Clinical Cancer Research CTRC-AACR San Antonio Breast Cancer Symposium Tumor Immunology: New Perspectives
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tatsumi, T.
Right arrow Articles by Storkus, W. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tatsumi, T.
Right arrow Articles by Storkus, W. J.
Clinical Cancer Research Vol. 9, 947-954, March 2003
© 2003 American Association for Cancer Research

Molecular Oncology, Markers, Clinical Correlates

MAGE-6 Encodes HLA-DRß1*0401-presented Epitopes Recognized by CD4+ T Cells from Patients with Melanoma or Renal Cell Carcinoma1

Tomohide Tatsumi2, Lisa S. Kierstead2, Elena Ranieri, Loreto Gesualdo, Francesco P. Schena, James H. Finke, Ronald M. Bukowski, Vladimir Brusic, John Sidney, Alessandro Sette, Theodore F. Logan, Yvette L. Kasamon, Craig L. Slingluff, Jr., John M. Kirkwood and Walter J. Storkus3

Departments of Surgery [T. T., L. S. K., E. R., Y. L. K., W. J. S.], Medicine [J. M. K.], and Immunology [W. J. S.], University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15213; Department of Emergency and Organ Transplantation, Section of Nephrology, University of Bari, Bari, Italy [E. R., L. G., F. P. S.]; Cleveland Clinic Foundation, Cleveland, Ohio 44195 [J. H. F., R. M. B.]; Kent Ridge Digital Laboratory, Singapore, [V. B.]; Epimmune Corporation, San Diego, California 92121 [J. S., A. S.]; Department of Medicine, Indiana University, Indianapolis, Indiana 46202 [T. F. L.]; Department of Surgery, University of Virginia, Charlottesville, Virginia 22908 [C. L. S.]; and University of Pittsburgh Cancer Institute, Pittsburgh, Pennsylvania 15261 [J. M. K., W. J. S.]


   ABSTRACT
Top
 ABSTRACT
Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
CD4+ T cells modulate the magnitude and durability of CTL responses in vivo and may serve as potent effector cells within the tumor microenvironment. The current study was undertaken to define novel epitopes from the broadly expressed tumor antigen MAGE-6 that are recognized by CD4+ T cells. We have combined the use of a HLA-DR4/peptide binding algorithm with the IFN-{gamma} enzyme-linked immunospot assay to identify four nonoverlapping sequences derived from the MAGE-6 protein that served as CD4+ T-cell epitopes in HLA-DR4+ donors. Strikingly, patients with active melanoma or renal cell carcinoma failed to secrete IFN-{gamma} in response to MAGE-6-derived epitopes, whereas both normal donors and cancer patients with no current evidence of disease were responsive, particularly after short-term in vitro stimulations with peptide-pulsed dendritic cells. Importantly, peptide-specific CD4+ T cells also recognized HLA-DRß1*0401+ tumor cells that constitutively expressed the MAGE-6 protein and autologous HLA-DRß1*0401+ dendritic cells transfected with MAGE-6 cDNA-elicited CD4+ T cells that reacted against individual peptide epitopes in vitro. These data suggest that MAGE-6-derived epitopes could serve as useful vaccine candidate components and may provide an immune-monitoring index of clinically important Th1-type immunity in patients with renal cell carcinoma or melanoma.


   Introduction
Top
 ABSTRACT
 Introduction
Materials and Methods
 Results
 Discussion
 REFERENCES
 
MAGE-6 is a member of the cancer-testis family of tumor-associated antigens and is broadly expressed by tumors of diverse histologies, including melanoma and RCC4 (1, 2, 3, 4, 5) . Although the MAGE family of proteins all bear strong homologies with each other, MAGE-6 is most highly homologous (98%) to MAGE-3 (1) . Interestingly, the expression of MAGE-6/-3 by tumor tissue has been reported to be inversely correlated with clinical stage (6) , and these two markers may be indicative of early premalignant lesions in situ (3 , 7) . This suggests that cellular immunity against MAGE-6 may modulate the incidence or time to incidence in individuals prone to develop certain types of cancer, the progression status of MAGE-6+ tumors and protection against recurrence of MAGE-6+ disease in the adjuvant setting.

Although RCC and melanoma are considered among the most responsive cancers to immunotherapy, many recent such approaches have been focused solely on the induction of CD8+ antitumor T cells in vivo (8, 9, 10) . CD4+ T-cell recognition of these tumors is also clearly possible, with some RCC and melanoma in situ expressing MHC class II molecules (HLA-DR, HLA-DP, and HLA-DQ; Refs. 11, 12, 13 ). Cross-presentation of tumor-associated epitopes by HLA-DR+ patient DCs is also anticipated in vivo (14) . The ability or inability of Th1-type CD4+ T cells to recognize MHC class II-presented tumor epitopes in situ may play a dominant role in determining whether resistance or susceptibility to disease progression occurs, respectively, and whether therapeutic approaches are both effective and durable (15 , 16) .

The current study was undertaken to define MAGE-6-derived peptides recognized in a HLA-DR-restricted fashion by CD4+ T cells and to use these probes to survey Th1-type CD4+ T-cell responses in patients with RCC or melanoma. These epitopes have promise as vaccine candidates for the treatment of patients with MAGE-6+ tumors and for the monitoring of evolving Th1-type CD4+ T-cell responses in patients receiving therapy.


   Materials and Methods
Top
 ABSTRACT
 Introduction
 Materials and Methods
Results
 Discussion
 REFERENCES
 
Cell Lines and Media.
The T2.DR4 (DRB1*0401+) cell line [kindly provided by Dr. Janice Blum (Indiana University School of Medicine, Indianapolis, IN] was used as the peptide-presenting cell in these studies (17) . Melanoma cell line MEL-SLM2 (Storkus Lab Melanoma no. 2; HLA-DR4+, MAGE-6+) was generated from primary tumor cultures at the University of Pittsburgh. All cell lines were maintained in RPMI 1640 supplemented with 10% heat-inactivated fetal bovine serum, 100 IU/ml penicillin, 100 µg/ml streptomycin, and 10 mM L-glutamine (all reagents Life Technologies, Inc.).

Peptide Selection and Synthesis.
The protein sequence of the MAGE-6 protein was obtained from GenBank (accession no. JC2360) and analyzed for HLA-DRB1*0401 binding peptides using a neural network algorithm (18, 19, 20) . High-scoring 9 amino acid long sequences were typically extended by three amino acids on either flank using the genomic corresponding sequences. Alternatively, if high-scoring 9 amino acid long sequences were found to overlap, the longer overlapping sequences were synthesized, with amino acid extensions added to the end(s) of putative DR4 binding sequence(s). Overall, peptides were 15–23 amino acids in length (Table 1)Citation and were synthesized by N-(9-fluorenyl)methoxycarbonyl chemistry by the University of Pittsburgh Cancer Institute’s Peptide Synthesis Facility (Shared Resource). Peptides were >90% pure based on high-performance liquid chromatography profile and tandem mass spectrometry mass spectrometric analysis performed by the UPCI Protein Sequencing Facility (Shared Resource).


View this table:
[in this window]
[in a new window]
  		Table 1 MAGE-6 peptides analyzed in this study: algorithm scores, solid-state binding IC50s, and summary of CD4+ T-cell responsiveness in IFN-{gamma} ELISPOT assays

 
Peptide Binding Assay.
The peptide binding determinations were performed using a solid-state competitive-binding assay as described previously (21) .

Isolation of Patient and Normal Donor PBMC-derived T Cells.
Forty to 100 ml of patient or normal donor heparinized blood were obtained with informed consent under Institutional Review Board-approved protocols and diluted 1:2 with HBSS, applied to Ficoll-Hypaque gradients (LSM; Organon-Teknika, Durham, NC) per the manufacturer’s instructions, and centrifuged at 550 x g for 25 min at room temperature. Patient and normal donor information is provided in Table 2Citation . Lymphocytes at the buoyant interface were recovered and washed twice with HBSS to remove residual platelets and Ficoll-Hypaque. HLA-DR4+ status was confirmed by flow cytometry using the anti-HLA-DR4-reactive mAb clone 359-13F10 [IgG, kindly provided by Dr. Janice Blum (Indiana University School of Medicine)] in indirect immunofluorescence assays. Cells were frozen in 90% FCS containing 10% DMSO (Sigma Chemical Co., St. Louis, MO) at 107 lymphocytes/vial using controlled rate freezing technique. On the day of establishing DC-T-cell cultures, nonadherent cells were thawed and washed twice with HBSS. CD4+ T cells were then isolated using MACS (Miltenyi Biotec, Auburn, CA) antihuman CD4 beads and MiniMACS columns per the manufacturer’s protocol. CD4+ T-cell yields were typically 25–35% of starting PBMC numbers loaded, with purity exceeding 97% as assessed by flow cytometry.


View this table:
[in this window]
[in a new window]
  		Table 2 HLA-DRB1*0401 + patients evaluated in this study

 
Induction of Antitumor T-Effector Lymphocytes.
Autologous DCs were prepared as previously described by 7-day culture of plastic-adherent PBMCs in granulocyte macrophage colony-stimulating factor and interleukin 4 (22) . Harvested, nonadherent DCs were then loaded with antigen in one of three ways. DCs were either pulsed with 10 µM synthetic peptides for 3–4 h at 37°C or infected with empty recombinant adenovirus (Ad-{psi}5) or adenovirus encoding the MAGE-6 (Ad-MAGE6) at a multiplicity of infection of 250 for 24 h at 37°C. The resulting antigen-loaded DCs were washed and used to stimulate purified CD4+ T cells at a 10–50:1 responder-to-stimulator ratio. Primary in vitro cultures were performed in AIM-V medium containing 5% human serum AB serum and 1 ng/ml of both rhIL-1 and rhIL-7 (Genzyme). In some cases, cultures were restimulated with the residual one-half of the DC-tumor stimulator preparation (cryopreserved for 1 week) on day 7 in AIM-V medium containing 5% HuAB serum and 10 IU/ml rhIL-2 (kind gift of Chiron Corporation, Emeryville, CA). In vitro-stimulated T cells were harvested either on day 7 and/or on day 14–17 and analyzed for MAGE-6 peptide/tumor specificity in ELISPOT assays.

IFN-{gamma} ELISPOT Assay for Peptide-reactive CD4+ T-Cell Responses.
ELISPOT assays were performed essentially as described previously (23 , 24) . HLA restriction of CD4+ T-cell responses was demonstrated by addition of the blocking anti-HLA-DR4 mAb 359-13F10 (5 µg/well).

PCR Analysis.
PCR analyses were performed to determine patient HLA-DR4 genotype using a commercial PCR panel according to the manufacturer’s instructions (Dynal, Oslo, Norway) and peripheral blood lymphocyte as a source DNA. Reverse transcription-PCR analysis was also used to determine tumor expression of MAGE-6 mRNA. The following primer set was used: MAGE-6 (forward: TGGAGGACCAGAGGCCCCC, reverse: CAGGATGATTATCAGGAAGCCTGT, product size 728 bp with cycles: melting 94°C for 1 min, annealing 68°C for 1 min, extension 72°C for 1 min).


   Results
Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
Discussion
 REFERENCES
 
Selection and Screening of Candidate DR4 Binding Peptides Derived from MAGE-6.
To identify a series of candidate peptides epitopes, we subjected the MAGE-6 cDNA sequence to a computer algorithm analysis designed to predict HLA-DR*0401 binding peptides (18, 19, 20) . Nine amino acid-long core sequences were evaluated and scored from 0–10, with the highest scoring sequences taken to represent peptides most likely to bind to HLA-DRß1*0401. Genomically encoded 3 amino acid long flanking extensions were added to core epitopes (i.e., 9-mers receiving an algorithm score >= 3) in syntheses. If overlapping 9-mers were identified, the cumulative sequence was produced, again with the flanking extensions added in the synthesis. A total of 15 peptides was produced for analysis (Table 1)Citation .

These selected synthetic peptides were then assessed for their comparative abilities to bind to purified HLA-DR4 molecules using a solid-state competitive-binding assay (21) . The data reported as the dose of peptide capable of inhibiting 50% of the binding of a radiolabeled reference DR4 binding peptide (IC50 in nM) to HLA-DR4w4 (-DRß1*0401) are listed in Table 1Citation . The strongest HLA-DR4 binding peptides tested were the MAGE-6102–116 and MAGE-6121–144 peptides, although the degree of affinity of these peptides for HLA-DR4 would be considered only moderate-to-low when compared with an extensive array of previously analyzed HLA-DR4/peptide binding events that used the same reference peptide (18, 19, 20) .

Immunoreactivity of CD4+ T Cells against Predicted HLA-DR4 Binding MAGE-6 Peptides in HLA-DR4+ Patients with Melanoma or RCC.
In a preliminary screen of the immunogenicity of these peptides, we evaluated the ability of CD4+ T cells isolated directly from the peripheral blood of 14 HLA-DR4 (-DRß1*0401)+ patients treated for melanoma (Table 2)Citation to recognize these putative peptide epitopes using the IFN-{gamma} ELISPOT assay. Six of these individuals (SLM1, SLM2, SLM5, SLM6, SLM9, and SLM10) were disease-free after surgery and/or immunotherapy, and we hypothesized that the current disease status might, in part, be attributed to circulating Th1-type antimelanoma CD4+ T cells. Reciprocally, the absence of disease (and chronic antigenic stimulation) may have been permissive of a biasing toward Th1-type immunity. As indicated in Table 1Citation and Fig. 1ACitation , a number of these disease-free patients displayed detectable frequencies of circulating Th0/Th1-type (i.e., IFN-{gamma} secreting) CD4+ T cells that recognized a subset of the peptides selected for analysis (i.e., MAGE-6102–116, MAGE-6121–144, MAGE-6140–170 (140L), MAGE-6145–160, MAGE-6150–165, and MAGE-6246–263). Interestingly, 7 HLA-DRB1*0401+ melanoma patients with active disease, either ocular melanoma (SLM12) or stage III or IV disease (SLM14, SLM16–19, and SLM21) exhibited minimal or no reactivity to any of the peptides analyzed in IFN-{gamma} ELISPOT assays (Fig. 1B)Citation . Among the 6 HLA-DRß1*0401+ RCC patients evaluated, a pattern of reactivity similar to that of the melanoma patients was observed. The highest frequency response was observed for a patient that was successfully treated by surgery (i.e., SLR2) and had no evidence of disease at the time of testing, whereas those RCC patients with active disease (SLR3–SLR7) were poorly responsive to MAGE-6 peptides (Fig. 1C)Citation .



View larger version (32K):
[in this window]
[in a new window]
  		Fig. 1. Peripheral blood CD4+ T-cell reactivity of HLA-DRB1*0401+ patients with melanoma or RCC against MAGE-6-derived peptides. Peripheral blood CD4+ T cells were freshly prepared from HLA-DR4+ patients with melanoma (A and B) or RCC (C) and analyzed for their reactivity to the algorithm-selected MAGE-6-derived peptides using 20-h IFN-{gamma} ELISPOT assays. Depicted are the results from 6 melanoma patients currently free of disease (NED, A), 7 melanoma patients with active disease (AD, B; see Table 2Citation for details), and 6 RCC patients (C). Peptide CS is a HLA-DR4-presented epitope derived from the malarial circumsporozooite protein that serves as a negative biological control. Data depicted represent the mean of triplicate determinations from which the mean of CD4+ T-cell responses against the control T2.DR4 (i.e., no peptide)-presenting cell line has been subtracted.

 
Immunoreactivity of CD4+ T Cells against Predicted HLA-DR4-Binding MAGE-6 Peptides in HLA-DR4+ Normal Donors after in Vitro Stimulation.
None of the peptides tested was recognized or they were recognized extremely poorly by freshly isolated CD4+ T cells harvested from a series of 5 normal HLA-DRß1*0401+ donors (Fig. 2A)Citation . To evaluate whether normal HLA-DR4+ donors could recognize any of these sequences, if appropriately activated in vitro, donor T cells were stimulated and restimulated (1 week later) with autologous DCs that had been prepulsed with a given MAGE-6 peptide identified in Table 1Citation . Resulting CD4+ T cells were used as responders against T2.DR4 target cells pulsed with the candidate DR4 binding peptides and against a HLA-DRß1*0401+/MAGE-6+ melanoma cell line SLM2 in IFN-{gamma} ELISPOT assays. Cryopreserved, freshly isolated (i.e., nonstimulated) CD4+ T cells obtained from each donor were also analyzed in these same assays to determine the basal in situ level and the impact of in vitro stimulation on the calculated frequencies of peptide-specific responder CD4+ T cells in these individuals. As shown in Fig. 2BCitation , high frequency responses were consistently observed from in vitro-stimulated CD4+ T cells against 6 of the MAGE-6-derived peptides in the IFN-{gamma} ELISPOT assay. As depicted in Fig. 3Citation , CD4+ T cells recognizing specific peptides also recognized the HLA-DRß1*0401+, MAGE-6+ SLM2 melanoma cell line, and this recognition was inhibited by inclusion of anti-DR4 mAb in the assay.



View larger version (30K):
[in this window]
[in a new window]
  		Fig. 2. Peripheral blood CD4+ T-cell reactivity of HLA-DRB1*0401+ normal donors pre-/post- in vitro stimulation against MAGE-6-derived peptides. Nonstimulated CD4+ T cells obtained from HLA-DR4+ normal donors were analyzed for their reactivity against T2.DR4 cells pulsed with the indicated MAGE-6 peptides (A). In B, CD4+ T cells were stimulated with autologous monocyte-derived DCs prepulsed with the indicated MAGE-6 peptides. After an additional restimulation with identically prepared DCs 1 week later (i.e., day 7 of culture), the resultant purified CD4+ T-cell populations were analyzed for peptide-specific reactivity in 20-h IFN-{gamma} ELISPOT assays (i.e., on day 14–17 of culture). Controls and data representation are as reported in Fig. 1Citation .

 


View larger version (42K):
[in this window]
[in a new window]
  		Fig. 3. Peptide-stimulated CD4+ T cells recognize HLA-DRB1*0401+, MAGE-6+ tumor cells. CD4+ T cells isolated from normal HLA-DR4+ donors were stimulated and restimulated with autologous DCs pulsed with the indicated peptides, as outlined in "Materials and Methods." One week after the third stimulation, responder cells were evaluated in IFN-{gamma} ELISPOT assays against T2.DR4 target cells in the absence of peptide or in the presence of immunizing peptide or irrelevant peptide (CS). The MAGE-6+ (MAGE-3-negative), HLA-DR4+ melanoma cell line target was also evaluated in the absence or presence of 5 µg/well of the anti-HLA-DR4 mAb 359-13F10. Data are reported as the mean ± SD of triplicate determinations from one representative donor of four evaluated, with similar results generated.

 
CD4+ T Cells Stimulated in Vitro with Autologous DCs Infected with Adenovirus-encoding MAGE-6 Recognize MAGE-6 Peptides and MAGE-6+ Tumor Cells.
We next investigated whether autologous DCs transfected with MAGE-6 cDNA could promote the induction of epitope-specific CD4+ T cells from normal DR4+ donors in vitro. As shown in Fig. 4Citation , autologous DCs infected with Ad-MAGE6, but not Ad-{psi}5, were able to promote the specific CD4+ Th1-type T-cell immunity. In Ad-MAGE6/DC-stimulated cultures obtained from 2 normal donors, IFN-{gamma}-secreting CD4+ T cells preferentially recognized peptides MAGE-6121–144, MAGE-6140–170, and MAGE-6150–165, with weaker responses noted against MAGE-6102–116 and MAGE-6246–263. These CD4+ T cells also recognized the MAGE-6+ SLM2 melanoma cell line in an HLA-DR4-restricted manner (Fig. 4)Citation . Overall, this suggests that immunogenic core epitope(s) resident within each of these biologically active, synthetic sequences is naturally processed and presented by MAGE-6+ Ghost DCs and by HLA-DR4+ tumors (i.e., SLM2) that constitutively express the relevant antigens.



View larger version (30K):
[in this window]
[in a new window]
  		Fig. 4. DCs infected with rAd-MAGE-6 elicit MAGE-6 peptide-specific and tumor-reactive CD4+ T cells in vitro. Immature DCs were generated in vitro from two normal HLA-DR4+ (DRB1*0401+) donors (ND1 and ND2) and infected with the indicated rAd-MAGE-6 or control rAd-{psi}5 adenoviruses at a multiplicity of infection of 250 as described previously (30) . These DCs were then used to stimulate autologous CD4+ T cells at a responder-to-stimulator ratio of 20:1. After being restimulated with identically prepared DCs on day 7 of culture, CD4+ T cells were harvested and evaluated for their reactivity against peptide-pulsed T2.DR4 target cells or the HLA-DR4+ SLM2 (MAGE-6+) melanoma cell line in the absence (SLM2-) or presence (SLM2+) of anti-HLA-DR4 mAb 359-13F10 in 20-h IFN-{gamma} ELISPOT assays. Data represent the mean ± SD of triplicate determinations.

 

   Discussion
Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
REFERENCES
 
We used peripheral blood T cells harvested from normal donors and patients with RCC or melanoma in conjunction with a peptide-binding algorithm and IFN-{gamma} ELISPOT assays to initially identify a series of MAGE-6-derived peptides that are recognized by Th1-type, HLA-DR4-restricted CD4+ T cells. Of 15 peptides analyzed, 6 (encompassing 4 distinct, nonoverlapping sequences) were consistently recognized by CD4+ T cells isolated from melanoma and RCC patients (that were clinically free of disease at the time of analysis) and from normal donors after in vitro sensitization. Freshly isolated normal donor T cells and CD4+ T cells isolated from patients with active disease did not produce IFN-{gamma} in response to any MAGE-6 peptides and typically two to three rounds of in vitro restimulation were required to expand MAGE-6-specific responders.

These data suggest that Th1-type CD4+ T cell responses to MAGE-6 may be important for immune-mediated control of melanoma/RCC tumor progression and may play a role in disease clearance and prevention of recurrence. The loss of such responses in patients with active disease may be attributable to tumor-induced immunosuppression or to the activation-induced cell death of these specific T-cell populations. Hence, therapeutic strategies targeting the potentiation of MAGE-6-reactive Th1-type CD4+ (and CD8+) T-cell responses may prove clinically beneficial.

On the basis of data provided in Table 1Citation , peptides that bound HLA-DR4w4 (-DRB1*0401) with an IC50 > 10,000 nM failed to consistently elicit IFN-{gamma} production from CD4+ T cells, and those peptides that promoted CD4+ T-cell responses would be considered to be moderate-to-low affinity (i.e., IC50s between 100-5000 nM) HLA-DR4 binders. It is hypothesized (although not investigated in this study) that variant analogues of these sequences designed to improve binding of these sequences to HLA-DR4 will promote enhanced immunoreactivity.

On the basis of the strong sequence homology between the MAGE-6 and MAGE-3 gene products (1) , the recently defined MAGE-3141–155 and MAGE-3281–295 sequences (25) and the MAGE-3119–134 sequence (26) that are also found unaltered in the MAGE-6 protein should represent MAGE-6 epitopes recognized by CD4+ T-cell lines in the context of HLA-DR11 and HLA-DR13, respectively. In the HLA-DR4 system evaluated in the current study, the MAGE-6140–155 (which contains the MAGE-6141–155 sequence) and MAGE-6280–296 (containing the MAGE-6281–295 sequence) were analyzed and found to be poorly or nonimmunogenic, suggesting that these epitopes do not represent global pan-DR-presented peptides. Interestingly, the MAGE-3146–160 peptide, which differs from the MAGE-6 sequence only at position 156 [serine (S) in MAGE-3 versus aspartate (D) in MAGE-6], has recently been reported to serve as both an HLA-DR4 and HLA-DR7-restricted epitope for CD4+ T-cell reactivity (27) . Our data suggests that the MAGE-6145–160 peptide is also recognized in the context of HLA-DR4 (albeit weakly).

Data provided in Figs. 3Citation and 4Citation suggest that CD4+ T cells recognize naturally processed epitopes constitutively presented by MAGE-6+, HLA-DR4+ tumor cells, and/or cross-presented by autologous DCs infected with rAd-MAGE-6 (but not control rAd-{psi}5). CD4+ T cells stimulated with MAGE-6-expressing DCs were able to recognize not only peptide-pulsed T2.DR4 cells but also the HLA-DR4-matched MAGE-6+ SLM2 melanoma cell line in a manner that was HLA-DR4 restricted. The range of MAGE-6 peptides recognized by Th1-type CD4+ T cells generated by priming with the complete MAGE-6 protein was essentially identical to that derived by in vitro sensitization with peptides (Figs. 2Citation and 4Citation ), suggesting that these sequences are not cryptic in vivo.

Interestingly, three of the MAGE-6 sequences recognized by CD4+ T cells in this study contain the amino acid asparagine (N), which may be posttranslationally modified into aspartate (D), potentially resulting in the HLA-DR4-presentation of the D-variant on cell surface of MAGE-6+/HLA-DR4+ DCs (via rAd-MAGE-6 infection) or MAGE-6+/HLA-DR4+ tumor cells. Skipper et al. (28) have previously demonstrated that this modification yields the naturally processed and HLA-A2-presented tyrosinase368–376 (YMDGTMSQV) epitope, and we have also recently shown that a posttranslationally modified tyrosinase365–381D, but not the genomically encoded tyrosinase365–381N peptide, serves as a strong HLA-DR4-presented immunogen recognized by melanoma-reactive CD4+ T cells. The observed enhanced immunoreactivity of the tyrosinase365–381D peptide could be attributed, in part, to its ~100-fold better binding affinity to HLA-DRß1*0401 (19) . We will prospectively evaluate the immunogenicity of the D-variants of MAGE-6121–144D, MAGE-6140–170D, and MAGE-6246–263D in promoting CD4+ T-cell responses.

The immunogenic MAGE-6 peptides identified in this study are presented by HLA-DR4, which is expressed by 15–20% of the North American population afflicted with RCC or melanoma (29) . The clinical use of these sequences would be enhanced greatly if they could be presented in the context of additional HLA-DR alleles to tumor-reactive CD4+ T cells. Our preliminary analysis suggests that a number of these epitopes bind to a broad range of MHC class II alleles (Table 3)Citation . For instance, the MAGE-6102–116 peptide binds to (at least) the HLA-DR1, HLA-DR4, HLA-DR7, HLA-DR8, HLA-DR9, HLA-DR11, HLA-DR13, HLA-DR15, and HLA-DRw53 (i.e., -DRß4*0401) alleles that cover in excess of one-half of patients with RCC or melanoma (29) . Prospective studies will assess the ability of Th1- and Th2-type CD4+ T cells restricted by non-DR4 class II alleles to recognize such pan-DR epitopes to justify the use of these peptides in vaccines and immune monitoring protocols treating patients with melanoma or RCC.


View this table:
[in this window]
[in a new window]
  		Table 3 Extended range of HLA-DR (non-DR4) alleles binding immunogenic MAGE-6 epitopesa

 


   ACKNOWLEDGMENTS
 
We thank Dr. Walter Olson and William Knapp for their excellent technical support and to Drs. Jan Mueller-Berghaus, Eva Pizzoferrato, Anna Kalinska, and Cynthia Brissette-Storkus for their careful review and comments during the generation of this manuscript.


   FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by NIH Grants CA 57840 and CA 73743 (to W. J. S.), CA 57653 (to C. L. S.), and NIH contract N01-AI 95362 (to A. S.). Back

2 Both authors contributed equally to this study. Back

3 To whom requests for reprints should be addressed, at University of Pittsburgh School of Medicine, L132e Hillman Cancer Center, UPCI Research Pavilion, 5117 Center Avenue, Pittsburgh, PA 15213. Phone: (412) 623-3240; Fax: (412) 623-7704; E-mail: storkuswj{at}msx.upmc.edu Back

4 The abbreviations used are: RCC, renal cell carcinoma; DC, dendritic cell; PBMC, peripheral blood mononuclear cell; mAb, monoclonal antibody; rhIL, recombinant human interleukin; ELISPOT, enzyme-linked immunospot. Back

Received 7/22/02; revised 10/18/02; accepted 10/23/02.


   REFERENCES
Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 

  1. Imai Y., Shichijo S., Yamada A., Katayama T., Yano H., Itoh K. Sequence analysis of the MAGE gene family encoding human tumor-rejection antigens. Gene (Amst.), 160: 287-290, 1995.[CrossRef][Medline]
  2. Itoh K., Hayashi A., Nakao M., Hoshino T., Seki N., Shichijo S. Human tumor rejection antigens MAGE. J. Biochem. (Tokyo), 119: 385-390, 1996.[Abstract/Free Full Text]
  3. Gibbs P., Hutchins A. M., Dorian K. T., Vaughan H. A., Davis I. D., Silvapulie M., Cebon J. S. MAGE-12 and MAGE-6 are frequently expressed in malignant melanoma. Melanoma Res., 10: 259-264, 2000.[Medline]
  4. Zambon A., Mandruzzato S., Parenti A., Macino B., Dalerba P., Ruol A., Merigliano S., Zaninotto G., Zanovello P. MAGE, BAGE, and GAGE gene expression in patients with esophageal squamous cell carcinoma and adenocarcinoma of the gastric cardia. Cancer (Phila.), 91: 1882-1888, 2001.[CrossRef][Medline]
  5. Hasagawa H., Mori M., Haraguchi M., Ueo H., Sugimachi K., Akiyoshi T. Expression spectrum of melanoma antigen-encoding gene family members in colorectal carcinoma. Arch. Pathol. Lab. Med., 122: 551-554, 1998.[Medline]
  6. Ishida H., Matsumura T., Salgaller M. L., Ohmizono Y., Kadono Y., Sawada T. MAGE-1 and MAGE-3 or -6 expression in neuroblastoma-related pediatric solid tumors. Int. J. Cancer, 69: 375-380, 1996.[CrossRef][Medline]
  7. Sudo T., Kuramoto T., Komiya S., Inoue A., Itoh K. Expression of MAGE genes in osteosarcoma. J. Orthop. Res., 15: 128-132, 1997.[CrossRef][Medline]
  8. Jager D., Jager E., Knuth A. Vaccination for malignant melanoma: recent developments. Oncology, 60: 1-7, 2001.[CrossRef][Medline]
  9. Weber J. Melanoma peptide vaccines: from preclinical background to clinical trials. Curr. Oncol. Rep., 2: 38-47, 2000.[Medline]
  10. Rivoltini L., Loftus D. J., Squarcina P., Castelli C., Rini F., Arienti F., Belli F., Marincola F. M., Geisler C., Borsatti A., Appella E., Parmiani G. Recognition of melanoma-derived antigens by CTL: possible mechanisms involved in down-regulating anti-tumor T-cell reactivity. Crit. Rev. Immunol., 18: 55-63, 1998.[Medline]
  11. Brasanac D., Markovic-Lipokovski J., Hadzi-Djokic J., Muller G. A., Muller C. A. Immunohistochemical analysis of HLA class II antigens and tumor infiltrating mononuclear cells in renal cell carcinoma: correlation of clinical and histopathological data. Neoplasma, 46: 173-178, 1999.[Medline]
  12. Taramelli D., Fossati G., Mazzocchi A., Delia D., Ferrone S., Parmiani G. Classes I and II HLA and melanoma-associated antigen expression and modulation on melanoma cells isolated from primary and metastatic lesions. Cancer Res., 46: 433-439, 1986.[Abstract/Free Full Text]
  13. Ruiter D. J., Mattijssen V., Broecker E. B., Ferrone S. MHC antigens in human melanomas. Semin. Cancer Biol., 2: 35-45, 1991.[Medline]
  14. Hoffmann T. K., Meidenbauer N., Muller-Berghaus J., Storkus W. J., Whiteside T. L. Proinflammatory cytokines and CD40 ligand enhance cross-presentation and cross-priming capability of human dendritic cells internalizing apoptotic cancer cells. J. Immunother., 24: 162-171, 2001.
  15. Lowes M. A., Bishop G. A., Crotty K., Barnetson R. S., Halliday G. M. T helper 1 cytokine mRNA is increased in spontaneously regressing primary melanoma. J. Investig. Dermatol., 108: 914-919, 1997.[CrossRef][Medline]
  16. Schwaab T., Heaney J. A., Schned A. R., Harris R. D., Cole B. F., Noelle R. J., Phillips D. M., Stempkowski L., Ernstoff M. S. A randomized Phase II trial comparing two different sequence combinations of autologous vaccine and human recombinant interferon gamma and human recombinant interferon {alpha}2B therapy in patients with metastatic renal cell carcinoma: clinical outcome and analysis of immunological parameters. J. Urol., 163: 1322-1327, 2000.[CrossRef][Medline]
  17. Turvy D. N., Blum J. S. Detection of biotinylated cell surface receptors and MHC molecules in a capture ELISA: a rapid assay to measure endocytosis. J. Immunol. Methods, 212: 9-18, 1998.[CrossRef][Medline]
  18. Zarour H., Kirkwood J. M., Kierstead L. S., Herr W., Brusic V., Slingluff C. L., Jr., Sette A., Southwood S., Storkus W. J. MART-151–73 represents an immunogenic HLA-DR4-restricted epitope recognized by melanoma-reactive CD4+ T cells. Proc. Natl. Acad. Sci. USA, 97: 400-405, 2000.[Abstract/Free Full Text]
  19. Kierstead L. S., Ranieri E., Brusic V., Sidney J., Sette A., Slingluff C. L., Jr., Kirkwood J. M., Storkus W. J. Multiple gp100- and tyrosinase-derived peptides are recognized by melanoma-reactive CD4+ Th1-type T cells. Br. J. Cancer, 85: 1738-1745, 2001.[CrossRef][Medline]
  20. Honeyman M. C., Brusic V., Stone N. L., Harrison L. C. Neural network-based predictions of candidate T-cell epitopes. Nat. Biotechnol., 16: 966-969, 1998.[CrossRef][Medline]
  21. Southwood S., Sidney J., Kondo A., Del Guercio M-F., Appella E., Hoffman S., Kubo R. T., Chesnut R. W., Grey H. M., Sette A. Several common HLA-DR types share largely overlapping peptide binding repertoires. J. Immunol., 160: 3363-3383, 1998.[Abstract/Free Full Text]
  22. Tueting T., Wilson C. C., Martin D. M., Kazamon Y., Rowles J., Ma D. I., Slingluff C. L., Jr., Wagner S. N., van der Bruggen P., Baar J., Lotze M. T., Storkus W. J. Autologous human monocyte-derived dendritic cells genetically modified to express melanoma antigens elicit primary cytotoxic T cell responses in vitro: enhancement by cotransfection of genes encoding the Th1-biasing cytokines IL-12 and IFN-{gamma}. J. Immunol., 160: 1139-1147, 1998.[Abstract/Free Full Text]
  23. Herr W., Ranieri E., Olson W., Zarour H., Gesualdo L., Storkus W. J. Mature dendritic cells pulsed with tumor freeze-thaw lysate define an effective in vitro vaccine designed to elicit EBV-specific CD4+ and CD8+ T lymphocyte responses. Blood, 96: 1857-1864, 2000.[Abstract/Free Full Text]
  24. Herr W., Ranieri E., Gambotto A., Kierstead L. S., Amoscato A. A., Gesualdo L., Storkus W. J. Identification of naturally-processed HLA-presented Epstein-Barr virus peptides recognized by ex vivo CD4+ or CD8+ T lymphocytes from human blood. Proc. Natl. Acad. Sci. USA, 96: 12033-12038, 1999.[Abstract/Free Full Text]
  25. Manici S., Sturniolo T., Imro M. A., Hammer J., Sinigaglia F., Noppen C., Spagnoli G., Mazzi B., Bellone M., Dellabona P., Protti M. P. Melanoma cells present a MAGE-3 epitope to CD4(+) cytotoxic T cells in association with histocompatibility leukocyte antigen DR11. J. Exp. Med., 189: 871-876, 1999.[Abstract/Free Full Text]
  26. Chaux P., Vantomme V., Stroobant V., Thielemans K., Corthals J., Luiten R., Eggermont A. M., Boon T., van der Bruggen P. Identification of MAGE-3 epitopes presented by HLA-DR molecules to CD4(+) T lymphocytes. J. Exp. Med., 189: 767-778, 1999.[Abstract/Free Full Text]
  27. Kobayashi H., Song Y., Hoon D. S., Appella E., Celis E. Tumor-reactive T helper lymphocytes recognize a promiscuous MAGE-A3 epitope presented by various major histocompatibility complex class II alleles. Cancer Res., 61: 4773-4778, 2001.[Abstract/Free Full Text]
  28. Skipper J. C., Hendrickson R. C., Gulden P. H., Brichard V., Van Pel A., Chen Y., Shabinowitz J., Wolfel T., Slingluff C. L., Jr., Boon T., Hunt D. F., Engelhard V. H. An HLA-A2-restricted tyrosinase antigen on melanoma cells results from posttranslational modification and suggests a novel pathway for processing of membrane proteins. J. Exp. Med., 183: 527-534, 1996.[Abstract/Free Full Text]
  29. Gjertson, D. W, and S. H. Lee. HLA 1998. In: D. W. Gjertson and P. I. Terasaki (eds.), UCLA Tissue Typing Laboratory, Los Angeles, CA. Am. Soc. Histocompatibility and Immunogenetics, p. 450. 1998.
  30. Ranieri E., Herr W., Gambotto A., Olson W., Robbins P. D., Salvucci-Kierstead L., Waykins S. C., Gesualdo L., Storkus W. J. Dendritic cells transduced with an adenoviral vector encoding the Epstein-Barr Virus latent membrane protein 2B: a new modality for vaccination. J. Virol., 73: 10416-10425, 1999.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Cancer Res.Home page
T. Das, G. Sa, C. Hilston, D. Kudo, P. Rayman, K. Biswas, L. Molto, R. Bukowski, B. Rini, J. H. Finke, et al.
GM1 and Tumor Necrosis Factor-{alpha}, Overexpressed in Renal Cell Carcinoma, Synergize to Induce T-Cell Apoptosis
Cancer Res., March 15, 2008; 68(6): 2014 - 2023.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
L. Vujanovic, M. Mandic, W. C. Olson, J. M. Kirkwood, and W. J. Storkus
A Mycoplasma Peptide Elicits Heteroclitic CD4+ T Cell Responses against Tumor Antigen MAGE-A6
Clin. Cancer Res., November 15, 2007; 13(22): 6796 - 6806.
[Abstract] [Full Text] [PDF]

Home page
 JCOHome page
J. M. Kirkwood
Building Upon the Standard of Care in Adjuvant Therapy of High-Risk Melanoma
J. Clin. Oncol., December 1, 2005; 23(34): 8559 - 8563.
[Full Text] [PDF]

Home page
 Cancer Res.Home page
D. A. Hokey, A. T. Larregina, G. Erdos, S. C. Watkins, and L. D. Falo Jr.
Tumor Cell Loaded Type-1 Polarized Dendritic Cells Induce Th1-Mediated Tumor Immunity
Cancer Res., November 1, 2005; 65(21): 10059 - 10067.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
A. Paschen, M. Song, W. Osen, X. D. Nguyen, J. Mueller-Berghaus, D. Fink, N. Daniel, M. Donzeau, W. Nagel, H. Kropshofer, et al.
Detection of Spontaneous CD4+ T-Cell Responses in Melanoma Patients against a Tyrosinase-Related Protein-2-Derived Epitope Identified in HLA-DRB1*0301 Transgenic Mice
Clin. Cancer Res., July 15, 2005; 11(14): 5241 - 5247.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
P. Rayman, A. K. Wesa, A. L. Richmond, T. Das, K. Biswas, G. Raval, W. J. Storkus, C. Tannenbaum, A. Novick, R. Bukowski, et al.
Effect of Renal Cell Carcinomas on the Development of Type 1 T-Cell Responses
Clin. Cancer Res., September 15, 2004; 10(18): 6360S - 6366S.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
J. Lin, L. Lin, D. G. Thomas, J. K. Greenson, T. J. Giordano, G. S. Robinson, R. A. Barve, F. A. Weishaar, J. M. G. Taylor, M. B. Orringer, et al.
Melanoma-Associated Antigens in Esophageal Adenocarcinoma: Identification of Novel MAGE-A10 Splice Variants
Clin. Cancer Res., September 1, 2004; 10(17): 5708 - 5716.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
H. L. Hanson, S. S. Kang, L. A. Norian, K. Matsui, L. A. O'Mara, and P. M. Allen
CD4-Directed Peptide Vaccination Augments an Antitumor Response, but Efficacy Is Limited by the Number of CD8+ T Cell Precursors
J. Immunol., April 1, 2004; 172(7): 4215 - 4224.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tatsumi, T.
Right arrow Articles by Storkus, W. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tatsumi, T.
Right arrow Articles by Storkus, W. J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online