
Clinical Cancer Research Vol. 9, 2015-2021, June 2003
© 2003 American Association for Cancer Research
Experimental Therapeutics, Preclinical Pharmacology |
Helicobacter pylori VacA Toxin Up-Regulates Vascular Endothelial Growth Factor Expression in MKN 28 Gastric Cells through an Epidermal Growth Factor Receptor-, Cyclooxygenase-2-dependent Mechanism1
Rosa Caputo2,
Concetta Tuccillo2,
Barbara A. Manzo,
Raffaele Zarrilli,
Giampaolo Tortora,
Camillo Del Vecchio Blanco,
Vittorio Ricci,
Fortunato Ciardiello3 and
Marco Romano3
Dipartimento di Internistica Clinica e Sperimentale-Cattedra di Gastroenterologia, Seconda Università di Napoli, Napoli [C. T., B. A. M., C. D. V. B., M. R.]; Dipartimento di Endocrinologia ed Oncologia Molecolare e Clinica, Università Federico II, 80131 Napoli [R. C., G. T., F. C.]; Dipartimento di Biologia e Patologia Cellulare e Molecolare, Università Federico II, Napoli [R. Z.]; and Istituto di Fisiologia Umana, Università di Pavia [V. R.], Italy
 |
ABSTRACT
|
|---|
Purpose: Helicobacter pylori causes gastric damage and is involved in gastric carcinogenesis. Vascular endothelial growth factor (VEGF) plays a major role in gastric mucosa repair and is overexpressed in gastric cancer. We investigated: (a) whether H. pylori, and in particular H. pylori VacA toxin, affected VEGF expression in gastric epithelial cells in culture; and (b) the signal transduction pathway involved in any effect exerted by H. pylori.
Experimental Design: MKN-28 cells were incubated with uninoculated BCF (control) or with BCF obtained from VacA-producing wild-type H. pylori 60190 strain or from its isogenic mutant 60190:v1, specifically lacking vacA gene in the presence or absence of ZD 1839, a selective inhibitor of the epidermal growth factor receptor (EGFR) tyrosine kinase, PD098059, a selective inhibitor of mitogen-activated protein (MAP)/extracellular signal-regulated kinase (ERK) kinase, the kinase responsible for ERK phosphorylation, or SC-236, a selective inhibitor of cyclooxygenase (COX)-2 for 2448 h.
Results: (a) Toxigenic H. pylori up-regulated VEGF mRNA and protein expression and caused a 2.5-fold increase in VEGF release compared with control, whereas nontoxigenic H. pylori did not; (b) H. pylori VacA toxin-induced up-regulation of VEGF was counteracted by selective inhibition of EGFR tyrosine kinase; (c) toxigenic H. pylori activated the ERK/MAP kinase cascade, and inhibition of MAP kinase activation counteracted H. pylori-induced VEGF up-regulation; (d) toxigenic H. pylori up-regulated COX-2 expression, and this effect was counteracted by blockade of EGFR tyrosine kinase; and (e) COX-2 selective inhibition counteracted H. pylori-induced up-regulation of VEGF.
Conclusion: (a) H. pylori up-regulates VEGF expression in gastric epithelial cells; and (b) this effect is specifically related to VacA toxin and seems to depend on the activation of an EGFR-, MAP kinase-, and COX-2-mediated pathway.
 |
Introduction
|
|---|
Helicobacter pylori is the major causative agent of chronic superficial gastritis and peptic ulcer disease in humans (1)
. Moreover, epidemiological and interventional studies in humans, as well as experimental studies in rodents, strongly indicate that H. pylori infection increases the risk for developing adenocarcinoma of the distal stomach (2, 3, 4)
.
H. pylori-related gastroduodenal disease depends on the inflammatory response of the host and release of a number of bacterial virulence factors (5)
. In particular, a Mr
90,000 cytotoxin (VacA) that causes vacuole formation in epithelial cells in vitro is produced by 60% of wild-type isolates of H. pylori (6)
. Essentially, all H. pylori strains possess the vacA gene, and nearly all strains secrete a VacA product, but those that have the cytotoxin phenotype (encoded by vacA alleles belonging to the type s1 family) are referred to as Tox+. An increasing body of evidence indicates that, in western countries, H. pylori strains producing a vacuolating VacA are preferentially associated with the development of peptic ulcer disease or gastric cancer (7)
.
VEGF,4
the most well-characterized angiogenic factor (8)
, plays a major role in the multistep process leading to the reconstruction of normal mucosa architecture by stimulating the process of angiogenesis, which ensures that healing tissues receive an adequate supply of nutrients (9)
. Moreover, VEGF plays a pivotal role in tumor-associated microvascular angiogenesis (10)
and has been demonstrated to be overexpressed in human gastric carcinomas (11, 12, 13)
.
We have shown previously that H. pylori up-regulates the expression of EGF-related growth factors and COX-2, the inducible isoform of the enzyme responsible for prostaglandin production (14)
, in human gastric epithelial cells in vitro (15
, 16)
, as well as in human gastric mucosa in vivo (17
, 18)
. In addition, COX-2 products (i.e., prostaglandins) are known to stimulate VEGF production (19)
. Whether H. pylori affects VEGF expression is not known.
This study was therefore designed to evaluate whether H. pylori alters VEGF expression in gastric epithelial cells in vitro and to assess the role of H. pylori vacuolating cytotoxin VacA in any such effect. In addition, we sought to dissect out the signal transduction pathway involved in any effect exerted by H. pylori on VEGF expression. Our study indicates that H. pylori up-regulates VEGF expression in gastric epithelial cells and that this effect depends on the expression of VacA because it was not observed with an isogenic mutant specifically lacking vacA. Additionally, H. pylori VacA-induced up-regulation of VEGF seems to be mediated by the activation of the EGFR and to depend on COX-2 activity because it is counteracted by selective inhibition of EGFR tyrosine kinase or COX-2. We postulate that VEGF is involved in the reparative response of human gastric mucosa to H. pylori infection and that VEGF overexpression might participate in the pathogenesis of H. pylori-related gastric carcinogenesis.
 |
Materials and Methods
|
|---|
Materials.
Clinical grade ZD1839 (Iressa) was provided by AstraZeneca Pharmaceuticals (Macclesfield, United Kingdom). MAP kinase inhibitor PD098059 was from Calbiochem (La Jolla, CA). SC-236 was from Pharmacia (Upsala, Sweden).
Bacterial Strains and Growth Conditions.
We used the urease-positive Tox+ (type s1a/m1 vacA allele) CagA+ wild-type H. pylori strain 60190 (ATCC 49503) and its isogenic mutant 60190:v1 in which vacA gene was disrupted by insertional mutagenesis (Ref. 20
; both strains kindly provided by T. L. Cover and M. J. Blaser, Nashville, TN). Bacteria were grown in brucella broth (DIFCO Laboratories, Detroit, MI) supplemented with 1% Vitox (Oxoid, Basingstoke, United Kingdom) and 5% FCS (Life Technologies, Inc., Paisley, United Kingdom) for 2436 h at 37°C in a thermostatic shaker under microaerobic conditions. As described previously (21
, 22)
, when bacterial suspensions reached 1.2 absorbance units at 450 nm (corresponding to a bacterial concentration of 5 x 108 colony-forming units/ml), bacteria were removed by centrifugation (12,000 x g for 10 min), and the supernatants were sterilized by passage through a 0.22-µm pore-size cellulose acetate filter (Nalgene, Rochester, NY) to obtain the BCFs. The presence or absence of VacA in H. pylori BCFs was verified by SDS-PAGE followed by immunoblotting with an anti-VacA rabbit polyclonal antiserum, as described previously (15)
. In all of the experiments, BCFs were used at a dilution of 1:3, and uninoculated broth filtrate served as a control.
Human Gastric Epithelial Cells in Culture.
We used the MKN 28 cell line. This cell line derives from a well-differentiated human gastric tubular adenocarcinoma and shows gastric-type differentiation (23)
. MKN 28 cells were grown as monolayers in DMEM Hams nutrient mixture F-12 (1:1; Sigma, St. Louis, MO) supplemented with 10% FCS (Life Technologies, Inc.) at 37°C in a humidified atmosphere of 5% CO2.
VEGF Concentration in the Conditioned Media.
The concentration of VEGF in the conditioned media from MKN 28 cells was measured using a commercially available sandwich ELISA kit (R&D Systems, Inc., Minneapolis, MN), according to the manufacturers instructions, as described previously (24)
. Assays were performed on serum-free medium collected after 24 or 48 h of cell incubation. Results were normalized for the number of producing cells and reported as pg/106 cells.
Western Blot Analysis.
Total cell protein extracts (50 µg of total proteins/lane) were resolved by electrophoresis using 7.5 or 12.5% SDS-PAGE precast gels (Bio-Rad Laboratories, Milan, Italy) as appropriate, transferred to BA 85 0.45 µm PROTAN nitrocellulose filters (Schleicher & Schnell, Inc., Dassel, Germany), blocked with 5% nonfat dry milk (Bio-Rad Laboratories, Hercules, CA) in phosphate buffer solution 1X with 0.1% Tween, and incubated with appropriate primary antibodies. Peroxidase-conjugated antirabbit or antimouse or antigoat secondary antibodies (Amersham International, Buckinghamshire, United Kingdom) were incubated at the dilution of 1:2000. Immunoreactive proteins were visualized by enhanced chemiluminescence (Amersham International) as described previously (25)
. Immunoblot analysis using anti-ß-actin antisera was performed as a control for protein loading. The primary antibodies (all from Santa Cruz Biotechnology Inc., Santa Cruz, CA) include: (a) antihuman VEGF (mouse monoclonal, sc-7269, used at the dilution of 1:1000); (b) antihuman COX-2 (rabbit polyclonal sc-7951, used at the dilution of 1:1000); (c) antihuman actin (goat polyclonal sc-1615, used at the dilution of 1:1000); and (d) anti-ERK-2 (mouse monoclonal sc-1647, used at the dilution of 1:1000).
RNA Extraction.
Total RNA was isolated from MKN-28 cells using an RNA extraction reagent, TRIzol (Invitrogen Life Technologies, Inc., Grand Island, NY), according to the standard acid-guanidium-phenol-chloroform method (26)
.
RT-PCR.
RT-PCR analysis was performed on total RNA as described previously (17
, 27)
. First-strand complementary DNA was prepared using 200 units of RT (Supertranscript RT, Life Technologies, Inc., Gaithersburg, MD), 1 µg of total RNA as template, and 10 pmol/liter random hexamers in the presence of 0.1 mmol/liter DTT, 0.5 mmol/liter deoxynucleotide triphosphate-litium salt (Pharmacia, Milan, Italy), and 20 units of RNase inhibitor (Promega, Madison, WI). The reaction profile was 37°C x 10 min, followed by 42°C x 60 min. To control for contamination by genomic DNA, all RNA samples were run in duplicate with or without the addition of RT. RT-PCR coamplification of VEGF/GAPDH transcript was performed using VEGF (sense, TGGATCCATGAACTTTCTGCTGTC; antisense, TCACCGCCTTGGCTTGTCACAT) and GAPDH (sense, CACCATCTTCCAGGAGCGAG; antisense, TCACGC-CACAGTTTCCCGGA)-specific primers (provided by PRIMM Srl, Milano, Italy, and used at the final concentration of 2 mmol/liter). Primers were placed on different exons. GAPDH primers were as described previously (15
, 17)
. VEGF primers were designed on the basis of the coding sequences of the human VEGF mRNA (28)
. These primers were chosen based on their ability to recognize all known VEGF splice variants. PCR amplifications were performed using 50 ng of cDNA in the presence of 0.2 mM deoxynucleotide triphosphate (Boehringer Mannheim, Mannheim, Germany) and 0.3 µl of AmpliTaq DNA polymerase (Perkin-Elmer, Branchburg, NJ). MgCl2 was added at the final concentration of 1.5 mmol/liter. After an initial denaturation step, 95°C x 5 min, the PCR amplification was performed using the following profile: 94°C x 40 s, 57°C x 1 min, and 72°C x 1 min for 35 cycles. GAPDH primers were added after seven cycles, and the final extension was at 72°C x 10 min. PCR products were separated on 1.8% agarose gel electrophoresis and visualized by ethidium bromide staining. Sizes of the amplified fragments were estimated from migration of the 1-kb ladder molecular weight marker (Life Technologies, Inc.), and identity was assessed by restriction enzyme digestion. To test for contamination by genomic DNA, samples were run in duplicate with (+RT) or without (-RT) the addition of RT. Three kinds of PCR product of 656, 584, and 452 bp were obtained, which encoded VEGF isoforms VEGF189, VEGF165, and VEGF121, respectively.
 |
Results
|
|---|
H. pylori Stimulates VEGF Release from MKN 28Role of VacA Cytotoxin and of EGFR Activation.
After 24- or 48-h incubation with uninoculated BCF (control) or BCFs obtained from Tox+ H. pylori 60190 strain, we observed a 2.5-fold increase in VEGF concentration in the conditioned media of MKN 28 cells (Fig. 1)
. This effect was not observed after incubation with the Tox- isogenic mutant of the bacterium specifically lacking vacA, thus implying that the effect is related to the production of the VacA cytotoxin (Fig. 1)
. To asses whether H. pylori-induced increase in VEGF release might be contributed to by the activation of the EGFR, we incubated MKN 28 with BCF from Tox+ H. pylori strain in the presence or absence of the selective EGFR tyrosine kinase inhibitor ZD1839 (1 µM). The stimulating effect on VEGF release exerted by Tox+ H. pylori strain was completely counteracted by selective EGFR tyrosine kinase inhibition (Fig. 1)
. Comparable effect was observed using bacterial suspensions from the same H. pylori strains (data not shown). Therefore, the subsequent experiments were carried out using H. pylori BCFs only.

View larger version (25K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 1. Tox+ H. pylori BCF up-regulates VEGF release in the conditioned media of MKN 28 cells through an EGFR-mediated pathway. MKN 28 cells were incubated for 24 or 48 h with uninoculated BCF (Control) or BCFs from Tox+ H. pylori or Tox- H. pylori strains in the presence or absence of the selective EGFR tyrosine kinase inhibitor ZD1839 (1 µM). Data are presented as mean ± SD from two different experiments, each performed in triplicate. Results were normalized for the number of producing cells and reported as pg/106 cells.
|
|
Tox+ H. pylori Up-Regulates VEGF Protein and mRNA Expression in MKN 28 Cells through an EGFR-mediated Pathway, whereas Tox- H. Pylori Does Not.
To determine whether Tox+ H. pylori up-regulated VEGF protein expression, protein cellular extracts from Tox+ H. pylori-treated or untreated (control) MKN 28 cells were analyzed by Western blot using an antiserum specific for VEGF (Fig. 2)
. A VEGF immunoreactive peptide of Mr
21,000 was detected in control untreated cells, and incubation with Tox+ H. pylori BCFs caused a time-dependent increase in the expression of VEGF (Fig. 2A)
. We then sought to evaluate whether this effect was also observed with Tox- H. pylori BCFs and whether selective inhibition of EGFR tyrosine kinase affected H. pylori stimulation of VEGF expression. Fig. 2B
shows that 48-h incubation with Tox+ but not Tox- H. pylori BCFs up-regulates VEGF protein expression in MKN 28 cells. In addition, selective EGFR tyrosine kinase inhibition counteracts Tox+ H. pylori-induced increase in VEGF protein expression. We next asked whether the effect of H. pylori on VEGF production was at the RNA level by determining VEGF mRNA expression in H. pylori-treated or untreated (control) MKN 28 cells through RT-PCR. We found that Tox+ H. pylori, but not Tox- H. pylori, BCF up-regulated VEGF mRNA expression (Fig. 3)
, causing an increase in VEGF mRNA levels, which peaked after 48-h incubation. Treatment with the EGFR tyrosine kinase inhibitor ZD1839 counteracted Tox+ H. pylori-induced up-regulation of VEGF mRNA expression (Fig. 3)
.

View larger version (56K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 2. Tox+ H. pylori BCF up-regulates VEGF protein expression in MKN 28 cells through an EGFR-mediated pathway. A, time course of Tox+ H. pylori-induced up-regulation of VEGF; cells were incubated for ≤48 h with uninoculated BCF (control) or BCF from Tox+ H. pylori. B, effect of the selective EGFR tyrosine kinase inhibitor ZD1839 on Tox+ H. pylori-induced up-regulation of VEGF protein expression; cells were incubated for 48 h with uninoculated BCF (control), Tox+ H. pylori BCF, or Tox- H. pylori BCF in the presence or absence of ZD1839 (1 µM). At the end of the incubation time, cells were lysed, and immunoblot analysis was performed using an anti-VEGF monoclonal antibody. Immunoblot analysis using anti-ß-actin antisera was performed as a control for protein loading. Arrows, VEGF and ß-actin immunoreactive bands. Representative Western blots of three independent experiments are shown.
|
|

View larger version (40K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 3. Tox+ H. pylori BCF up-regulates VEGF mRNA expression, whereas Tox- H. pylori BCF does not; effect of EGFR tyrosine kinase inhibition. RT-PCR coamplification of VEGF/GAPDH transcripts in MKN 28 cells incubated for ≤48 h with uninoculated BCF (control), Tox+ H. pylori BCF, or Tox- H. pylori BCF in the presence or absence of ZD1839 (1 µM). VEGF isoforms were analyzed by RT-PCR using oligonucleotide primers designed to detect all known splice variants. Aliquots from each PCR product were electrophoresed on a 1.8% agarose gel. The size of amplification products was determined by a 1-kb ladder. Expected amplification products of 452, 584, and 656 bp correspond to VEGF isoforms VEGF121, VEGF165, and VEGF189, respectively. Data are representative of three independent experiments. C, control (i.e., MKN 28 cells incubated with uninoculated BCF).
|
|
Inhibition of MAP Kinase Cascade Activation Counteracts Tox+ H. pylori-induced Increase in VEGF Expression in MKN 28 Gastric Epithelial Cells.
Increased expression of VEGF is mediated by the activation of the MAP kinase cascade (29)
. We therefore asked whether H. pylori activated the MAP kinase cascade in MKN 28 cells and, if so, whether inhibition of MAP kinase counteracted H. pylori-induced up-regulation of VEGF expression. MKN 28 cells were incubated with Tox+ H. pylori BCF or uninoculated BCF (control) for ≤60 min in the presence or absence of ZD1839 (a selective EGFR tyrosine kinase inhibitor) or PD098059 (a selective inhibitor of MAP/ERK kinase, the kinase responsible for ERK phosphorylation). As illustrated in Fig. 4A
, Tox+ H. pylori time dependently activated ERK-2 phosphorylation with maximal effect exerted at 10 and 30 min, and this was efficiently counteracted by either ZD1839 or PD98059 (Fig. 4A)
. Subsequently, MKN 28 cells were incubated with Tox+ H. pylori BCF or uninoculated BCF (control) for 48 h in the presence or absence of the selective inhibitor of MAP/ERK kinase, PD98059. Inhibition of MAP kinase activation counteracted H. pylori-induced up-regulation of VEGF expression (Fig. 4B)
.

View larger version (30K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 4. Inhibition of MAP kinase activation counteracts Tox+ H. pylori-induced up-regulation of VEGF. In A, Tox+ H. pylori activates the phosphorylation of ERK-2, and this is counteracted by specific inhibition of EGFR tyrosine kinase or MAP kinase activation. MKN 28 cells were incubated for ≤60 min with uninoculated BCF (control) or Tox+ H. pylori BCF or for 10 min with Tox+ H. pylori BCF in the presence of ZD1839 (1 µM) or PD098059 (40 µM). At the end of the incubation time, cells were lysed, and immunoblot analysis was performed using anti-ERK-2 antisera. In B, PD098059, a specific inhibitor of MAP kinase activation, counteracts Tox+ H. pylori-induced up-regulation of VEGF. MKN 28 cells were incubated for 48 h with uninoculated BCF (control) or Tox+ H. pylori BCF in the presence or absence of PD098059 (40 µM). At the end of the incubation time, cells were lysed, and immunoblot analysis was performed using anti-VEGF antisera. Representative Western blots of three independent experiments are shown. C, control (i.e., MKN 28 cells incubated with uninoculated BCF); ZD, ZD1839; PD, PD098059.
|
|
Selective COX-2 Blockade Counteracts Tox+ H. pylori-induced Up-Regulation of VEGF Expression in MKN 28 Cells.
COX-2 is involved in the up-regulation of VEGF expression in a number of experimental models (19
, 30
, 31)
. We have shown previously that H. pylori up-regulates COX-2 expression in MKN 28 cells and human gastric mucosa in vivo (16
, 18)
. In addition, exposure of MKN 28 cells to H. pylori is associated with up-regulation of the expression of heparin-binding EGF-like growth factor and amphiregulin, members of the EGFR family of ligands, which, in turn, are able to up-regulate COX-2 mRNA expression (15
, 17) . We therefore hypothesized that H. pylori-induced up-regulation of VEGF might be mediated by an increase in COX-2 expression through the activation of the EGFR. To this end, we first investigated COX-2 expression in MKN 28 cells exposed to uninoculated BCF (control) or Tox+ H. pylori BCF in the absence or presence of the EGFR tyrosine kinase inhibitor ZD1839. Blockade of EGFR activation efficiently counteracted Tox+ H. pylori-induced increase in COX-2 protein expression (Fig. 5A)
. We then examined VEGF expression in MKN 28 cells treated with uninoculated BCF (control) or Tox+ H. pylori BCF in the absence or presence of the COX-2 selective inhibitor SC- 236 (10 µM) for 48 h. Our data show that selective COX-2 inhibition efficiently counteracted H. pylori-induced up-regulation of VEGF expression (Fig. 5B)
.

View larger version (33K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 5. Selective COX-2 inhibition counteracts Tox+ H. pylori-induced up-regulation of VEGF. In A, Tox+ H. pylori up-regulates COX-2 expression, and this is inhibited by EGFR tyrosine kinase inhibition. MKN 28 cells were incubated for 48 h with uninoculated BCF (control) or Tox+ H. pylori BCF in the presence or absence of ZD1839 (1 µM). At the end of the incubation time, cells were lysed, and protein cellular extracts were analyzed by Western blotting using a specific COX-2 antiserum. In B, the selective COX-2 inhibitor SC-236 counteracts Tox+ H. pylori-induced up-regulation of VEGF. MKN 28 cells were incubated for 48 h with uninoculated BCF (control) or Tox+ H. pylori BCF in the presence or absence of SC-236 (10 µM). At the end of the incubation time, cells were lysed, and immunoblot analysis was performed using anti-VEGF antisera. Immunoblot analysis using anti-ß-actin antisera was performed as a control for protein loading. Representative Western blots of three independent experiments are shown. C, control (i.e., MKN 28 cells incubated with uninoculated BCF).
|
|
 |
Discussion
|
|---|
H. pylori infection causes gastritis and gastroduodenal mucosal ulceration and is associated with an increased risk for development of adenocarcinoma of the distal stomach in humans (32
, 33)
. Specific virulence factors produced by the bacterium, such as the vacuolating toxin VacA, contribute to gastroduodenal mucosal injury and impair the healing process of the damaged mucosa (5
, 22)
. In addition, host response to the infection and environmental factors are thought to be involved in the pathogenesis of H. pylori-related gastroduodenal disease (32
, 33)
. In particular, an increase in the proliferative activity of gastric epithelial cells without a corresponding increase in apoptosis has been suggested to be implicated in H. pylori-related gastric carcinogenesis (34
, 35)
.
Polypeptide growth factors play a crucial role in the maintenance of gastric homeostasis (36)
. They are involved in the protection and healing of the gastric mucosa (37, 38, 39)
and modulate the balance between proliferation and apoptosis in normal and damaged gastrointestinal mucosa (36
, 40)
. In particular, VEGF contributes to the restoration of normal mucosal architecture after injury through stimulation of angiogenesis in the granulation tissue at the ulcer bed (9)
. Furthermore, VEGF has been found to be overexpressed in gastric cancer (11, 12, 13)
.
H. pylori infection causes up-regulation of a number of EGF-related growth factors in vitro and in vivo (15
, 17)
. Additionally, we have recently demonstrated that H. pylori up-regulates the expression of COX-2 in gastric mucosal cells in vitro and in human gastric mucosa in vivo (16
, 18)
. Whether H. pylori alters the expression of VEGF is not known. We found that H. pylori bacterial suspension or BCF increased the release of VEGF from MKN 28 cells, causing a 2.5-fold increase in the concentration of VEGF in the conditioned media. In addition, H. pylori up-regulated VEGF mRNA and protein expression in MKN 28 gastric mucosal cells. To assess the role of the vacuolating toxin VacA in H. pylori-induced up-regulation of VEGF, we studied whether an isogenic mutant H. pylori strain specifically lacking vacA (i.e., nontoxigenic) exerted similar effect to that observed with its toxigenic wild-type parental strain. We found that only toxigenic H. pylori strain up-regulated VEGF expression, whereas its Tox- isogenic mutant did not, thus implying that VEGF up-regulation strictly depends on the integrity of a cytotoxic phenotype.
H. pylori infection transactivates EGFR through up-regulation of EGF-related growth factor expression (41)
. Activation of the EGFR then initiates a cascade of intracellular signaling pathways, including activation of ERK/MAP kinase cascade, ultimately leading to the activation of the transcription factor activator-protein 1, which plays a crucial role in cell proliferation and transformation (42)
. Moreover, activation of the MAP kinase cascade is known to be associated with up-regulation of VEGF expression (29
, 43) . We therefore evaluated whether H. pylori was able to activate the ERK/MAP kinase cascade in MKN 28 cells and whether the inhibition of H. pylori-mediated ERK/MAP kinase activation had any effect on H. pylori-induced up-regulation of VEGF. Tox+ H. pylori BCF activated in a time-dependent manner ERK-2 phosphorylation, and this effect was counteracted by specific inhibition of EGFR tyrosine kinase or MAP kinase by ZD1839 or PD098059, respectively. Additionally, activated specific inhibition of EGFR tyrosine kinase by ZD1839 or MAP kinase by PD098059 abrogated H. pylori toxin-mediated increase in VEGF expression, thus suggesting that H. pylori-related up-regulation of VEGF expression is mediated by the activation of EGFR and MAP kinase cascade.
COX-2 plays a major role in regulating the balance between cell proliferation and apoptosis (44)
and activates angiogenesis through up-regulation of VEGF expression (19
, 30
, 31)
. We have recently shown that H. pylori up-regulates COX-2 expression in MKN 28 cells (17)
. In addition, we have shown previously that H. pylori up-regulates the expression of heparin-binding EGF-like growth factor and amphiregulin, members of the EGFR family of ligands (15)
, which in turn up-regulate COX-2 expression in MKN 28 cells (17)
. We therefore sought to investigate first whether EGFR blockade counteracted H. pylori-induced up-regulation of COX-2 expression and, then, whether specific COX-2 inhibition had any effect on H. pylori-dependent up-regulation of VEGF. We found that the EGFR tyrosine kinase inhibitor ZD1839 inhibited H. pylori-induced increase in COX-2 protein levels in MKN 28 cells, thus indicating that H. pylori-induced up-regulation of COX-2 expression depends on the activation of an EGFR-related pathway. Our finding is in agreement with a recent report showing that bile acids up-regulate COX-2 expression in cholangiocarcinoma cells through activation of the EGFR and MAP kinase cascade (45)
. Moreover, SC-236, a selective COX-2 inhibitor (46
, 47)
, almost completely abolished H. pylori-induced up-regulation of VEGF expression, thus suggesting that COX-2 expression is necessary for H. pylori to increase VEGF expression in gastric mucosal cells.
In conclusion, this study shows for the first time that H. pylori increases the expression of VEGF in gastric mucosa cells in vitro. This effect is strictly VacA dependent because it was observed with the parental toxigenic wild-type H. pylori strain but not with its isogenic mutant specifically lacking the cytotoxin VacA. That EGFR tyrosine kinase and MAP kinase inhibition counteracted H. pylori-related increase in VEGF expression indicates that activation of the EGFR and MAP kinase cascade are necessary events for H. pylori to up-regulate VEGF expression. Finally, that H. pylori-induced COX-2 up-regulation was counteracted by inhibition of EGFR activation and that blockade of COX-2 activity abrogated H. pylori-induced VEGF up-regulation suggests that H. pylori-induced up-regulation of VEGF in MKN 28 cells might be mediated by COX-2 through the activation of EGFR-related events.
The identification of H. pylori-specific signaling pathways leading to the induction of cell cycle and/or angiogenesis mediators may be relevant as to the understanding of the mechanism of H. pylori-associated gastric carcinogenesis and might be of interest for therapeutical intervention to overcome H. pylori-associated gastric cancer. We postulate that H. pylori-induced gastric mucosal injury triggers the compensatory overexpression of EGF-related polypeptide growth factors, which, through the activation of the MAP kinase cascade, stimulate cell proliferation, inhibit apoptosis, and stimulate COX-2 expression. This, through the increased production of prostaglandins, leads to further activation of the EGFR (48)
and to increased expression of angiogenetic VEGF. All these events may ultimately favor the progression from chronic gastritis to adenocarcinoma in the multistep model of gastric carcinogenesis (49)
. One may therefore envision the chemopreventive use of a specific EGFR tyrosine kinase inhibitor alone or in combination with a selective COX-2 inhibitor (50)
, in those H. pylori-infected subjects who are resistant to conventional therapeutic regimens and potentially at risk for developing adenocarcinoma of the distal stomach.
 |
FOOTNOTES
|
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 Supported in part by grants from Ministero della Università e Ricerca Scientifica, Consiglio Nazionale delle Ricerche, and Centro Interuniversitario per Ricerche su Alimenti, Nutrizione e Apparato Digerente, Seconda Università di Napoli. 
2 R. C. and C. T. equally contributed to this work. 
3 To whom requests for reprints should be addressed, at Dipartimento di Internistica Clinica e Sperimentale "F. Magrassi," Seconda Università di Napoli, C/O II Policlinico, Edificio 3, Secondo piano, Via Pansini 5, 80131 Napoli, Italy. Phone: 39-0815666713; Fax: 39-0815666713; E-mail: marco.romano{at}unina2.it, or fortunatociardiello{at}yahoo.com 
4 The abbreviations used are: VEGF, vascular endothelial growth factor; COX, cyclooxygenase; BCF, broth culture filtrate; MAP, mitogen-activated protein; RT-PCR, reverse transcription-PCR; EGF, epidermal growth factor; ERK, extracellular signal-regulated kinase; RT, reverse transcriptase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; EGFR, epidermal growth factor receptor. 
Received 10/18/02;
accepted 2/10/03.
 |
REFERENCES
|
|---|
- Blaser M. J. Hypothesis: the changing relationships of Helicobacter pylori and humans: implications for health and disease. J. Infect. Dis., 179: 1523-1530, 1999.[CrossRef][Medline]
- Huang J-Q., Sridhar S., Chen Y., Hunt R. H. Meta-analysis of the relationship between Helicobacter pylori seropositivity and gastric cancer. Gastroenterology, 114: 1179-1196, 1998.[CrossRef]
- Watanabe T., Tada M., Nagai H., Sasaki S., Nakao M. Helicobacter pylori infection induces gastric cancer in mongolian gerbils. Gastroenterology, 115: 642-648, 1998.[CrossRef][Medline]
- Uemura N., Okamoto S., Yamamoto S., Matsumura N., Yamaguchi S., Yamakido M., Taniyama K., Sasaki N., Schlemper R. J. Helicobacter pylori infection and the development of gastric cancer. N. Engl. J. Med., 345: 784-789, 2001.[Abstract/Free Full Text]
- Montecucco C., Rappuoli R. Living dangerously: how Helicobacter pylori survives in the human stomach. Nat. Rev. Mol. Cell. Biol., 2: 457-466, 2001.[CrossRef][Medline]
- Cover T. L., Blaser M. J. Purification and characterization of the vacuolating toxin from Helicobacter pylori. J. Biol. Chem., 267: 10570-10575, 1992.[Abstract/Free Full Text]
- Telford J. L., Covacci A., Ghiara P., Montecucco C., Rappuoli R. Unravelling the pathogenic role of Helicobacter pylori in peptic ulcer: potential new therapies and vaccines. Trends Biotechnol., 12: 420-426, 1994.[CrossRef][Medline]
- Papetti M., Herman I. M. Mechanisms of normal and tumor-derived angiogenesis. Am. J. Physiol., 282: C947-C970, 2002.
- Jones M. K., Tomikawa M., Mohajer B., Tarnawski A. S. Gastrointestinal mucosal regeneration: role of growth factors. Front. Biosci., 4: D303-D309, 1999.[Medline]
- Connolly D. T., Heuvelman D. M., Nelson R., Olander J. V., Eppley B. L., Delfino J. J., Siegel N. R., Leimbgruber R. M., Feder J. Tumor vascular permeability factor stimulates endothelial cell growth and angiogenesis. J. Clin. Investig., 84: 1470-1478, 1989.
- Brown L. F., Berse B., Jackman R. W., Tognazzi K., Manseeau E. J., Senger D. R., Dvorak H. F. Expression of vascular permeability factor (vascular endothelial growth factor) and its receptors in adenocarcinomas of the gastrointestinal tract. Cancer Res., 53: 4727-4735, 1993.[Abstract/Free Full Text]
- Tian X., Song S., Wu J., Meng L., Dong Z., Shou C. Vascular endothelial growth factor: acting as an autocrine growth factor for human gastric adenocarcinoma cell MGC803. Biochem. Biophys. Res. Commun., 286: 505-512, 2001.[CrossRef][Medline]
- Yamamoto S., Yasui W., Kitadai Y., Yokozaki H., Haruma K., Kajiyama G., Tahara E. Expression of vascular endothelial growth factor in human gastric carcinomas. Pathol. Int., 48: 499-506, 1998.[Medline]
- Williams C. S., Mann M., DuBois R. N. The role of cyclooxygenases in inflammation, cancer, and development. Oncogene, 18: 7908-7916, 1999.[CrossRef][Medline]
- Romano M., Ricci V., Di Popolo A., Sommi P., Del Vecchio Blanco C., Bruni C. B., Ventura U., Cover T. L., Blaser M. J., Coffey R. J., Zarrilli R. Helicobacter pylori upregulates expression of epidermal growth factor-related peptides, but inhibits their proliferative effect in MKN 28 gastric mucosal cells. J. Clin. Investig., 101: 1604-1613, 1998.[Medline]
- Romano M., Ricci V., Memoli A., Tuccillo C., Di Popolo A., Sommi P., Acquaviva A. M., Del Vecchio Blanco C., Bruni C. B, Zarrilli R. Helicobacter pylori up-regulates cyclooxygenase-2 mRNA expression and prostaglandin E2 synthesis in MKN 28 gastric mucosal cells in vitro. J. Biol. Chem., 273: 28560-28563, 1998.[Abstract/Free Full Text]
- Tuccillo C., Manzo B. A., DArgenio G., Rocco A., Di Popolo A., Della Valle N., Staibano S., De Rosa G., Ricci V., Del Vecchio Blanco C., Zarrilli R., Romano M. Up-regulation of heparin binding epidermal growth factor-like growth factor and amphiregulin expression in Helicobacter pylori-infected human gastric mucosa. Digest. Liver Dis., 34: 498-505, 2002.
- Zarrilli R., Tuccillo C., Santangelo M., Nardone G., Romano M. Increased COX-2, but not COX-1, mRNA expression in Helicobacter pylori gastritis. Am. J. Gastroenterol., 94: 3376-3378, 1999.[Medline]
- Williams C. S., Tsujii M., Reese J., Dey S. K., DuBois R. N. Host cyclooxygenase-2 modulates carcinoma growth. J. Clin. Investig., 105: 1589-1594, 2000.[Medline]
- Cover T. L., Tummuru M. K. R., Cao P., Thompson S. A., Blaser M. J. Divergence of genetic sequences for the vacuolating cytotoxin among Helicobacter pylori strains. J. Biol. Chem., 269: 10566-10573, 1994.[Abstract/Free Full Text]
- Ricci V., Galmiche A., Doye A., Necchi V., Solcia E., Boquet P. High cell sensitivity to Helicobacter pylori VacA toxin depends on a GPI-anchored protein and is not blocked by inhibition of the clathrin-mediated pathway of endocytosis. Mol. Biol. Cell, 11: 3897-3909, 2000.[Abstract/Free Full Text]
- Ricci V., Ciacci C., Zarrilli R., Sommi P., Tummuru M. K., Del Vecchio Blanco C., Bruni C. B., Cover T. L., Blaser M. J., Romano M. Effect of Helicobacter pylori on gastric epithelial cell migration and proliferation in vitro: role of VacA and CagA. Infect. Immun., 64: 2829-2833, 1996.[Abstract]
- Romano M., Razandi M., Sekhon S., Krause W. J., Ivey K. J. Human cell line for study of damage to gastric epithelial cells in vitro. J. Lab. Clin. Med., 111: 430-440, 1988.[Medline]
- Ciardiello F., Caputo R., Bianco R., Damiano V., Fontanini G., Cuccato S., De Placido S., Bianco A. R., Tortora G. Inhibition of growth factor production and angiogenesis in human cancer cells by ZD1839 (Iressa), a selective epidermal growth factor receptor tyrosine kinase inhibitor. Clin. Cancer Res., 7: 1459-1465, 2001.[Abstract/Free Full Text]
- Tortora G., Damiano V., Bianco C., Baldassarre G., Bianco A. R., Lanfrancone L., Pellicci P. G., Ciardiello F. The R1
subunit of protein kinase A (PKA) binds to Grb2 and allows PKA interaction with the activated EGF-receptor. Oncogene, 14: 923-928, 1997.[CrossRef][Medline]
- Chomczynski P., Sacchi N. Single-step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction. Anal. Biochem., 162: 156-159, 1987.[Medline]
- Nardone G., Romano M., Calabrò A., Pedone P. V., de Sio I., Persico M., Budillon G., Bruni C. B., Riccio A., Zarrilli R. Activation of fetal promoters of insulin-like growth factor-II gene in hepatitis C virus-related chronic hepatitis, cirrhosis and hepatocellular carcinoma. Hepatology, 23: 1304-1312, 1996.[CrossRef][Medline]
- Tischer E., Mitchell R., Hartmann T., Silva M., Gospodarowicz D., Fiddes J. C., Abraham J. A. The human gene for vascular endothelial growth factor. J. Biol. Chem., 266: 11947-11954, 1991.[Abstract/Free Full Text]
- Milanini J., Vinals F., Pouyssegur J., Pages G. p42/p44 MAP kinase module plays a key role in the transcriptional regulation of the vascular endothelial growth factor gene in fibroblasts. J. Biol. Chem., 273: 18165-18172, 1998.[Abstract/Free Full Text]
- Cheng T., Cao W., Wen R., Steinberg R. H., LaVail M. M. Prostaglandin E2 induces vascular endothelial growth factor and basic fibroblast growth factor mRNA expression in cultured rat Muller cells. Investig. Ophtalmol. Vis. Sci., 39: 581-591, 1998.
- Jones M. K., Wang H., Peskar B. M., Levin E., Itani R. M., Sarfeh I. J., Tarnawski A. S. Inhibition of angiogenesis by nonsteroidal anti-inflammatory drugs: insight into mechanisms and implications for cancer growth and ulcer healing. Nat. Med., 5: 1418-1423, 1999.[CrossRef][Medline]
- Zarrilli R., Ricci V., Romano M. Molecular response of gastric epithelial cells to Helicobacter pylori-induced cell damage. Cell. Microbiol., 1: 93-99, 1999.[CrossRef][Medline]
- Ricci V., Zarrilli R., Romano M. Voyage of Helicobacter pylori in human stomach: odyssey of a bacterium. Digest. Liver Dis., 34: 2-8, 2002.[CrossRef]
- Peek R. M., Jr., Moss S. F., Tham K. T., Perez-Perez G. I., Wang S., Miller G. G., Atherton J. C., Holt P. R., Blaser M. J. Helicobacter pylori cagA+ strains and dissociation of gastric epithelial cell proliferation from apoptosis. J. Natl. Cancer Inst. (Bethesda), 89: 863-869, 1997.[Abstract/Free Full Text]
- Peek R. M., Jr., Blaser M. J. Helicobacter pylori and gastrointestinal tract adenocarcinomas. Nature Rev. Cancer, 2: 28-37, 2002.[CrossRef][Medline]
- Barnard J. A., Beauchamp R. D., Russell W. E., DuBois R. N., Coffey R. J. Epidermal growth factor-related peptides and their relevance to gastrointestinal pathophysiology. Gastroenterology, 108: 564-580, 1995.[CrossRef][Medline]
- Romano M., Polk W. H., Awad J. A., Arteaga C. L., Nanney L. B., Wargovich M. J., Krause E. R., Boland C. R., Coffey R. J. Transforming growth factor
protection against drug-induced damage to the rat gastric mucosa in vivo. J. Clin. Investig., 90: 2409-2421, 1992.
- Romano M., Krause E. R., Boland C. R., Coffey R. J. Comparison between transforming growth factor alpha and epidermal growth factor in the protection of rat gastric mucosa against drug-induced injury. Ital. J. Gastroenterol., 26: 223-228, 1994.[Medline]
- Romano M., Lesch C. A., Meise K. S., Veljiaca M., Sanchez B., Krause E. R., Boland C. R., Guglietta A., Coffey R. J. Increased gastroduodenal concentrations of transforming growth factor
in adaptation to aspirin in monkeys and rats. Gastroenterology, 110: 1446-1455, 1996.
- Coffey R. J., McCutchen C. M., Graves-Dealm R., Polk W. H., Jr. Transforming growth factors and related peptides in gastrointestinal neoplasia. J. Cell. Biochem. Suppl., 16G: 111-118, 1992.
- Keates S., Sougioultzis S., Keates A. C., Zhao D., Peek R. M., Jr., Shaw L. M., Kelly C. P. cag+ Helicobacter pylori induce transactivation of the epidermal growth factor receptor in AGS gastric epithelial cells. J. Biol. Chem., 276: 48127-48134, 2001.[Abstract/Free Full Text]
- Wisdom R. AP-1: one switch for many signals. Exp. Cell Res., 253: 180-185, 1999.[CrossRef][Medline]
- Pai R., Szabo I. L., Soreghan B. A., Atay S., Kawanaka H., Tarnawski A. S. PGE2 stimulates VEGF expression in endothelial cells via ERK2/JNK1 signaling pathways. Biochem. Biophys. Res. Commun., 286: 923-928, 2001.[CrossRef][Medline]
- Prescott S. M., Fitzpatrick F. A. Cyclooxygenase-2 and carcinogenesis. Biochim. Biophys. Acta, 1470: M69-M78, 2000.[Medline]
- Yoon J-H., Higuchi H., Werneburg N. W., Kaufmann S. H., Gores G. J. Bile acids induce cyclooxygenase-2 expression via the epidermal growth factor receptor in a human cholangiocarcinoma cell line. Gastroenterology, 122: 985-993, 2002.[CrossRef][Medline]
- Baatar D., Jones M. K., Pai R., Kawanaka H., Szabo I. L., Moon W. S., Kitano S., Tarnawski A. S. Selective cyclooxygenase-2 blocker delays healing of esophageal ulcers in rats and inhibits ulceration-triggered c-Met/hepatocyte growth factor receptor induction and extracellular signal-regulated kinase 2 activation. Am. J. Pathol., 160: 963-972, 2002.[Abstract/Free Full Text]
- Masferrer J. L., Koki A., Seibert K. COX-2 inhibitors. A new class of antiangiogenic agents. Ann. N. Y. Acad. Sci., 889: 84-86, 1999.[CrossRef][Medline]
- Pai R., Soreghan B., Szabo I. L., Pavelka M., Baatar D., Tarnawski A. S. Prostaglandin E2 transactivates EGF receptor: a novel mechanism for promoting colon cancer growth and gastrointestinal hypertrophy. Nat. Med., 8: 289-293, 2002.[CrossRef][Medline]
- Correa P., Miller M. J. S. Carcinogenesis, apoptosis and cell proliferation. Br. Med. Bull., 54: 151-162, 1998.[Abstract/Free Full Text]
- Gupta R. A., DuBois R. N. Combinations for cancer prevention. Nat. Med., 6: 974-975, 2000.[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
T. TAHARA, T. ARISAWA, T. SHIBATA, M. NAKAMURA, H. YAMASHITA, D. YOSHIOKA, M. OKUBO, N. MARUYAMA, T. KAMANO, Y. KAMIYA, et al.
Effect of Polymorphisms in the 3'-Untranslated Region (3'-UTR) of VEGF Gene on Gastric Pre-malignant Condition
Anticancer Res,
February 1, 2009;
29(2):
485 - 489.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Basu, S. K. Pathak, G. Chatterjee, S. Pathak, J. Basu, and M. Kundu
Helicobacter pylori Protein HP0175 Transactivates Epidermal Growth Factor Receptor through TLR4 in Gastric Epithelial Cells
J. Biol. Chem.,
November 21, 2008;
283(47):
32369 - 32376.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M.-R. Ki, H.-R. Lee, M.-J. Goo, I.-H. Hong, S.-H. Do, D.-H. Jeong, H.-J. Yang, D.-W. Yuan, J.-K. Park, and K.-S. Jeong
Differential regulation of ERK1/2 and p38 MAP kinases in VacA-induced apoptosis of gastric epithelial cells
Am J Physiol Gastrointest Liver Physiol,
March 1, 2008;
294(3):
G635 - G647.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Hisatsune, E. Yamasaki, M. Nakayama, D. Shirasaka, H. Kurazono, Y. Katagata, H. Inoue, J. Han, J. Sap, K. Yahiro, et al.
Helicobacter pylori VacA Enhances Prostaglandin E2 Production through Induction of Cyclooxygenase 2 Expression via a p38 Mitogen-Activated Protein Kinase/Activating Transcription Factor 2 Cascade in AZ-521 Cells
Infect. Immun.,
September 1, 2007;
75(9):
4472 - 4481.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M Yeo, D-K Kim, S U Han, J E Lee, Y B Kim, Y K Cho, J H Kim, S W Cho, and K-B Hahm
Novel action of gastric proton pump inhibitor on suppression of Helicobacter pylori induced angiogenesis
Gut,
January 1, 2006;
55(1):
26 - 33.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Y. Shin, W. K.K. Wu, Y.-N. Ye, W. H.L. So, M. W.L. Koo, E. S.L. Liu, J.-C. Luo, and C.-H. Cho
Nicotine promotes gastric tumor growth and neovascularization by activating extracellular signal-regulated kinase and cyclooxygenase-2
Carcinogenesis,
December 1, 2004;
25(12):
2487 - 2495.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. J. Chang, M. S. Wu, J. T. Lin, B. S. Sheu, T. Muta, H. Inoue, and C.-C. Chen
Induction of Cyclooxygenase-2 Overexpression in Human Gastric Epithelial Cells by Helicobacter pylori Involves TLR2/TLR9 and c-Src-Dependent Nuclear Factor-{kappa}B Activation
Mol. Pharmacol.,
December 1, 2004;
66(6):
1465 - 1477.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. R. Preusch, A. J. Grau, F. Buggle, C. Lichy, J. Bartel, C. Black, and J. Rudi
Association Between Cerebral Ischemia and Cytotoxin-Associated Gene-A-Bearing Strains of Helicobacter pylori
Stroke,
August 1, 2004;
35(8):
1800 - 1804.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. C. Yao, L. Wang, D. Wei, W. Gong, M. Hassan, T.-T. Wu, P. Mansfield, J. Ajani, and K. Xie
Association between Expression of Transcription Factor Sp1 and Increased Vascular Endothelial Growth Factor Expression, Advanced Stage, and Poor Survival in Patients with Resected Gastric Cancer
Clin. Cancer Res.,
June 15, 2004;
10(12):
4109 - 4117.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Nakayama, M. Kimura, A. Wada, K. Yahiro, K.-i. Ogushi, T. Niidome, A. Fujikawa, D. Shirasaka, N. Aoyama, H. Kurazono, et al.
Helicobacter pylori VacA Activates the p38/Activating Transcription Factor 2-mediated Signal Pathway in AZ-521 Cells
J. Biol. Chem.,
February 20, 2004;
279(8):
7024 - 7028.
[Abstract]
[Full Text]
[PDF]
|
 |
|