10060 Torino, Italy.
Under a licensing agreement between the Johns Hopkins University and Genzyme Molecular Oncology and A. B., S. S., B. V., K. W. K., and V. E. V., the authors previously mentioned are entitled to a share of the royalties received by the university from the sales of licensed technologies relating to PRL-3. K. W. K. and V. E. V. are consultants to Genzyme. The university and researchers [B. V., K. W. K., V. E. V.] own Genzyme stock, which is subject to certain restrictions under university policy. The terms of these arrangements are being managed by the university in accordance with its conflict of interest policies.
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Requests for reprints: Dr. Bert Vogelstein, The Howard Hughes Medical Institute & The Sidney Kimmel Comprehensive Cancer Center, The Johns Hopkins Medical Institutions, 1650 Orleans Street, Baltimore, MD 21231. Phone: (410) 955-8878; Fax: (410) 955-0548; E-mail: vogelbe{at}welch.jhu.edu
4 The abbreviations used are: CRC, colorectal cancer; DIG, digoxin; FISH, fluorescent in situ hybridization; CRC, colorectal cancer; HA, hemagglutinin; VEGFR, vascular endothelial growth factor receptor. ![]()
Received 6/11/03; accepted 7/28/03.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
Z. Wang, S.-R. Cai, Y.-L. He, W.-H. Zhan, C.-Q. Chen, J. Cui, W.-H. Wu, H. Wu, W. Song, C.-H. Zhang, et al. High Expression of PRL-3 can Promote Growth of Gastric Cancer and Exhibits a Poor Prognostic Impact on Patients Ann. Surg. Oncol., January 1, 2009; 16(1): 208 - 219. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Daouti, W.-h. Li, H. Qian, K.-S. Huang, J. Holmgren, W. Levin, L. Reik, D. L. McGady, P. Gillespie, A. Perrotta, et al. A Selective Phosphatase of Regenerating Liver Phosphatase Inhibitor Suppresses Tumor Cell Anchorage-Independent Growth by a Novel Mechanism Involving p130Cas Cleavage Cancer Res., February 15, 2008; 68(4): 1162 - 1169. [Abstract] [Full Text] [PDF] |
||||
![]() |
U.-M. Fagerli, R. U. Holt, T. Holien, T. K. Vaatsveen, F. Zhan, K. W. Egeberg, B. Barlogie, A. Waage, H. Aarset, H. Y. Dai, et al. Overexpression and involvement in migration by the metastasis-associated phosphatase PRL-3 in human myeloma cells Blood, January 15, 2008; 111(2): 806 - 815. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Stephens, H. Han, G. Hostetter, M. J. Demeure, and D. D. Von Hoff Small interfering RNA-mediated knockdown of PRL phosphatases results in altered Akt phosphorylation and reduced clonogenicity of pancreatic cancer cells Mol. Cancer Ther., January 1, 2008; 7(1): 202 - 210. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-P. Sun, Y. Luo, X. Yu, W.-Q. Wang, B. Zhou, F. Liang, and Z.-Y. Zhang Phosphatase Activity, Trimerization, and the C-terminal Polybasic Region Are All Required for PRL1-mediated Cell Growth and Migration J. Biol. Chem., September 28, 2007; 282(39): 29043 - 29051. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Chia, N. Kusuma, R. Anderson, B. Parker, B. Bidwell, L. Zamurs, E. Nice, and N. Pouliot Evidence for a Role of Tumor-Derived Laminin-511 in the Metastatic Progression of Breast Cancer Am. J. Pathol., June 1, 2007; 170(6): 2135 - 2148. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Wang, S. Y. Quah, J. M. Dong, E. Manser, J. P. Tang, and Q. Zeng PRL-3 Down-regulates PTEN Expression and Signals through PI3K to Promote Epithelial-Mesenchymal Transition Cancer Res., April 1, 2007; 67(7): 2922 - 2926. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Liang, J. Liang, W.-Q. Wang, J.-P. Sun, E. Udho, and Z.-Y. Zhang PRL3 Promotes Cell Invasion and Proliferation by Down-regulation of Csk Leading to Src Activation J. Biol. Chem., February 23, 2007; 282(8): 5413 - 5419. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Achiwa and J. S. Lazo PRL-1 Tyrosine Phosphatase Regulates c-Src Levels, Adherence, and Invasion in Human Lung Cancer Cells Cancer Res., January 15, 2007; 67(2): 643 - 650. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Dumaual, G. E. Sandusky, P. L. Crowell, and S. K. Randall Cellular Localization of PRL-1 and PRL-2 Gene Expression in Normal Adult Human Tissues J. Histochem. Cytochem., December 1, 2006; 54(12): 1401 - 1412. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Guo, J. Li, H. Wang, M. Osato, J. P. Tang, S. Y. Quah, B. Q. Gan, and Q. Zeng PRL-3 Initiates Tumor Angiogenesis by Recruiting Endothelial Cells In vitro and In vivo Cancer Res., October 1, 2006; 66(19): 9625 - 9635. [Abstract] [Full Text] [PDF] |
||||
![]() |
L Wang, L Peng, B Dong, L Kong, L Meng, L Yan, Y Xie, and C Shou Overexpression of phosphatase of regenerating liver-3 in breast cancer: association with a poor clinical outcome Ann. Onc., October 1, 2006; 17(10): 1517 - 1522. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. S. El-Deiry, C. C. Sigman, and G. J. Kelloff Imaging and Oncologic Drug Development J. Clin. Oncol., July 10, 2006; 24(20): 3261 - 3273. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Fiordalisi, P. J. Keller, and A. D. Cox PRL tyrosine phosphatases regulate rho family GTPases to promote invasion and motility. Cancer Res., March 15, 2006; 66(6): 3153 - 3161. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Rouleau, A. Roy, T. St. Martin, M. R. Dufault, P. Boutin, D. Liu, M. Zhang, K. Puorro-Radzwill, L. Rulli, D. Reczek, et al. Protein tyrosine phosphatase PRL-3 in malignant cells and endothelial cells: expression and function. Mol. Cancer Ther., February 1, 2006; 5(2): 219 - 229. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. J. Stephens, H. Han, V. Gokhale, and D. D. Von Hoff PRL phosphatases as potential molecular targets in cancer Mol. Cancer Ther., November 1, 2005; 4(11): 1653 - 1661. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Polato, A. Codegoni, R. Fruscio, P. Perego, C. Mangioni, S. Saha, A. Bardelli, and M. Broggini PRL-3 Phosphatase Is Implicated in Ovarian Cancer Growth Clin. Cancer Res., October 1, 2005; 11(19): 6835 - 6839. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Li, K. Guo, V. W. C. Koh, J. P. Tang, B. Q. Gan, H. Shi, H. X. Li, and Q. Zeng Generation of PRL-3- and PRL-1-Specific Monoclonal Antibodies as Potential Diagnostic Markers for Cancer Metastases Clin. Cancer Res., March 15, 2005; 11(6): 2195 - 2204. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. L. Eckhardt, B. S. Parker, R. K. van Laar, C. M. Restall, A. L. Natoli, M. D. Tavaria, K. L. Stanley, E. K. Sloan, J. M. Moseley, and R. L. Anderson Genomic Analysis of a Spontaneous Model of Breast Cancer Metastasis to Bone Reveals a Role for the Extracellular Matrix Mol. Cancer Res., January 1, 2005; 3(1): 1 - 13. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. S. Parker, P. Argani, B. P. Cook, H. Liangfeng, S. D. Chartrand, M. Zhang, S. Saha, A. Bardelli, Y. Jiang, T. B. St. Martin, et al. Alterations in Vascular Gene Expression in Invasive Breast Carcinoma Cancer Res., November 1, 2004; 64(21): 7857 - 7866. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kato, S. Semba, U. A. Miskad, Y. Seo, M. Kasuga, and H. Yokozaki High Expression of PRL-3 Promotes Cancer Cell Motility and Liver Metastasis in Human Colorectal Cancer: A Predictive Molecular Marker of Metachronous Liver and Lung Metastases Clin. Cancer Res., November 1, 2004; 10(21): 7318 - 7328. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Wu, H. Zeng, X. Zhang, Y. Zhao, H. Sha, X. Ge, M. Zhang, X. Gao, and Q. Xu Phosphatase of Regenerating Liver-3 Promotes Motility and Metastasis of Mouse Melanoma Cells Am. J. Pathol., June 1, 2004; 164(6): 2039 - 2054. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Kozlov, J. Cheng, E. Ziomek, D. Banville, K. Gehring, and I. Ekiel Structural Insights into Molecular Function of the Metastasis-associated Phosphatase PRL-3 J. Biol. Chem., March 19, 2004; 279(12): 11882 - 11889. [Abstract] [Full Text] [PDF] |
||||
![]() |
T.-L. Wang, L. A. Diaz Jr., K. Romans, A. Bardelli, S. Saha, G. Galizia, M. Choti, R. Donehower, G. Parmigiani, I.-M. Shih, et al. Digital karyotyping identifies thymidylate synthase amplification as a mechanism of resistance to 5-fluorouracil in metastatic colorectal cancer patients PNAS, March 2, 2004; 101(9): 3089 - 3094. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |