Clinical Cancer Research The Future of Cancer Research: Science and Patient Impact Infection and Cancer: Biology, Therapeutics, and Prevention
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Geller, J.
Right arrow Articles by Houghton, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Geller, J.
Right arrow Articles by Houghton, J. A.
Clinical Cancer Research Vol. 9, 6504-6515, December 15, 2003
© 2003 American Association for Cancer Research

Experimental Therapeutics, Preclinical Pharmacology

Interferon-{gamma}–Induced Sensitization of Colon Carcinomas to ZD9331 Targets Caspases, Downstream of Fas, Independent of Mitochondrial Signaling and the Inhibitor of Apoptosis Survivin

James Geller, Istvan Petak, Kinga Szekely Szucs, Katalin Nagy, David M. Tillman and Janet A. Houghton

Division of Molecular Therapeutics, Department of Hematology-Oncology, St. Jude Children’s Research Hospital, Memphis, Tennessee


   ABSTRACT
Top
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We have demonstrated previously a Fas-dependent component in thymineless death of human colon carcinoma cells. Importantly, the cytotoxic effects of thymidine deprivation induced by 5-fluorouracil (FUra) combined with leucovorin (LV) was enhanced by IFN-{gamma}, and the synergism was shown to be dependent on Fas, FUra-induced DNA damage, and independent of p53. Subsequently we examined the potential for synergistic interactions between IFN-{gamma} and the specific thymidylate synthase inhibitor, ZD9331. IFN-{gamma} sensitized colon carcinomas to ZD9331-induced apoptosis and loss in clonogenic survival, also dependent on ZD9331-induced DNA damage, independent of p53. Synergism occurred in HCT116, demonstrating previously RNA-mediated FUra/LV cytotoxicity that could not be potentiated by IFN-{gamma}. Manipulation of the Fas death receptor pathway from the level of the receptor (Nok1/Nok2, Fas overexpression, and DN-FADD) to the mitochondria (Bcl-xL and Bcl-2) did not modulate ZD9331 ± IFN-{gamma}-induced cytotoxicity in HT29, with the exception that Nok1/Nok2-blocking antibodies partially protected HT29 from the cytotoxic activity of ZD9331 alone. However, IFN-{gamma} alone (but not ZD9331) up-regulated the expression of caspases -3, -4, -7, and -8, and in combination with ZD9331 demonstrated enhanced caspase activation and cleavage of poly(ADP-ribose) polymerase that was not prevented by overexpression of Bcl-2. Additionally, IFN-{gamma} increased the activity of the proteasome in HT29, leading to selective down-regulation of the antiapoptotic protein survivin, whereas simultaneously increasing Fas expression. However, reduction in the survivin:Fas ratio by transfection of survivin small interfering RNA and/or overexpression of Fas did not affect sensitivity of HT29 to ZD9331 ± IFN-{gamma}. Data demonstrate that IFN-{gamma} combined with ZD9331 is synergistic in additional cell lines that demonstrate RNA-mediated FUra/LV cytotoxicity, and that a major target of interaction is at the level of caspases, downstream of Fas, and independent of involvement of either the mitochondria or survivin.


   INTRODUCTION
Top
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Thymidylate synthase (TS) inhibitors continue to maintain their role as first line chemotherapy for the treatment of colorectal cancer. Efforts to maximize efficacy of TS inhibitor-based regimens have addressed ways to selectively modulate the cellular response to TS inhibition in tumor cells in vivo (1 , 2) , as well as to develop newer, more specific TS inhibitors (3) . Effective modulation in enhancing the therapeutic selectivity of 5-fluorouracil (FUra) has been achieved with the reduced folate leucovorin (LV), which potentiates the anti-TS effects of FUra, resulting in more extensive induction of thymineless stress and cellular cytotoxicity (1) . For these reasons, combinations of FUra with LV have proven superior to FUra alone (4) . Other efforts have focused on antisense approaches (5 , 6) to down-regulate important determinants of the cellular response to TS inhibitors including TS itself, or alternatively, dUTPase, an enzyme involved in maintaining intracellular nucleotide homeostasis after TS inhibition (7) . Additional modulation of colorectal carcinoma tumor biology, with promising preclinical (8) and clinical (9) activity, is evident from our previous reports demonstrating that IFN-{gamma} is synergistic in potentiating the cytotoxic effect of FUra/LV in human colon carcinoma cell lines, in part by modulation of the Fas death receptor and its signaling pathway (8) . IFN-{gamma} in combination with FUra/LV has already demonstrated activity in a Phase I trial (9) , and currently this regimen is entering Phase II clinical investigation. The interaction mechanism requires FUra/LV-induced DNA damage, does not affect tumor cells that demonstrate FUra-induced RNA-mediated cytotoxicity, and is independent of p53 (8) .

IFN-{gamma} is a type II IFN known for its critical role in promotion of both the innate and adaptive immune responses, essential for host defense against infection (10) . Promotion of the host response in immune surveillance of human cancers is also well documented (10) . The mechanism(s) by which this cytokine modulates gene expression in cancer cells are unclear; however, >200 genes are known to be transcriptionally regulated by IFN-{gamma} (11 , 12) .

More specific TS inhibitors including ZD1694 or ZD9331 (AstraZeneca; Refs. 13, 14, 15 ) were developed and have now undergone Phase III trials. Tomudex is a quinazoline-based folic acid analogue that acts directly and specifically at inhibiting TS. In vivo, tomudex appears to be equally effective compared with FUra/LV-based regimens, yielding similar median survival times to those achieved with standard FUra/LV regimens (16) . Despite demonstrable activity in several clinical trials, resistance to tomudex has been evident in some colon cancers due to mutations in the reduced folate carrier required for cellular uptake of the drug (17) , low TS levels (17) , low thymidine phosphorylase levels (18) , or low folylpolyglutamate synthase (17 , 19 , 20) required for polyglutamylation. ZD9331, a specific water-soluble quinazoline-based nonpolyglutamatable TS inhibitor, was developed to obviate some of these pitfalls (20) . The reduced folate carrier is still required for cellular uptake of this drug; however, resistance via low tumor levels of folylpolyglutamate synthase is circumvented. In addition, ZD9331 is 150 times more potent in inhibiting TS than tomudex (15) .

On the basis of previous work in our laboratory demonstrating synergism between FUra/LV and IFN-{gamma} in tumor cell killing in human colon carcinoma cell lines, we now demonstrate that IFN-{gamma} and the specific TS inhibitor, ZD9331, also exert a synergistic cytotoxic effect in these model systems. In contrast to FUra combined with LV, ZD9331 ± IFN-{gamma} displays a broader range of cytotoxicity that occurs via a thymineless stress-induced cell death mechanism. We also demonstrate that Fas receptor modulation via the use of blocking antibodies (Nok1/Nok2) partially inhibits cytotoxicity induced by ZD9331 but not ZD9331 + IFN-{gamma}, whereas overexpression of Fas partially promotes Fas-mediated cytotoxicity, but does not increase the cytotoxic action of ZD9331 ± IFN-{gamma}. In addition, blocking signaling upstream of the mitochondria by dominant negative fas-associated death domain (DN-FADD) or at the level of the mitochondria by overexpression of Bcl-xL or Bcl-2, did not inhibit the cytotoxic activity of ZD9331 ± IFN-{gamma}, suggesting that a major target of interaction between ZD9331 and IFN-{gamma} occurs downstream of Fas and its associated death-inducing signaling complex, and is independent of the mitochondria. Similar to Bcl-2 and Bcl-xL, no role was identified for survival factors of the inhibitor of apoptosis (IAP) family or nuclear factor {kappa}B (NF{kappa}B). Noteworthy is that survivin was down-regulated after IFN-{gamma} treatment due to IFN-{gamma}-induced proteasomal degradation of this IAP member. Whereas the overall effect of IFN-{gamma} was to decrease the survivin:Fas ratio, dramatic alteration of this ratio using combined isogenic Fas overexpression and small interfering RNA (siRNA) suppression of survivin did not affect the cytotoxic response of ZD9331/IFN-{gamma} combinations. Although a dominant role for either the Fas death receptor, signaling upstream of the mitochondria, or survivin could not be definitively demonstrated in the synergistic interaction between ZD9331 and IFN-{gamma}, it is evident that IFN-{gamma} increased the expression of vital caspases and, in combination with ZD9331, resulted in increased caspase activation that could not be inhibited by overexpression of Bcl-2, confirming that signaling downstream of the mitochondria is critical to synergy observed when ZD9331 and IFN-{gamma} are combined.


   MATERIALS AND METHODS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Cell Lines.
The HT29 human colon carcinoma cell line was obtained from American Tissue Type Culture Collection, and VRC5/cl was established as reported previously (21 , 22) . HCT116 and HCT116 p53-/- were obtained from Dr. Bert Vogelstein (Johns Hopkins University, Baltimore, MD). Cell cultures were maintained in low folate-containing, thymidine (dThd)-free media composed of RPMI 1640 containing 10% dialyzed fetal bovine serum, 80 nM [6RS]5-methyltetrahydrofolate, and 712 µM Ca2+ (8) .

Retroviral Expression Vectors.
The retroviral expression vectors pMSCV-I-GFP [expressing green fluorescent protein (GFP)], pMSCV-Fas, (expressing human Fas and GFP separated by an internal ribosomal entry site sequence), and pMSCV-DN-FADD (expressing the death domain only of FADD) were kind gifts from Drs. Jill M. Lahti and Vincent J. Kidd (St. Jude Children’s Research Hospital) and have been described previously (23) . The retroviral expression vector pMSCV-Bcl-xL (expressing human Bcl-xL and GFP, separated by an internal ribosomal entry site sequence) and pMSCV-Bcl-2 (expressing human Bcl-2 protein) were kindly provided by Dr. John Cleveland (St. Jude Children’s Research Hospital). Retroviral supernatants were prepared as described previously (24) . HT29 cells were incubated overnight in a 50% mixture of RPMI 1640 and supernatant in the presence of Polybrene (8 µg/ml; Sigma). After replacement of this medium with fresh viral supernatants and culture medium, HT29 cells were incubated at 37° for an additional 48 h. The viral-transferred cells were isolated according to GFP expression using a fluorescence-activated cell sorter (Becton Dickinson), and stable GFP-positive cells were selected. The expression of Bcl-xL and Bcl-2 were confirmed by Western blotting. The expression of Fas was analyzed as in "Materials and Methods" describing Fas expression.

Immunoblotting.
HT29, HT29GFP, HT29Bcl-xL, or HT29Bcl-2 cells were treated with ZD9331 (100 nM) ± IFN-{gamma} (100 units/ml) for 24–72 h, followed by determination of the level of expression of procaspases-3 (Alexis Corporation), -4, -6, -7, -8, and -9 (MBL International Corp., Woburn, MA), as well as determination of the cleavage of procaspase-3, -7, -8, and poly(ADP-ribose) polymerase (Transduction Laboratories) by Western analysis. HT29 cells were also treated with IFN-{gamma} (100 units/ml) ± MG132 (1 µM) for 48 h, and the levels of survivin (R&D Systems), Bcl-xL (Transduction Laboratories), XIAP (MBL), cellular FLICE inhbitory protein (c-FLIP) (Upstate), and cellular IAP-1 (c-IAP-1) (Alexis Corporation) were assessed by Western analysis. The fold reduction in survivin expression after treatment of HT29Fas cells with siRNA (400 nM) directed to the survivin gene was determined by absorbance measurements using NIH Image Software Version 1.61. Antibodies used for confirmation of successful retroviral transduction also include FADD and Bcl-2 (Transduction Laboratories). ZD9331 was a generous gift from Astrazeneca.

Clonogenic Survival Assays.
Cell lines were plated at a density of 1500 cells/well in six-well plates (Costar). After overnight attachment, cells were treated, in triplicate, with the various treatment conditions for 72 h. Subsequently the media were aspirated and replaced with media supplemented with dThd (20 µM). Cells were harvested 5–7 days later (the equivalent of seven doubling times), and clonogenic survival was evaluated as described previously (21) .

Apoptosis Assays.
Cell lines were plated at a density of 100,000–200,000 cells/well in six-well plates. After overnight attachment, HT29GFP cells were treated with ZD9331 (100 nM) ± IFN-{gamma} (100 units/ml) ± dThd (20 µM) for 72, 96, and 144 h. All of the cells, both floating and attached, were combined after trypsinization. After fixation with 70% ethanol, samples were stored at -20°C. Before analysis, samples were prepared in 1 ml of Na2HPO4 buffer (pH 7.8) containing 50 µg/ml RNase and filtered. Apoptotic cells were detected as a sub-G1 fraction after ethidium bromide staining and analyzed using a Becton Dickinson FACScan (25) .

Fas Expression.
HT29, HT29GFP, HT29Fas, HCT116, or HCT116p53-/- cells were either untreated or treated with ZD9331 (50 nM) for 24 h. Cell surface Fas expression was determined by fluorescence-activated cell sorter analysis using standard procedures (26) . The method involved use of a phycoerythrin-labeled anti-Fas monoclonal antibody (clone DX2; PharMingen) and phycoerythrin staining calibrated using Quantibright (Becton Dickinson) beads. The mean fluorescence intensity values were converted to number of phycoerythrin molecules/cell using Quantiquest software.

cDNA Microarrays.
HT29 cells, cultured in a T75 flask, were treated when 50–70% confluent, with IFN-{gamma} (100 units/ml) or ZD9331 (50 nM; IC50) for 24 h. RNA was collected using standard techniques using RNAzolB (TEL-TEST Inc.). Specifically, cells were washed with Hank’s buffered solution (10 ml), RNAzolB (5 ml) was added to each flask, cells were lysed by gentle rocking of the flasks, and RNA was solubilized by up-and-down pipetting (x10). Mixtures were transferred to 13-ml Sarstedt tubes, and chloroform (0.1 ml/ml of homogenate) was added. The tubes were shaken vigorously (15 s), placed on ice (5 min), and subsequently centrifuged (10,000 rpm, 4°, 15 min). The upper aqueous phase was transferred from each sample to fresh tubes and mixed with an equal volume of isopropanol. After 15 min incubation on ice, samples were centrifuged again (10,000 rpm, 4°, 15 min) to pellet the RNA. Supernatants were decanted, and the remaining RNA was washed once with 75% ethanol (5 ml). Samples were vortexed and centrifuged (8,000 rpm, 4°, 8 min). The ethanol was decanted and RNA pellets dried under vacuum for 10–15 min. Each RNA sample was dissolved in diethyl pyrocarbonate water, diluted (1:250), and the 260 nm:280 nm ratio determined by absorbance. A minimum cutoff ratio of 1.8 was used to assess the purity and concentration of collected RNA. Concentrations of RNA of ~2 µg/µl were obtained and additionally processed through standard quality assessment by the Functional Genomics microarray facility at the Hartwell Center for Bioinformatics and Biotechnology, St. Jude Children’s Research Hospital. The human cDNA microarray, constructed by the Functional Genomics microarray facility at St. Jude Children’s Research Hospital, contains ~9,400 PCR products corresponding to human expressed sequence tags (the Human Unigene 1 collection) obtained from Incyte Genomics (Palo Alto, CA) designated as the H1 chip. Data files generated from the chip experiments were imported to Spotfire Decisionsite for Functional Genomics (Spotfire Inc., Somerville, MA) for additional analysis. Outliers were identified using Cy5:Cy3 ratios after background subtraction, filtering of bad spots (improper morphology, small size, intensity to background ratio <1.4 and so forth), and global normalization. Dye flip replicates were performed for every experiment. Average fold-changes and 95% confidence intervals were generated from analysis of eight experiments.

Proteasome Kinetics Assay.
HT29 cells were treated with IFN-{gamma} (100 units/ml) ± MG132 (1 µM) for 48 h. Cells (5 x 105) were collected and washed twice in PBS. PBS (100 µl) containing 5 mM EGTA was added, and the cells were subsequently plated in a 96-well plate. Assay buffer [100 µl; PBS-5 mM EGTA containing 20 mM DTT and 50 µM suc-leu-leu-val-tyr (LLVY)-amino-coumarin (AMC)] was added last to yield a final concentration in each well of 5 mM EGTA, 10 mM DTT, and 25 µM LLVY-AMC. Cells were incubated at 37°C for 10 min. LLVY-AMC is a specific substrate of the chymotryptic component of the proteasome complex. The active proteasome cleaves off the AMC-end of the substrate yielding free AMC that is fluorogenic, and measurable at an extinction wavelength of 390 nm and at an emission wavelength of 460 nm with the CytoFluor 2300 System. Proteasome activity was measured over a period of 30 min.

siRNA Transfections.
HT29GFP and HT29Fas cells were plated at a density of 50,000 cells/well in six-well plates (Costar). After overnight fixation, transfection with 21-mer siRNA oligonucleotides directed against the survivin gene was performed using oligofectamine according to the manufacturer’s instructions (Invitrogen Life Technologies, Inc., Carlsbad, CA). The survivin siRNA sequence used was AAGCAUUCGUCCGGUUGCGCU, and a Duplex siRNA sequence (Scramble II Duplex), used as a control, was GCGCGCUUUGUAGGAUUCGdTdT (Dharmacon Research Inc., Lafayette, CO). Each siRNA was 2'-deprotected, desalted, annealed, and purified by the manufacturer. For clonogenic assays, after a 6-h transfection period, cells were collected, counted using a Coulter Counter, and replated in six-well plates at a density of 1,000 cells/well. Nontransfected HT29GFP and HT29Fas cells from the same passage were also plated as such at this time and used as additional controls. After overnight fixation, the cells were treated, in triplicate, with ZD9331 (0–100 nM) ± IFN-{gamma} (100 units/ml) and ± dThd (20 µM) for 72 h, and subsequently analyzed for clonogenic survival. Western analysis confirming survivin protein down-regulation at 24 h after transfection, as described previously, was performed each time siRNA was used. Additionally, survivin expression in HT29, with or without siRNA transfection, was assayed via Western analysis at multiple time points to determine the expected duration of protein suppression.


   RESULTS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
ZD9331 and IFN-{gamma} Are Synergistic in Human Colon Carcinoma Cell Lines Independent of p53.
In clonogenic survival assays, ZD9331 demonstrated cytotoxicity in the nM range (IC50 {approx}50 nM or less) in all of the cell lines examined (HT29, VRC5/c1, HCT116, and HCT116p53-/-). In all of the cases ZD9331-induced cytotoxicity was reversible by dThd, consistent with thymineless stress (and subsequent DNA damage) induced by TS inhibition as the predominant mechanism of cell death. IFN-{gamma} potentiated the cytotoxic activity of ZD9331 in a synergistic manner in all of the cell lines, an effect that was reversed by dThd supplementation in all of the cell lines tested, thereby demonstrating the requirement for ZD9331-induced DNA damage in the mechanism of sensitization by IFN-{gamma} (Fig. 1)Citation . HT29, VRC5/c1, and HCT116p53-/- maintain a mutant p53 phenotype, whereas HCT116 is wild-type for p53, demonstrating the p53 independence of the interaction between ZD9331 and IFN-{gamma}, similar to the that observed between FUra/LV and IFN-{gamma} (26) .



View larger version (27K):
[in this window]
[in a new window]
  		Fig. 1. ZD9331-induced cytotoxicity, determined by clonogenic survival, is potentiated by IFN-{gamma} and reversed by thymidine (dThd). Cell lines were treated with various concentrations of ZD9331 (0–100 nM) either in the absence or presence of IFN-{gamma} (100 units/ml) or dThd (20 µM) for 72 h. Data represent the mean of three determinations at each concentration of ZD9331; bars, ±SD.

 
ZD9331 ± IFN-{gamma} Induce Apoptosis.
After 72-h exposure, quantitation of the sub-G1 compartment via fluorescence-activated cell sorter analysis demonstrated ZD9331-induced apoptosis in HT29GFP cells, potentiated in the presence of IFN-{gamma}, and reversible by dThd (Fig. 2A)Citation , consistent with data derived in clonogenic survival assays (Fig. 1)Citation . Coincubation with the pan-caspase inhibitor ZVAD-FMK (50 µM) for 72 h was inhibitory to the induction of apoptosis induced by ZD9331 (0–100 nM) ± IFN-{gamma} (100 units/ml) by {approx}50% in comparison with N-benzyloxycarbonyl Phe-Ala fluoromethylketone (ZFA) (20 µM; control; Fig. 2BCitation ). Clonogenic survival assays also demonstrated partial protection from ZD9331 ± IFN-{gamma}-induced cytotoxicity by ZVAD-FMK (Fig. 2C)Citation .



View larger version (24K):
[in this window]
[in a new window]
  		Fig. 2. ZD9331 induces apoptosis. A, HT29 cells were treated for 72 h with ZD9331 (100 nM) ± IFN-{gamma} (100 units/ml) ± thymidine (dThd) (20 µM); B, HT29 cells, 2 h after pretreatment with either the pan-caspase inhibitor ZVAD-FMK (50 µM) or control (ZFA; 20 µM) were treated with ZD9331 (0–100 nM) ± IFN-{gamma} (100 units/ml) for 72 h and apoptosis (B) or clonogenic survival (C) determined. Results are the means of two (B) or three (C) determinations per point; bars, ±SD.

 
p53 Influences the Induction of Fas Expression by ZD9331.
We demonstrated previously that IFN-{gamma} up-regulates Fas expression in human colon carcinoma cell lines independent of p53 (8) . In contrast, FUra/LV-induced elevation in Fas expression is influenced by the p53 status, the increase being considerably greater in the presence of wild-type p53 (26) . After 24-h exposure to ZD9331 (50–100 nM), Fas was elevated by 0.5–1-fold in HT29 (mp53) and HCT116p53-/- (p53 null), similar to results obtained with FUra/LV (26) , in contrast to HCT116 (wild-type p53), which demonstrated 2.5-fold elevation in Fas expression (Fig. 3A)Citation . These results demonstrate a role for p53 in enhancing up-regulation of Fas in response to ZD9331. Of note in HT29, Fas up-regulation by IFN-{gamma} (3.5-fold) was not enhanced by coexposure to ZD9331 (data not shown).



View larger version (16K):
[in this window]
[in a new window]
  		Fig. 3. In HT29 ZD9331 induces increased Fas expression, and overexpression of Fas partially sensitizes cells to Fas ligand (sFasL)-induced loss in clonogenic survival. A, fluorescence-activated cell sorter analysis of cell surface Fas expression in HT29, HCT116wt, and HCT116p53-/- cells after 24-h exposure to ZD9331 (50–100 nM); B, fluorescence-activated cell sorter analysis of cell surface Fas expression in HT29 cells retrovirally transduced with vector alone (HT29GFP) or vector containing a human Fas cDNA (HT29Fas); C, HT29GFP or HT29Fas were treated with sFasL (50 ng/ml) for 72 h, and the effect on clonogenic survival determined. Results in A and B constitute duplicate determinations, and in C the mean of three determinations; bars, ±SD.

 
Overexpression of Fas Sensitizes HT29 to Fas-Mediated Cytotoxicity.
HT29Fas was derived to critically evaluate the role of up-regulation of Fas expression alone in Fas-mediated or ZD9331-induced cytotoxicity. Retroviral transduction of Fas (HT29Fas) in comparison with vector control (HT29GFP), yielded a 28.7-fold increase in the expression level of Fas (Fig. 3B)Citation . Clonogenic survival assays after 72-h exposure to soluble Fas ligand (sFasL) (50 ng/ml) demonstrated enhanced sensitivity to ligation of the Fas death receptor in HT29Fas, where clonogenic survival was decreased by {approx}70% (Fig. 3C)Citation .

ZD9331 + IFN-{gamma} Demonstrate Interaction Sites Downstream of Fas.
In HT29 cells after 72-h exposure to varied concentrations of ZD9331 (0–100 nM), ZD9331-induced loss in clonogenic survival was completely reversed by dThd and partially inhibited in the presence of Nok1/Nok2 antibodies that block Fas/Fas ligand (FasL) interactions (500 ng/ml each), similar to data derived for FUra/LV (8) . However, no protection after coincubation with Nok1/Nok2 antibodies was demonstrated when the cytotoxic activity of ZD9331 was potentiated in the presence of IFN-{gamma} (100 units/ml; Fig. 4ACitation ). The cytotoxic activity of ZD9331 ± IFN-{gamma} was examined subsequently in HT29GFP in comparison with HT29Fas after 72-h drug exposures (Fig. 4B)Citation . Loss in clonogenic survival was similar for ZD9331 alone or in combination with IFN-{gamma} in both HT29GFP and HT29Fas. Data suggest that although sensitivity to TS inhibitors may be influenced by Fas, other targets downstream of the Fas death receptor are involved in the synergistic interaction between IFN-{gamma} and ZD9331.



View larger version (20K):
[in this window]
[in a new window]
  		Fig. 4. Influence of blocking Fas/Fas ligand (FasL) interactions or overexpression of Fas on the cytotoxicity of ZD9331 ± IFN-{gamma}. A, HT29 cells were treated with ZD9331 (0–100 nM) ± IFN-{gamma} (100 units/ml) either in the presence or absence of Nok-1/Nok-2 Fas/FasL blocking antibodies (500 ng/ml each) for 72 h and clonogenic survival determined. Data are the mean of three determinations per point. B, HT29GFP or HT29Fas were treated with ZD9331 (0–50 nM) ± IFN-{gamma} (100 units/ml) for 72 h, and clonogenic survival determined (mean; n = 3); bars, ±SD.

 
Influence of DN-FADD or Bcl-xL Overexpression on Cytotoxicity Induced by ZD9331± IFN-{gamma} in HT29 Isogenic Cell Lines.
Clonogenic survival assays were undertaken in HT29 isogenic cell lines to determine the role of signaling upstream of the mitochondria (DN-FADD), or involvement at the level of the mitochondria (Bcl-xL overexpression), in ZD9331-induced cytotoxicity either alone or in combination with IFN-{gamma}. DN-FADD did not protect HT29 cells from ZD9331 (0–100 nM) either in the absence or presence of IFN-{gamma} 100 units/ml (Fig. 5A)Citation . Similarly, transfection of DN-caspase-8 (23) did not protect these cells from the cytotoxic activity of ZD9331 ± IFN-{gamma} (data not shown). Furthermore, at the level of the mitochondria, Bcl-xL overexpression did not protect cells from ZD9331-induced cytotoxicity alone or in combination with IFN-{gamma} (Fig. 5B)Citation , neither did Bcl-2 overexpression afford protection (data not shown). Data suggest that target(s) downstream or independent of the mitochondria are involved in the interaction between ZD9331 and IFN-{gamma}.



View larger version (30K):
[in this window]
[in a new window]
  		Fig. 5. Clonogenic survival of (A) HT29GFP and HT29DN-FADD or (B) HT29GFP and HT29Bcl-xL, after 72-h exposure to ZD9331 (0–100 nM) ± IFN-{gamma} (100 units/ml) ± thymidine (dThd; 20 µM). Data represent the mean of three determinations for each concentration of ZD9331. C, Western analysis confirms expression of DN-FADD and Bcl-xL in the HT29 isogenic cell lines compared with HT29GFP control; bars, ±SD.

 
Expression and Activation of Caspases.
After 24-h exposure of HT29 cells to IFN-{gamma} (100 units/ml), mRNA for caspases-1, -3, -4, -5, -7, and -8 but not caspases -2, -6, or -9 were elevated by >2-fold as analyzed by cDNA microarray (Table 1)Citation . In contrast, mRNA for the caspases was not significantly elevated after 24-h exposure of HT29 to ZD9331 (50 nM; Table 1Citation ). Expression of procaspases -3, -4, -7, and -8, but not procaspases -6 or -9, determined by Western analysis, were elevated as early as 24 h, and consistently by 48 h, after exposure to IFN-{gamma} (100 units/ml; Fig. 6ACitation ). No elevation in caspase expression after treatment with ZD9331 (50 nM) was evident by Western analysis (Fig. 6A)Citation , consistent with data obtained from cDNA microarray analysis. When ZD9331 and IFN-{gamma} were combined, activation of caspases -3 and –7, and cleavage of poly(ADP-ribose) polymerase were potentiated at 48 h (Fig. 6A)Citation and caspase-8 at 72 h (data not shown). IFN-{gamma}-induced up-regulation of caspases -3, -4, -7, and –8, and enhanced caspase activation after treatment with ZD9331 + IFN-{gamma} were also found in the presence of Bcl-2 overexpression (Fig. 6B)Citation , indicating no Bcl-2 inhibitory effect on caspase activation, consistent with the lack of protection of Bcl-xL or Bcl-2 seen in clonogenic survival assays.


View this table:
[in this window]
[in a new window]
  		Table 1 C-DNA microarray analysis of caspase expression

 


View larger version (39K):
[in this window]
[in a new window]
  		Fig. 6. Up-regulated expression and activation of caspases play a significant role in IFN-{gamma}-induced sensitization to ZD9331 in HT29 that is not inhibited by Bcl-2: HT29 cells were treated with ZD9331 (100 nM), IFN-{gamma} (100 units/ml), either alone or in combination for 24, 42, or 48 h either in the absence (A) or presence (B) of Bcl-2 overexpression. Expression and activation of caspases and cleavage of poly(ADP-ribose) polymerase were determined by Western blotting as described in "Materials and Methods." C, expression level of Bcl-2 determined by Western analysis after retroviral transduction (HT29Bcl-2).

 
IFN-{gamma} Up-Regulates Proteasomal Activity and Down-Regulates Expression of Survivin in HT29.
Proteasome kinetic assays demonstrated a marked increase in proteasomal chymotryptic activity after 48-h exposure to IFN-{gamma} (100 units/ml), inhibited after simultaneous exposure of HT29 cells to the proteasome inhibitor MG132 (1 µM; Fig. 7ACitation ). These data are in concordance with cDNA microarray analyses of IFN-{gamma}-treated HT29 cells, which demonstrated significant elevation in expression of 34 of 35 cDNA oligonucleotides designated on the microarray to represent the genes that encode proteasomal subunits after IFN-{gamma} (100 units/ml) exposure for 24 h (data not shown). Expression of survival factors known to be degraded by proteasomal cleavage and to be expressed in HT29 (XIAP, c-FLIP, c-IAP1, Bcl-xL, and survivin) were examined after treatment with IFN-{gamma} (100 units/ml) for 48 h (Fig. 7B)Citation . Survivin expression was decreased by 48 h, whereas expression of other antiapoptotic proteins was unaffected by IFN-{gamma} treatment. IFN-{gamma}-induced down-regulation of survivin expression was attenuated by inhibition of proteasomal activity (MG132, 1 µM; Fig. 7CCitation ). Activation of the proteasome can also increase the activation of NF{kappa}B. However, treatment of HT29 cells with IFN-{gamma} (100 units/ml) did not activate NF{kappa}B as determined by electrophoretic mobility shift analysis (data not shown).



View larger version (30K):
[in this window]
[in a new window]
  		Fig. 7. IFN-{gamma} up-regulates proteasomal activity and down-regulates survivin, inhibited by the proteasomal inhibitor MG132. A, proteasome kinetics were determined for up to 30 min after 48-h exposure to IFN-{gamma} (100 units/ml), the proteasome inhibitor MG132 (1 µM), or IFN-{gamma} + MG132. Data are the mean of triplicate determinations at each point; bars, ±SD. B, Western analysis for the detection of XIAP, c-FLIP, c-IAP1, Bcl-xL, and survivin expression after 48-h treatment of HT29 cells with IFN-{gamma} (100 units/ml). C, HT29 cells were treated with IFN-{gamma} (100 units/ml), MG132 (1 µM), or IFN-{gamma} + MG132 for 48 h, and the expression of survivin or actin (control) determined by Western analysis.

 
No Influence of the Survivin:Fas Ratio in Sensitivity to ZD9331 ± IFN-{gamma}.
To explore the simultaneous biological modulation of increased Fas and decreased survivin expression on the cytotoxic activity of ZD9331 ± IFN-{gamma}, HT29GFP and HT29Fas cell lines were used in conjunction with siRNA directed toward the survivin gene. Transfection of survivin siRNA (400 nM) decreased survivin protein expression by 24 h in HT29 (Fig. 8A)Citation , which was maintained for up to 120 h (data not shown). Survivin expression was also down-regulated 19.4-fold after siRNA exposure in HT29Fas by 24 h (Fig. 8A)Citation . After survivin siRNA transfection, thereby decreasing the survivin:Fas ratio by >500-fold in HT29Fas (19.4-fold decrease in survivin and 28.7-fold increase in Fas) in comparison with HT29, no increase in the cytotoxic activity of ZD9331 (0–100 nM) alone or in combination with IFN-{gamma} (100 units/ml), either in HT29GFP (Fig. 8B)Citation or HT29Fas (Fig. 8C)Citation , was demonstrated.



View larger version (27K):
[in this window]
[in a new window]
  		Fig. 8. Decreasing the survivin:Fas ratio does not sensitize HT29 isogenic cell lines to the cytotoxic effects of ZD9331 ± IFN-{gamma}. A, HT29 or HT29Fas cells were transfected with siRNA (400 nM) directed at the survivin gene or control siRNA (400 nM; Scramble II duplex; Dharmacon), and analyzed by Western analysis at 24 h. HT29GFP (B) or HT29Fas (C) were transfected with siRNA (400 nM) directed at the survivin gene (or control), and subsequently treated with ZD9331 (0–100 nM) ± IFN-{gamma} (100 units/ml) ± thymidine (20 µM) for 72 h. Clonogenic survival was assessed as described previously (mean of three determinations per point); bars, ±SD.

 

   DISCUSSION
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
The development of newer and more selective folate-based inhibitors of TS has the potential for greater therapeutic selectivity in comparison with FUra/LV (27, 28, 29) . In a study of 13 colon cancer cell lines, TS levels maintained predictive value with respect to response to FUra, but did not correlate with resistance to the newer folate-based TS inhibitors (30) . After exposure to pure TS inhibitors including ZD1694 and ZD9331, TS levels within colorectal tumor cell lines, including HT29, increased to a lesser degree than the increase observed in normal colonic epithelial cells after similar exposure (31) , suggesting that toxicity from ZD9331 may be mitigated by the differential expression of TS levels in normal versus neoplastic colonic tissue.

We have demonstrated that the combination of IFN-{gamma} and ZD9331 displays synergistic cytotoxicity in human colon carcinoma cell lines, similar to the synergistic interaction between FUra/LV and IFN-{gamma}, and requires ZD9331-induced DNA damage (TS inhibitory effect). This synergism does not depend on functional wild-type p53, as evidenced by synergistic cytotoxicity in cell lines expressing mp53 (HT29 and VRC5/c1), and in HCT116p53-/- cells. This is important in the setting of metastatic colorectal carcinoma where the majority of tumors display a mutant p53 phenotype (32) . In addition, whereas FUra/LV is cytotoxic in HCT-116 via RNA-mediated damage (8) , the current studies demonstrate that ZD9331 and IFN-{gamma}, unlike FUra/LV and IFN-{gamma}, are synergistic in HCT116 cells via an anti-TS effect (non-RNA mediated), suggesting that this combination may have a broader range of activity in colon carcinomas.

Mechanistically, the role of Fas/FasL interactions as mediators of anticancer therapy has been variable, dependent on the cell type and agent under investigation (33 , 34) . In colon carcinoma cell lines, the interaction between cytotoxic agents and Fas signaling pathways may be specific for inhibitors of TS, such as FUra, and not for other agents that damage DNA, including doxorubicin, topotecan, or VP-16 (25) . Fas is a type I transmembrane protein of Mr 48,000 belonging to the tumor necrosis factor receptor family. FasL is a cytokine belonging to the tumor necrosis factor family, synthesized as a type II membrane protein of Mr 40,000 (34) . After FasL-induced formation of Fas receptor microaggregates, recruitment of FADD and procaspase-8 occur to form the death-inducing signaling complex. Subsequent downstream events proceed by either a type I mechanism involving high levels of caspase-8 activation at the death-inducing signaling complex followed by direct activation of executioner caspases or by a Type II mechanism involving mitochondrial activation and initiation of an amplification loop required to ultimately yield downstream caspase activation (35 , 36) . Human colon carcinoma cell lines used in the current study represent both type I (GC3/c1) and type II cells (HT29, VRC5/c1, and HCT116) for death receptor signaling (37) , and in both cell types IFN-{gamma} and TS inhibitor combinations demonstrate synergistic cytotoxicity.

We demonstrated previously the importance of the Fas signaling pathway in thymineless stress-induced apoptosis in colon carcinoma cells (25 , 26 , 38, 39, 40) and as a component in the sensitivity of human colon carcinoma cell lines to FUra/LV-induced cytotoxicity, potentiated by IFN-{gamma} (8) . The purest manner in which to study thymineless stress-induced apoptosis is to use TS- cells, where thymineless death is induced solely by depriving the cells of preformed dThd, in contrast to TS inhibitors that are known to have targets in addition to the enzyme, TS. In TS- cells, blocking Fas/FasL interactions with the Nok1 antibody completely protected cells from thymineless death induced after dThd withdrawal (39) , demonstrating the essential role of Fas, FasL, and Fas signaling in the mechanism of cell death induced by thymineless stress. Furthermore, Nok1 + Nok2 antibodies partially, but not completely, protected HT29 cells from the cytotoxic action of FUra/LV either in the absence or in the presence of IFN-{gamma}, demonstrating a Fas-dependent component in FUra/LV-induced thymineless death and in sensitization by IFN-{gamma} (8) . The importance of Fas has also been demonstrated in the mechanism of FUra-induced apoptosis of hepatocellular carcinoma cells in vitro (41) and in mouse thymocytes in vivo (42) , demonstrating the more general applicability of Fas as one component in the mechanism of FUra-induced apoptosis. In the current study, partial protection from ZD9331-induced cytotoxicity but lack of protection from ZD9331 + IFN-{gamma}-induced cytotoxicity by Nok1 + Nok2 antibodies was demonstrated, and transfection of DN-FADD did not inhibit the cytotoxic action of ZD9331 ± IFN-{gamma}. This may reflect: (a) that activation of the Fas pathway can occur independently of FasL (43 , 44) , FADD (45) or caspase-8 (46) ; (b) the different mechanisms of action or targets for FUra in comparison to ZD9331; or (c) additional targets of IFN-{gamma} action, which can occur independent of Fas.

IFN-{gamma}-inducible genes have been shown to regulate the expression of caspases, including caspases -1, -3, -4, -7, -8, and -10 (47, 48, 49, 50, 51) . In some systems, caspase-8 (47 , 49, 50, 51) and/or caspase-3 (47 , 51) have been selectively up-regulated in response to IFN-{gamma}. It is evident that IFN-{gamma} induced the elevated expression of mRNA for most of the caspases (except for caspase-9) and procaspases -3, -4, -7, and -8, but not procaspases -6 or -9, examined at the protein level. In contrast to IFN-{gamma}, ZD9331 did not induce up-regulated caspase expression determined by cDNA or Western analyses; however, when IFN-{gamma} and ZD9331 were combined, caspase activation was clearly enhanced and could not be inhibited by overexpression of Bcl-2. The potential interaction between ZD9331 and IFN-{gamma} at targets downstream or independent of the mitochondria were confirmed in HT29 after transfection and overexpression of Bcl-xL or Bcl-2, which also did not protect cells from loss in clonogenic survival induced by ZD9331 ± IFN-{gamma}. After coincubation with ZVAD-FMK, we demonstrated previously partial, but not complete, protection from cell death induced by DNA damaging agents (VP-16), anti-Fas (CH-11), or after thymineless stress-induced DNA damage, in colon carcinoma cells (25) , consistent with data reported by others (52) . Similarly, inhibition of caspase activation partially protected HT29 cells from cytotoxicity induced by ZD9331, both alone and in combination with IFN-{gamma}, that were more pronounced in assays of apoptosis compared with clonogenic survival. Several studies have demonstrated that caspase inhibitors can block the appearance of the apoptotic phenotype, although cell death continues to proceed (53) . It is evident that caspase inhibitors may block only a part of the classical apoptotic program resulting in delay but not prevention of apoptosis induced by multiple signals (54) . FUra has been reported to directly activate caspase-8 (51 , 55 , 56) , and/or caspase-3 (51 , 56) that may additionally enhance the interaction between FUra/LV and IFN-{gamma}, and may also be applicable to the mechanism of ZD9331 action. Direct targeting of caspases by IFN-{gamma} or TS inhibitors may also prevent or attenuate the ability of blocking Fas/FasL interactions (Nok1/Nok2) or upstream signaling mechanisms (DN-FADD, DN-caspase-8, Bcl-2, and Bcl-xL) to inhibit the induction of cell death. Taken together, data suggest that a critical target site in the synergistic interaction between ZD9331 and IFN-{gamma} lies at the level of the caspases, at both the level of expression and activation, independent of Fas or of involvement of the mitochondria.

We have also demonstrated that an additional target for IFN-{gamma} action occurs at the level of the proteasome, a multisubunit complex known to be responsible for degradation of numerous cellular protein substrates via ubiquitin targeting (57 , 58) . Functionally, the proteasome has known proapoptotic and antiapoptotic effects. Activation of the proteasome can be lethal to cells (e.g., thymocytes), where proteasome inhibition protects from glucocorticoid- or etoposide- induced cytotoxicity via prevention of c-IAP1 and XIAP degradation (59) . The use of proteasome inhibitors to protect from the toxicity of chemotherapeutic agents has also been documented in human leukemic cells (60) . In general proteasome inhibitors have reached clinical trial due to their effective induction of cytotoxicity in numerous cancers (61) . Substrates of the proteasome important in apoptosis include the antiapoptotic factors Bcl-2, Bcl-xL, c-IAP1, c-FLIP, XIAP, and survivin (59 , 62, 63, 64) , and activation of proteasomal activity can also elevate the expression of the survival factor NF{kappa}B (65) . Because HT29 lacks Bcl-2 and c-IAP2, the influence of IFN-{gamma} on levels of expression of XIAP, Bcl-xL, c-IAP1, c-FLIP, and survivin was determined. Whereas IFN-{gamma} increases cell surface Fas expression, the expression of survivin was selectively decreased by IFN-{gamma} treatment, dependent on enhanced proteasomal activity, and independent of NF{kappa}B. Survivin expression has been reported to influence colon tumorigenesis (66) as well as the prognosis for survival after curative resection of stage II colorectal carcinomas (67) . In addition, the survivin:Fas ratio has been reported to predict for aggressive behavior and/or recurrent disease in neuroblastoma, as well as in pediatric renal tumors of multiple subtypes (68 , 69) . Using HT29Fas and HT29GFP isogenic cell lines and siRNA oligonucleotides directed against survivin, reduction of the survivin:Fas ratio by >500-fold did not enhance the cellular sensitivity to ZD9331 ± IFN-{gamma}. Thus, IFN-{gamma}-induced down-regulation of survivin expression did not appear to be involved directly in the interaction mechanism between ZD9331 and IFN-{gamma} in HT29 cells.

The mechanisms behind the synergistic interaction between IFN-{gamma} and TS inhibitors are complex. The interaction between FUra/LV and IFN-{gamma} in inducing a cytotoxic response and the involvement of Fas and its signaling pathway determined in human colorectal carcinoma cell lines, will be additionally explored in Phase II investigation, based on results from the Phase I trial (9) . The studies presented here also provide a rationale for combining IFN-{gamma} with the new and specific TS inhibitor, ZD9331, that may induce a synergistic interaction with IFN-{gamma} in a higher proportion of colorectal tumors. Furthermore, a major target of this interaction appears to be at the level of the caspases, by enhanced expression of caspases in the presence of IFN-{gamma}, and enhanced activation when IFN-{gamma} and ZD9331 are combined, downstream of Fas and independent of the mitochondria. The role of proteasomal activation by IFN-{gamma} followed by degradation of survivin, together with IFN-{gamma}-induced increase in Fas expression that results in a significant decrease in the survivin:Fas ratio, whereas an attractive target for potential interaction between IFN-{gamma} and TS inhibitors demonstrated no influence on ZD9331/IFN-{gamma}-induced cytotoxicity in HT29 in the current investigation. However, this would be worthy of more detailed exploration in an expanded panel of human colorectal carcinoma cell lines and in other cancer models.


   FOOTNOTES
 
Grant Support: NIH Awards RO1 CA 32613, T32-CA70089 (J. G.), Cancer Center Support (CORE) Grant CA 21765, and the American Lebanese Syrian Associated Charities.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Requests for reprints: Janet Houghton, Division of Molecular Therapeutics, Department of Hematology-Oncology, St. Jude Children’s Research Hospital, 332 North Lauderdale, Memphis, TN 38105. Phone: (901) 495-3456; Fax: (901) 495-3966; E-mail: janet.houghton{at}stjude.org

Received 4/15/03; revised 9/ 5/03; accepted 9/ 8/03.


   REFERENCES
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Houghton J. A. Developing novel and highly effective new therapeutic strategies for treatment of colorectal cancer: where do we go from here?. Curr. Opin. Investig. Drugs, 2: 674-676, 2001.[Medline]
  2. Cutsem E. V., Dicato M., Wils J. Recent advances in the management of colorectal cancer. Eur. J. Cancer, 37: 2302-2309, 2001.
  3. Papamichael D. The use of thymidylate synthase inhibitors in the treatment of advanced colorectal cancer: current status. Oncologist, 4: 478-487, 1999.[Abstract/Free Full Text]
  4. Advanced Colorectal Cancer Meta-analysis Project. Modulation of fluorouracil by leucovorin in patients with advanced colorectal cancer: evidence in terms of response rate. J. Clin. Oncol., 10: 896-903, 1992.[Abstract]
  5. Ferguson P. J., Collins O., Dean M. M., DeMoor J., Sha-Li C., Vincent M. D., Koropatnick J. Antisense down-regulation of thymidylate synthase to suppress growth and enhance cytotoxicity of 5-FudR, 5-FU and Tomudex in HeLa cells. Br. J. Pharm., 127: 1777-1786, 1999.[CrossRef][Medline]
  6. Ladner R., Caradonna S. Lowering dUTPase levels through antisense induces sensitivity to fluorodeoxyuridine in HT29 cells. Proc. Am. Assoc. Cancer Res., 28: 4126a 1999.
  7. Webley S. D., Hardcastle A., Ladner R. D., Jackman A. L., Aherne G. W. Deoxyuridine triphosphatase (dUTPase). expression and sensitivity to the thymidylate synthase (TS) inhibitor ZD9331. Br. J. Cancer, 83: 792-799, 2000.[CrossRef][Medline]
  8. Tillman D. M., Petak I., Houghton J. A. A Fas-dependent component in 5-fluorouracil/leucovorin-induced cytotoxicity in colon carcinoma cells. Clin. Cancer Res., 5: 425-430, 1999.[Abstract/Free Full Text]
  9. Schwartzberg L. S., Petak I., Stewart C., Turner P. K., Ashley J., Tillman D. M., Doublas L., Tan M., Billups C., Mihalik R., Weir A., Tauer K., Shope S., Houghton J. A. Modulation of the Fas signaling pathway by IFN-{gamma} in therapy of colon cancer: Phase I trial and correlative studies of IFN-{gamma}, 5-fluorouracil, and leucovorin. Clin. Cancer Res., 8: 2488-2498, 2002.[Abstract/Free Full Text]
  10. Ikeda H., Old L. J., Schreiber R. D. The roles of IFN{gamma} in protection against tumor development and cancer immunoediting. Cytokine Growth Factor Rev., 13: 95-109, 2002.[CrossRef][Medline]
  11. Varela N., Munoz-Pinedo C., Ruiz-Ruiz C., Robledo G., Pedroso M., Lopez-Rivas A. Interferon-{gamma} sensitizes human myeloid leukemia cells to death receptor-mediated apoptosis by a pleiotropic mechanism. J. Biol. Chem., 276: 17779-17787, 2001.[Abstract/Free Full Text]
  12. Boehm U., Kamp T., Groot M., Howard J. C. Cellular responses to interferon-{gamma}. Annu. Rev. Immunol., 15: 749-795, 1997.[CrossRef][Medline]
  13. Marsham P. R., Wardelworth J. M., Boyle F. T., Hennequin L. F., Kimbell R., Brown M., Jackman A. L. Design and synthesis of potent non-polyglutamatable quinazoline antifolate thymidylate synthase inhibitors. J. Med. Chem., 42: 3809-3820, 1999.[CrossRef][Medline]
  14. Jackman A. L., Kimbell R., Aherne G. W., Brunton L., Jansen G., Stephens T. C., Smith M. N., Wardleworth J. M., Boyle F. T. Cellular pharmacology and in vivo activity of a new anticancer agent, ZD9331: A water-soluble, nonpolyglutamatable, qunazoline-based inhibitor of thymidylate synthase. Clin. Cancer Res., 3: 911-921, 1997.[Abstract]
  15. Jackman A. L., Kimbell R., Brown M., Brunton L., Harrap K. R., Wardleworth J. M., Boyle F. T. Sahota A. Taylor M. eds. . The Antitumor Activity of ZD9331, A Non-Polyglutamatable Quinazoline Thymidylate Synthase Inhibitor, Purine and Pyrimidine Metabolism in Man VIII, 185-188, Plenum Press New York 1995.
  16. Cunningham D., Zalcberg J., Maroun J., James R., Clarke S., Maughan T. S., Vincent M., Schulz J., Gonzalez Baron M., Facchini T. Efficacy, tolerability and management of raltitrexed (Tomudex) monotherapy in patients with advanced colorectal cancer: a review of phase II/III trials. Eur. J. Cancer, 38: 478-86, 2002.
  17. Jackman A. L., Kelland L. R., Kimbell R., Brown M., Gibson W., Aherne G. W., Hardcastle A., Boyle F. T. Mechanisms of acquired resistance to the quinazoline thymidylate synthase inhibitor ZD1694 (tomudex) in one mouse and three human cell lines. Br. J. Cancer, 71: 914-24, 1995.[Medline]
  18. Patterson A. V., Talbot D. C., Stratford I. J., Harris A. L. Thymidine phosphorylase moderates thymidine-dependent rescue after exposure to the thymidylate synthase inhibitor ZD1694 (tomudex) in vitro. Cancer Res., 58: 2737-2740, 1998.[Abstract/Free Full Text]
  19. Cheradame S., Chazal M., Fischel J. L., Formento P., Renee N., Milano G. Variable intrinsic sensitivity of human tumor cell lines to raltitrexed (Tomudex) and folylpolyglutamate synthetase activity. Anticancer Drugs, 10: 505-510, 1999.[Medline]
  20. Jackman A. L., Melin C. M., Kimbell R., Brunton L., Aherne G. W., Theti D. S., Walton M. A rationale for the clinical development of the thymidylate synthase inhibitor ZD9331 in ovarian and other solid tumors. Biochim. Biophys. Acta, 1587: 215-223, 2002.[Medline]
  21. Houghton J. A., Adkins D. A., Rahman A., Houghton P. G. Interaction between 5-flurouracil, [6RS] leucovorin, and recombinant human interferon-{alpha}2a in cultured colon adenocarcinoma cells. Cancer Commun., 3: 223-231, 1991.
  22. Houghton J. A., Tillman D. M., Harwood F. G. Ratio of 2'-deoxyadenosine-5'-triphosphate/thymidine-5'-triphosphate influences the commitment of human colon carcinoma cells to thymineless death. Clin. Cancer Res., 1: 723-730, 1995.[Abstract]
  23. Teitz T., Wei T., Valentine M. B., Vanin E. F., Grenet J., Valentine V. A., Behm F. G., Look A. T., Lahti J. M., Kidd V. J. Caspase 8 is deleted or silenced preferentially in childhood neuroblastomas with amplification of MYCN. Nat. Med., 6: 529-535, 2000.[CrossRef][Medline]
  24. Persons D. A., Allay J. A., Allay E. R., Ashmun R. A., Orlic D., Jane S. M., Cunningham J. M., Nienhuis A. W. Enforced expression of the GATA-2 transcription factor blocks normal hematopoiesis. Blood, 93: 488-499, 1999.[Abstract/Free Full Text]
  25. Petak I., Tillman D. M., Harwood F. G., Mihalik R., Houghton J. A. Fas-dependent and independent mechanisms of cell death following DNA damage in human colon carcinoma cells. Cancer Res., 60: 2643-2650, 2000.[Abstract/Free Full Text]
  26. Petak I., Tillman D. M., Houghton J. A. P53 dependence of Fas induction and acute apoptosis in response to 5-fluorouracil-leucovorin in human colon carcinoma cell lines. Clin. Cancer Res., l,6: 4432-4441, 2000.
  27. Takemura Y., Jackman A. L. Folate-based thymidylate synthase inhibitors in cancer chemotherapy. Anticancer Drugs, 8: 3-16, 1997.[CrossRef][Medline]
  28. Danenberg P. V., Malli H., Swenson S. Thymidylate synthase inhibitors. Semin. Oncol., 26: 621-631, 1999.[Medline]
  29. Cassidy J. Thymidylate synthase inhibitors in colorectal cancer. Semin. Int. Oncol., 27(Suppl. 10): 83-87, 2000.
  30. Van Triest B., Pinedo H. M., van Hensbergen Y., Smid K., Telleman F., Schoenmakers P. S., van der Wilt C. L., van Laar J. A. M., Noordhuis P., Jansen G., Peters G. J. Thymidylate synthase level as the main predictive parameter for sensitivity to 5-fluorouracil, but not for folate-based thymidylate synthase inhibitors, in 13 nonselected colon cancer cell lines. Clin. Cancer Res., 5: 643-654, 1999.[Abstract/Free Full Text]
  31. Welsh S. J., Titley J., Brunton L., Valenti M., Monaghan P., Jackman A. L., Aherne G. W. Comparison of thymidylate synthase (TS) protein up-regulation after exposure to TS inhibitors in normal and tumor cell lines and tissues. Clin. Cancer Res., 6: 2538-2546, 2000.[Abstract/Free Full Text]
  32. Lanza G., Maestri I., Dubini A., Gafa R., Santini A., Ferretti S., Cavazzini L. p53 expression in colorectal cancer: relation to tumor type, DNA ploidy pattern and short-term survival. Am. J. Clin. Pathol., 105: 604-12, 1996.[Medline]
  33. Poulaki V., Mitsiades C. S., Mitsiades N. The role of Fas and FasL as mediators of anticancer chemotherapy. Drug Resist. Updates, 4: 233-242, 2001.[CrossRef][Medline]
  34. Timmer T., de Vries E. G. E., de Jong S. Fas receptor-mediated apoptosis: a clinical application?. J. Pathol., 196: 125-134, 2002.[CrossRef][Medline]
  35. Algeciras-Schimnich A., Shen L., Barnhart B. C., Murmann A. E., Burkhardt J. K., Peter M. E. Molecular ordering of the initial signaling events of CD95. Mol. Cell. Biol., 22: 207-220, 2002.[Abstract/Free Full Text]
  36. Scaffidi C., Fulda S., Srinivasan A., Friesen C., Li F., Tomaselli K. J., Debatin K. m., Krammer P. H., Peter M. E. Two CD95 (APO-1/Fas) signaling pathways. EMBO J., 17: 1675-1687, 1998.[CrossRef][Medline]
  37. Tillman, D. M., Izeradjene, K., Szekely Szucs, K., Douglas, L., and Houghton, J. A. Rottlerin sensitizes colon carcinoma cells to TRAIL-induced apoptosis via uncoupling of the mitochondria independent of PKC. Cancer Res., in press, 2003.
  38. Tillman D. M., Harwood F. G., Gibson A. A., Houghton J. A. Expression of genes that regulate Fas signaling and Fas-mediated apoptosis in colon carcinoma cells. Cell Death Diff., 5: 450-457, 1998.[CrossRef][Medline]
  39. Houghton J. A., Harwood F. G., Tillman D. M. Thymineless death in colon carcinoma cells is mediated via Fas signaling. Proc. Natl. Acad. Sci. USA, 94: 8144-8149, 1997.[Abstract/Free Full Text]
  40. Houghton J. A., Harwood F. G., Gibson A. A., Tillman D. M. The Fas signaling pathway is functional in colon carcinoma cells and induces apoptosis. Clin. Cancer Res., 3: 2205-2209, 1997.[Abstract/Free Full Text]
  41. Eichhorst S. T., Muller M., Li-Weber M., Schulze-Bergkamen H., Angel P., Krammer P. H. A novel AP-1 element in the CD95 ligand promoter is required for induction of apoptosis in hepatocellular carcinoma cells upon treatment with anticancer drugs. Mol. Cell. Biol., 20: 7826-7837, 2000.[Abstract/Free Full Text]
  42. Eichhorst S. T., Muerkoster S., Weigand M. A., Krammer P. H. The chemotherapeutic drug 5-fluorouracil induces apoptosis in mouse thymocytes in vivo via activation of the CD95(APO-1/Fas) system. Cancer Res., 61: 243-248, 2001.[Abstract/Free Full Text]
  43. Shao R. G., Cao C. X., Nieves-Neira W., Dimanche-Boitrel M. T., Solary E., Pommier Y. Activation of the Fas pathway independently of Fas ligand during apoptosis induced by camptothecin in p53 mutant human colon carcinoma cells. Oncogene, 20: 1852-1859, 2001.[CrossRef][Medline]
  44. Micheau O., Solary E., Hammann A., Dimanche-Boitrel M. T. Fas ligand-independent, FADD-mediated activation of the Fas death pathway by anticancer drugs. J. Biol. Chem., 274: 7987-7992, 1999.[Abstract/Free Full Text]
  45. Wesselborg S., Engels i. H., Rossmann E., Los M., Schulze-Osthoff K. Anticancer drugs induce caspase-8/FLICE activation and apoptosis in the absence of CD95 receptor/ligand interaction. Blood, 93: 3053-3063, 1999.[Abstract/Free Full Text]
  46. Holler N., Zaru R., Micheau O., Thome M., Attinger A., Valitutti S., Bodmer J. L., Schneider P., Seed B., Tschopp J. Fas triggers an alternative, caspase-8-independent cell death pathway using the kinase RIP as effector molecule. Nat. Immunol., 1: 489-495, 2000.[CrossRef][Medline]
  47. Ossina N. K., Cannas A., Powers V. C., Fitzpatrick P. A., Knight J. D., Gilbert J. R., Shekhtman E. M., Tomei L. D., Umansky S. R., Kiefer M. C. Interferon-{gamma} modulates a p53-independent apoptotic pathway and apoptosis-related gene expression. J. Biol. Chem., 272: 16351-16357, 1997.[Abstract/Free Full Text]
  48. O’Connell J., Bennett M. W., Nally k., O’Sullivan G. C., Collins J. K., Shanahan F. Interferon-{gamma} ensitizes colonic epithelial cell lines to physiological and therapeutic inducers of colonocyte apoptosis. J. Cell Physiol., 185: 331-338, 2000.[CrossRef][Medline]
  49. Ruiz-Ruiz C., Munnoz-Pinedo C., Lopez-Rivas A. Interferon-{gamma} treatment elevates caspase-8 expression and sensitizes human breast tumor cells to a death receptor-induced mitochondria-operated apoptotic program. Cancer Res., 60: 5673-5680, 2000.[Abstract/Free Full Text]
  50. Fulda S., Debatin K. M. IFN-{gamma} sensitizes for apoptosis by upregulating caspase-8 expression through the Stat1 pathway. Oncogene, 21: 2295-2308, 2002.[CrossRef][Medline]
  51. Adachi Y., Taketani S., Oyaizu H., Ikebukuro K., Tokunaga R., Ikehara S. Apoptosis of colorectal adenocarcinoma induced by 5-FU and/or IFN-{gamma} through caspase 3 and caspase 8. Int. J. Oncol., 15: 1191-1196, 1999.[Medline]
  52. Peart M. J., Tainton K. M., Ruefli A. A., Dear A. E., Sedelies K. A., O’Reilly L. A., Waterhouser N. J., Trapani J. A., Johnstone R. W. Novel mechanisms of apoptosis induced by histone deacetylase inhibitors. Cancer Res., 63: 4460-4471, 2003.[Abstract/Free Full Text]
  53. Green D. R., Beere H. M. Killers or clean-up crew: how central are the central mechanisms of apoptosis Hickman J. A. Dive C. eds. . Apoptosis and Cancer Therapy, 157-174, Humana Press Inc. Totowa, NY 1999.
  54. McCarthy N. J., Whyte M. K. B., Gilbert C. S., Evan G. I. Inhibition of ced-3/ICE-related proteases does not prevent cell death induced by oncogenes, DNA damage, or the Bcl-2 homologue Bak. J. Cell Biol., 136: 215-227, 1997.[Abstract/Free Full Text]
  55. Engels I. H., Stepczynska A., Stroh C., Lauber K., Berg C., Schwenzer R., Wajant H., Janicke R. U., Porter A. G., Belka C., Gregor M., Schulze-Osthoff K., Wesselborg S. Caspase-8/FLICE functions as an executioner caspase in anticancer drug-induced apoptosis. Oncogene, 19: 4563-4573, 2000.[CrossRef][Medline]
  56. Wu X. X., Kakehi Y., Mizutani Y., Lu J., Terachi T., Ogawa O. Activation of caspase-3 in renal cell carcinoma cells by anthracyclines or 5-fluorouracil. Int. J. Oncol., 19: 19-24, 2001.[Medline]
  57. Lee D. H., Goldberg A. L. Proteasome inhibitors: valuable new tools for cell biologists. Cell Biol., 8: 397-403, 1998.
  58. Weissman A. M. Themes and variations on ubiquitylation. Nat. Rev. Mol. Cell. Biol., 2: 169-178, 2001.[CrossRef][Medline]
  59. Yang Y., Fang S., Jensen J. P., Weissman A. M., Ashwell J. D. Ubiquitin protein ligase activity of IAPs and their degradation in proteasomes in response to apoptotic stimuli. Science (Wash. DC), 288: 874-877, 2000.[Abstract/Free Full Text]
  60. Watanabe K., Kubota M., Hamahata K., Lin Y., Usami I. Prevention of etoposide-induced apoptosis by proteasome inhibitors in a human leukemic cell line but not in fresh acute leukemia blasts. Biochem. Pharmacol., 60: 823-830, 2000.[CrossRef][Medline]
  61. Adams J. Proteasome inhibition in cancer: development of PS-341. Semin. Oncol., 28: 613-619, 2001.[CrossRef][Medline]
  62. Kim Y., Suh N., Sporn M., Reed J. C. An inducible pathway for degradation of FLIP protein sensitizes tumor cells to TRAIL-induced apoptosis. J. Biol. Chem., 277: 22320-22329, 2002.[Abstract/Free Full Text]
  63. Dimmeler S., Breitschopf K., Haendeler J., Zeiher A. M. Dephosphorylation targets Bcl-2 ubiquitin-dependent degradation: A link between the apoptosome and the proteasome pathway. J. Exp. Med., 89: 1815-1822, 1999.
  64. Zhao J., Tenev T., Martins L. M., Downward J., Lemoine N. R. The ubiquitin-proteasome pathway regulates survivin degradation in a cell cycle-dependent manner. J. Cell Sci., 113: 4363-4371, 2000.[Abstract]
  65. Palombella V. J., Rando O. J., Goldberg A. L., Maniatis T. The Ubiquitin-proteasome pathway is required for processing the NF-B1 precursor protein and the activation of NF-kB. Cell, 78: 773-785, 1994.[CrossRef][Medline]
  66. Kawasaki H., Toyoda M., Shinohara H., Okuda J., Watanabe I., Yamamoto T., Tanaka K., Tenjo T., Tanigawa N. Expression of survivin correlates with apoptosis, proliferation, and angiogenesis during human colorectal tumorigenesis. Cancer (Phila.), 91: 2026-2032, 2001.
  67. Sarela A. I., Scott N., Ramsdale J., Markham A. F., Guillou P. J. Immunohistochemical detection of the anti-apoptosis protein, survivin, predicts survival after cur