| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Oncology, Markers, Clinical Correlates |
1 Departments of Molecular and Surgical Oncology and
2 Pathology, Medical Institute of Bioregulation, and
3 Department of Surgery and Science, Graduate School of Medical Sciences, Kyushu University
| ABSTRACT |
|---|
|
|
|---|
Experimental Design: We measured Cks1 expression using quantitative reverse transcription-PCR in 76 human gastric carcinomas and p27 expression using immunohistochemistry in 28 cases. Moreover, we established Cks1- and/or Skp2-transfected gastric carcinoma cell lines and assessed the relationship between Cks1, Skp2, and p27 expression using quantitative reverse transcription-PCR and Western blot analysis.
Results: Cks1 high expression was correlated with poor prognosis (P < 0.05) and Cks1 expression was inversely correlated with the expression level of p27 protein in gastric carcinomas (P < 0.05). Using combined Skp2 data [T-a. Masuda, Cancer Res., 62: 38193825, 2002], 88.9% of the Cks1/Skp2 double-high cases expressed a low level of p27 protein and showed the poorest prognosis (P < 0.05). Western blot analysis showed that Cks1/Skp2-cotransfected cells expressed a much lower level of p27 protein than the controls.
Conclusions: These findings indicate that Cks1, as well as Skp2, regulates the expression level of p27 protein in gastric carcinomas. Cks1 could play an important role in gastric carcinoma progression and would be a novel target for the treatment of gastric carcinomas as well as a strong prognostic marker.
| INTRODUCTION |
|---|
|
|
|---|
It is widely known that genetic or epigenetic changes in the p27 gene are rare in carcinomas (4) . One main mechanism responsible for the decreased level of p27 protein in carcinomas is the increased expression of SCFSkp2, especially Skp2 (5, 6, 7, 8, 9) , which is a substrate-specific receptor of p27 (10) . We also reported that Skp2 expression was correlated inversely with p27 expression and could be a prognostic factor in gastric carcinomas, and furthermore, Skp2 can modulate the malignant phenotype of gastric carcinomas possibly via p27 proteolysis (11) . However, the reduced expression of p27 seems to be not necessarily caused by Skp2 overexpression in carcinomas (6 , 9 , 11) .
Recently, human Cks1 has been identified as an essential and specific cofactor in the ubiquitination and degradation of p27 by SCFSkp2 (12 , 13) . Cks proteins were originally identified as subunits that interacted tightly with cyclin-Cdk complexes (14 , 15) . Human Cks1 binds to Skp2 and greatly increases the binding of threonine 187-phosphorylated p27 to Skp2 (12) . We hypothesized that Cks1 might be involved in p27 degradation in gastric carcinoma cases with low expression levels of both Skp2 and p27.
We therefore examined the relationship between Cks1 and p27 expression in vivo and clarified the clinical significance of Cks1 expression in human gastric carcinomas. We next established Cks1- or Skp2-transfected and Cks1/Skp2-cotransfected human gastric carcinoma cell lines and examined the relationship between Cks1, Skp2, and p27 expression in vitro.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell Culture.
The two different human gastric carcinoma cell lines, AZ521 and MKN28, were obtained from Cell Resource Center for Biomedical Research Institute of Development, Aging and Cancer, Tohoku University, and maintained in RPMI 1640 supplemented with 10% fetal bovine serum at 37°C in a 5% humidified CO2 atmosphere.
Antibodies.
Rabbit polyclonal antibody to Cks1 and mouse monoclonal antibodies to Skp2 and p27 were purchased from Santa Cruz Biotechnology (Santa Cruz, CA), Zymed Laboratories (San Francisco, CA), and Transduction Laboratories (Lexington, KY), respectively.
Quantitative RT-PCR Analysis.
Frozen tissue specimens or cultured cell lines in a state of subconfluency were homogenized, the total RNA was extracted using the modified acid-guanidine-phenol-chloroform method, and reverse transcriptase reaction was performed. The PCR amplification for quantification of Cks1, Skp2, p27, and GAPDH mRNA in tissues and cell lines was performed in the LightCycler using the LightCycler-FastStart DNA Master Sybr Green I kit (Roche Diagnostics). The amplification conditions of 40 cycles consisted of denaturation at 95°C for 10 s, annealing at 60°C for 10 s, and elongation at 72°C for 20 s. After the amplification, the products were subjected to a temperature gradient from 68°C to 95°C at 0.2°C/s with continuous fluorescence monitoring to produce a melting curve of the products. After proportional background adjustment, the fit point method was used to determine the cycle in which the log-linear signal was distinguished from the background and that cycle number was used as a crossing-point value. The standard curve was produced by measuring the crossing point of each standard value (2-fold serially diluted cDNAs of AZ521) and plotting them against the logarithmic value of concentrations. The concentrations of each sample were then calculated by setting their crossing points to the standard curve. The expression levels were normalized by GAPDH. We classified the cases into two groups; a Cks1 high expression group (T/N < 1; n = 41) and a Cks1 low expression group (T/N
1; n = 35). The expression level of Skp2 mRNA was classified into two groups; a high group (n = 50) and a low group (n = 26) according to the criteria described previously (11)
. The following primers were used (all 5' to 3' direction): Cks1 (179 bp) sense primer AGCAAACCGAGCGATCATGTC and antisense primer CCCATCCCTGACTCTGCTGAA; Skp2 (292 bp) sense primer GCTGCTAAAGGTCTCTGGTGT and antisense primer AGGCTTAGATTCTGCAACTTG; p27 (225 bp) sense primer ACGGGAGCCCTAGCCTGGAGC and antisense primer TGCCCTTCTCCACCTCTTGCC; and GAPDH (249 bp) sense primer TTGGTATCGTGGAAGGACTCA and antisense primer TGTCATCATATTTGGCAGGTT.
Immunohistochemistry.
Immunohistochemical studies of Cks1, Skp2 and p27 were performed on specimens available from 28 gastric carcinoma cases using the avidin-biotin-peroxidase method (LSAB2 kit; Dako, Kyoto, Japan) on formalin-fixed, paraffin-embedded tissues. All sections were counterstained with hematoxylin. The primary antibodies against Cks1, Skp2, and p27 were used at dilutions of 1:50, 1:500, and 1:1000, respectively.
p27 scores were measured by observing 1000 cancer cells in at least five high-power fields and were classified as high (staining in >50% of cells) or low (staining in
50% of cells) as described previously (2)
. The scoring was done independently by two observers (T. M. and Y. Y.).
Western Blot Analysis.
Total protein was extracted from samples with radioimmunoprecipitation assay buffer. Aliquots of total protein were applied to 15% acrylamide gradient gels. After electrophoresis, the samples were electroblotted onto a polyvinylidene membrane (Immobilon; Millipore, Inc., Bedford, MA) at 0.5 A for 30 min at 4°C. Cks1, Skp2, and p27 were detected using the antibodies at dilutions of 1:500, 1:2000, and 1:2500, respectively. The blots were developed with horseradish peroxidase-linked antirabbit or antimouse immunoglobulin (Promega, Inc., Madison, WI). Signals were detected using Supersignal (Pierce, Inc., Rockford, IL).
Transfection Assays.
We previously established stably Skp2-transfected gastric carcinoma cell lines (parent cell lines: AZ521 and MKN28; Ref. 11
). Human Cks1 cDNA was generated by RT-PCR and subcloned into a pcDNA3.1Hygro+ expression vector (Invitrogen, Carlsbad, CA) and then transfected into the Skp2-transfected cells and the mock cells using Lipofectamine (Life Technologies, Inc., Tokyo, Japan). Mock vector-transfected clones of each cell line were used for the control.
Statistical Analysis.
Associations between the variables were tested by the Fishers exact test. Survival curves were drawn according to the Kaplan-Meier method, and the survival analysis was carried out by the Mantel-Cox test when two curves were being compared or the Tarone-Ware test when three curves were being compared. Multivariate analysis to determine the patient prognosis was performed with Cox regression analysis with the forward stepwise model. All differences were deemed significant at the level of P < 0.05. The histological type of gastric carcinomas was classified on the basis of the criteria set by the Japanese Society for Cancer of the Stomach (16)
.
| RESULTS |
|---|
|
|
|---|
|
Correlation between Cks1 and p27 Expression in Gastric Carcinomas.
As shown in Table 1A
, 12 (70.6%) of 17 Cks1 high cases showed a low expression level of p27 protein and 8 (72.7%) of 11 Cks1 low cases showed a high expression level of p27 protein. Thus, Cks1 mRNA expression was inversely correlated with the expression level of p27 protein in gastric carcinomas (P < 0.05). Next, we classified these 28 cases into three groups: Cks1/Skp2 double-high group (n = 9); Cks1 high and Skp2 low or Cks1 low and Skp2 high group (n = 12); and Cks1/Skp2 double-low group (n = 7), and examined the correlation with the expression level of p27 protein. As shown in Table 1B
, 8 (88.9%) of 9 in the Cks1/Skp2 double-high group showed low expression level of p27 protein, and 6 (85.7%) of 7 in the Cks1/Skp2 double-low group showed a high expression level of p27 protein.
|
Clinical Significance of Cks1 Gene Expression in Gastric Carcinomas.
No significant difference was found between the high and low Cks1 expression groups regarding Skp2 expression and clinicopathological factors such as age, sex, histology, serosal invasion, lymph node metastasis, lymphatic or vascular invasion, and postoperative therapy (Table 2)
. As shown in Fig. 2A
, the Cks1 mRNA high expression group showed a significantly poorer prognosis than the low expression group (P = 0.018). On multivariate analysis for prognosis, Cks1 mRNA expression, Skp2 mRNA expression, lymph node metastasis, lymphatic involvement, and serosal invasion, which were found to be prognostic factors on univariate analysis, were included for the parameters. This analysis demonstrated that Cks1 mRNA expression was an independent prognostic factor (Table 3)
. Next, the 76 cases were classified into three groups: Cks1/Skp2 double-low group (n = 13); Cks1 or Skp2 high group (n = 35); and Cks1/Skp2 double-high group (n = 28), and survival analysis was performed (Fig. 2B)
. The Cks1/Skp2 double-high group showed the poorest prognosis, and the Cks1/Skp2 double-low group showed the best prognosis among the three groups (P = 0.013).
|
|
|
|
| DISCUSSION |
|---|
|
|
|---|
It was worth noting that the Cks1/Skp2 double-high expression group showed a low expression level of p27 protein in 8 (88.9%) of 9 cases, and the Cks1/Skp2 double-low expression group showed a high expression level of p27 protein in 6 (85.7%) of 7 cases. The Cks1/Skp2 double-high group showed the poorest prognosis, and the Cks1/Skp2 double-low group showed the best prognosis among the three groups. In the in vitro study, the Cks1/Skp2-cotransfected gastric carcinoma cells showed a markedly lower expression level of p27 protein than the controls. These findings indicate that both Cks1 and Skp2 overexpression more strongly promote the proteolysis of p27 than either Cks1 or Skp2 overexpression. Thus, Cks1 and Skp2 may cooperate in regulating the expression level of p27 protein in gastric carcinomas. These clinical and in vitro data suggest that, in most gastric carcinomas, the expression level of p27 is mainly regulated by the expression of Cks1 and Skp2 through ubiquitin-mediated proteolysis. To clarify the correlation between the Cks1/Skp2 expression and p27 proteolysis, additional studies using more gastric carcinoma tissues will be required.
It is unclear how Cks1 participates in the p27 ubiquitination by SCFSkp2. However, one possibility is that Cks1 associates with Skp2 and probably confers an allosteric change in Skp2, resulting in increasing its affinity for the phosphorylated p27 and consequently promoting p27 proteolysis (17 , 18) .
The mechanism of Cks1 and Skp2 overexpression in gastric carcinoma cells is uncertain. Recently, it was reported that the genomic locus of the Skp2 gene was amplified and the DNA copy number was closely associated with Skp2 expression in small cell lung carcinoma (8) . On the other hand, gene amplification of human chromosome 1q21, where the human Cks1 gene is located, has been reported in human epithelial malignancies (19 , 20) . Cks1 and Skp2 overexpression in carcinomas may be attributable to this gene amplification. We are now examining the genomic alterations of Cks1 and Skp2 and will clarify the mechanism of Cks1 and Skp2 overexpression in gastric carcinomas.
In conclusion, Cks1 expression was correlated inversely with the expression level of p27 protein and could be an independent prognostic factor in gastric carcinomas. Furthermore, Cks1 cooperates with Skp2 to strongly degrade p27 protein, and Cks1/Skp2 coexpression was correlated inversely with the expression level of p27 protein in gastric carcinomas. These findings strongly suggest that Cks1, in addition to Skp2, could play an important role in gastric carcinoma progression and would be a novel molecular target for the treatment of gastric carcinomas, as well as a strong prognostic marker.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Requests for reprints: Dr. Masaki Mori, Department of Molecular and Surgical Oncology, Medical Institute of Bioregulation, Kyushu University, Tsurumibaru 4546, Beppu 874-0838, Japan. Phone: 81-977-27-1650; Fax: 81-977-27-1651; E-mail: mmori{at}beppu.kyushu-u.ac.jp
4 The abbreviations used are: Cdk, cyclin-dependent kinase; RT-PCR, reverse transcription-polymerase chain reaction; Cks1, Cdk subunit 1; SCF, Skp1-Cullin-F-box protein; Skp, S-phase kinase associated protein; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. ![]()
Received 3/ 3/03; revised 7/22/03; accepted 7/22/03.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
H.-S. Martinsson-Ahlzen, V. Liberal, B. Grunenfelder, S. R. Chaves, C. H. Spruck, and S. I. Reed Cyclin-Dependent Kinase-Associated Proteins Cks1 and Cks2 Are Essential during Early Embryogenesis and for Cell Cycle Progression in Somatic Cells Mol. Cell. Biol., September 15, 2008; 28(18): 5698 - 5709. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Agarwal, T. G. P. Bumm, A. S. Corbin, T. O'Hare, M. Loriaux, J. VanDyke, S. G. Willis, J. Deininger, K. I. Nakayama, B. J. Druker, et al. Absence of SKP2 expression attenuates BCR-ABL-induced myeloproliferative disease Blood, September 1, 2008; 112(5): 1960 - 1970. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Kosaka, H. Inoue, T. Ohmachi, T. Yokoe, T. Matsumoto, K. Mimori, F. Tanaka, M. Watanabe, and M. Mori Tripartite Motif-Containing 29 (TRIM29) Isa Novel Marker for Lymph Node Metastasis in Gastric Cancer Ann. Surg. Oncol., September 1, 2007; 14(9): 2543 - 2549. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Zhan, S. Colla, X. Wu, B. Chen, J. P. Stewart, W. M. Kuehl, B. Barlogie, and J. D. Shaughnessy Jr CKS1B, overexpressed in aggressive disease, regulates multiple myeloma growth and survival through SKP2- and p27Kip1-dependent and -independent mechanisms Blood, June 1, 2007; 109(11): 4995 - 5001. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Sonoda, H. Inoue, K. Ogawa, T. Utsunomiya, T.-a. Masuda, and M. Mori Significance of Skp2 Expression in Primary Breast Cancer Clin. Cancer Res., February 15, 2006; 12(4): 1215 - 1220. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-Y. Huang, H.-Y. Kang, C.-F. Li, H.-L. Eng, S.-C. Chou, C.-N. Lin, and C.-Y. Hsiung Skp2 Overexpression Is Highly Representative of Intrinsic Biological Aggressiveness and Independently Associated with Poor Prognosis in Primary Localized Myxofibrosarcomas Clin. Cancer Res., January 15, 2006; 12(2): 487 - 498. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kitajima, Y. Kudo, I. Ogawa, T. Bashir, M. Kitagawa, M. Miyauchi, M. Pagano, and T. Takata Role of Cks1 Overexpression in Oral Squamous Cell Carcinomas: Cooperation with Skp2 in Promoting p27 Degradation Am. J. Pathol., December 1, 2004; 165(6): 2147 - 2155. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Hu, H. Sun, J. Drake, F. Kittrell, M. C. Abba, L. Deng, S. Gaddis, A. Sahin, K. Baggerly, D. Medina, et al. From Mice to Humans: Identification of Commonly Deregulated Genes in Mammary Cancer via Comparative SAGE Studies Cancer Res., November 1, 2004; 64(21): 7748 - 7755. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |