Clinical Cancer Research Meeting Calendar Frontiers in Basic Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moschella, F.
Right arrow Articles by Harris, P. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moschella, F.
Right arrow Articles by Harris, P. E.
Clinical Cancer Research Vol. 9, 2022-2031, June 2003
© 2003 American Association for Cancer Research

Experimental Therapeutics, Preclinical Pharmacology

Gene Expression Profiling and Functional Activity of Human Dendritic Cells Induced with IFN-{alpha}-2b: Implications for Cancer Immunotherapy1

Federica Moschella, Brygida Bisikirska, Antonella Maffei, Kyriakos P. Papadopoulos, Donna Skerrett, Zhuoru Liu, Charles S. Hesdorffer and Paul E. Harris2

The International Institute of Genetics and Biophysics, Naples, Italy [A. M.], the Department of Pathology [D. S.], the Department of Surgery [Z. L.], the Division of Medical Oncology, Department of Medicine [F. M., B. B., K. P. P., C. S. H., P. E. H.], College of Physicians and Surgeons, Columbia University, New York, New York 10033


   ABSTRACT
Top
 ABSTRACT
Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Purpose: In this study, we have compared patterns of gene expression and functional activity of human dendritic cells (DCs) cultured under defined conditions in IFN-{alpha}-2b and recombinant human granulocyte macrophage colony-stimulating factor (DCA) with cells grown in granulocyte macrophage colony-stimulating factor and IL-4 (DC4) as an initial step in evaluating the clinical utility of DCA in cancer immunotherapy.

Experimental Design and Results: Comparison of mRNA transcript profiles between DCA and DC4 revealed different expression patterns for cytokines, chemokines, chemokine receptors, costimulatory molecules, and adhesion proteins. Many genes involved in antigen (Ag) processing were equally expressed in both populations; however, expression of transcripts involved in Ag presentation was increased in DCA. DCA also showed up-regulation of Toll-like receptor 2 and 3, as well as several tumor necrosis factor family ligands. Consistent with expression profiling, functional assays demonstrated that DCAs were more potent stimulators of naive T-cell responses than DC4 in an interleukin 15 and interleukin 1ß-dependent manner. DCA-mediated tumor cell-directed cytotoxicity induced apoptosis in different human tumor cell lines and internalized apoptotic bodies to a greater extent than DC4. Lastly, in vitro priming experiments, using apoptotic cells or peptide as sources of Ag, showed that DCA drove the expansion of tumor peptide Ag-specific autologous CD8+ T cells to a greater extent than DC4.

Conclusions: The unique phenotype conferred by culturing DCs in IFN-{alpha}-2b may be useful in adoptive transfer regimens where the destruction of tumor cells in situ, initiation of T-cell responses toward tumor tissue with unknown Ags, and/or enhancement of pre-existing Ag-specific memory responses are desired outcomes.


   Introduction
Top
 ABSTRACT
 Introduction
Materials and Methods
 Results
 Discussion
 REFERENCES
 
IFN-{alpha} is an immunoregulatory cytokine presently used clinically in a recombinant form for the treatment of tumors and chronic viral infections (1, 2, 3) . Although the exact mechanism(s) by which IFN-{alpha} promotes antitumor and antiviral responses is still under investigation, it is known that IFN-{alpha} can act via selective toxicity toward transformed or virally infected cells, and that it modulates immune response (4) . However, systemic administration of type I IFNs is associated with severe toxicity and significant side effects, thereby limiting its clinical applications (5 , 6) .

DCs3 are central regulatory elements of both adaptive and innate immune responses by virtue of their ability to activate naïve T cells and recognize pathogen-associated molecule patterns (7 , 8) . Our current understanding of DC biology in the context of adaptive immunity suggests that the differentiation state of the DC qualitatively affects their interaction with T lymphocytes. It is well documented that, depending on the degree of maturation and direction of maturation, DCs will elaborate different profiles of cytokines and cell surface receptors, and express different Ag processing and presenting abilities (9, 10, 11) . Recent studies show that IFN-{alpha} strongly modulates DC function and maturation (12, 13, 14, 15, 16, 17) . For example, treatment of peripheral blood monocytes with GM-CSF plus IFN-{alpha} induces rapid maturation of these cells into potent APCs for viral epitopes (14) . Other studies have found that type I IFNs induce apoptotic cell death in cultures of mature DCs (15 , 16) .

We have developed GMP compatible culture methods for the production of DCs used in cancer immunotherapy (18) . To broaden our understanding of DC phenotypes obtainable under these culture conditions, we have systematically compared gene expression in DCA and DC4 using oligonucleotide microarrays. As a partial confirmation of gene profiling results we performed several semiquantitative assays of T-cell growth and effector function. Our data show that type 1 IFN-treated DCs relative to cells cultured in GM-CSF and IL-4 have higher expression of genes associated with immature DCs, e.g., genes involved in inflammatory site homing or chemoattraction of inflammatory cells, yet at the same time, display increased levels of transcripts for costimulatory, adhesion and Ag presenting molecules. Functional experiments demonstrated that IFN-{alpha}-treated DCs have an increased capacity, relative to DCs produced in GM-CSF and IL-4, to: (a) stimulate naive T-lymphocyte allogeneic proliferative responses; (b) induce apoptotic cell death in tumor cell lines; (c) internalize ATCs; and (d) drive Ag-specific CD8 T-cell responses.


   Materials and Methods
Top
 ABSTRACT
 Introduction
 Materials and Methods
Results
 Discussion
 REFERENCES
 
Cells and Cell Culture.
The tumor cell lines U87 and SK-BR-3 were cultured under standard conditions (humidified 37°C, 5% CO2 atmosphere) using DMEM/F12 medium (Invitrogen Life Technologies, Inc., Carlsbad, CA), supplemented with 10% heat-inactivated FCS (Atlanta Biologicals, Norcross, GA) and Gentamicin (Life Technologies, Inc.). A closed GMP compliant system for culturing populations of monocyte-enriched PBMCs, using flexible gas permeable cell culture bags and sterile connecting devices, was used as described previously (18) . Aphaeresis products were obtained with Institutional Review Board approval and informed consent. All of the materials and reagents used for the aphaeresis and DC culture were sterile and endotoxin free (<0.05 endotoxin unit/ml by LAL assay). All of the DC culture materials and reagents were FDA approved for human use with the exception of the plastic beads and IL-4. The PBMC product obtained from the aphaeresis system (Spectra; COBE BCT, Lakewood, CO) was enriched for CD11C- and CD14-positive cells (ranging from 15% to 55% CD14 positive), and platelet-depleted relative to peripheral blood. Cells were allowed to adhere to the beads and inner surface of the beads, and nonadherent cells were removed by washing with serum-free AIM V medium (Therapeutic Grade; Invitrogen Life Technologies 0870112DK) containing L-glutamine, 50 µg/ml streptomycin sulfate, and 10 µg/ml gentamicin sulfate. In some experiments, residual platelets were reduced to 5–10% of the level in the MNC product by centrifugation over Ficoll-Hypaque (Lymphoprep; Nycomed Pharma, Oslo, Norway). Adherent cells were cultured in therapeutic grade AIM-V medium containing recombinant human GM-CSF (50 ng/ml; Sargramostim; Immunex, Seattle, WA) and IL-4 (1000 units/ml; R&D Systems, Minneapolis, MN) or GM-CSF and IFN-{alpha}2b (10,000 units/ml; Intron A; Schering Co., Kenilworth, NJ). Neither FCS nor autologous human serum was added to the culture medium. The bags were placed in a dedicated, HEPA-filtered, humidified 37°C, 5% CO2 incubator. On the third day of culture, 50 ml of fresh AIM-V medium with GM-CSF and IL-4 or IFN-{alpha}2b was added to each bag (cultures and cells designated DC4 or DCA, respectively). On day 6, nonadherent cells were harvested and washed for additional testing. The yield of nonadherent cells from cultures using GM-CSF and IL-4 was routinely 1% of the total number of cells introduced into the bag. Cultures containing GM-CSF and IFN-{alpha}2b yielded approximately one-fifth the number of cells found in the GM-CSF and IL-4 cultures. After culture, DCs were cryopreserved in autologous serum and 10% sterile DMSO, and stored in liquid nitrogen until use. In some experiments, the CD34-negative fraction of aphaeresis products were obtained from HLA-A*0201 positive breast cancer patients. DC cultures were initiated as described above, and CD8+ lymphocytes were isolated from the nonadherent fraction using a CD8+ isolation and detachment kit (Dynal Biotech, Lake Success, NY) according to the manufacturer’s instructions. CD8+ lymphocytes were cryopreserved and stored in liquid N2 until use.

Immunophenotyping of DCs.
Immunophenotyping of the cultured cells was performed using a FACScan flow cytometer and the CellQuest software. The mAb panel used included fluorochrome-conjugated Abs to CD1A, CD2, CD3, CD11B, CD11C, CD14, CD19, CD20, CD45, CD45RA, CD45RO, CD56, CD80, CD83, CD86, and HLA-DR (Becton-Dickinson, San Jose, CA). The amount of MHC CLIP bound to MHC class II, was measured using the CerCLIP mAb (Becton-Dickinson). Staining, washing, and analysis were performed as per the manufacturer’s recommendations (Becton Dickinson).

RNA Preparation and Array Hybridization.
HG-U95A GeneChips (Affymetrix, Santa Clara, CA), which query 10,000 genes (12,000 probe sets), were used for all of the analyses. The cRNA probes were synthesized as recommended by Affymetrix. Briefly, total RNA from nonadherent DCs (1.5 x 107 cells) was prepared in two steps using TRIzol (Invitrogen) followed by RNeasy (Qiagen, Valencia, CA) purification. Double-stranded cDNA was generated from 5 µg of total RNA using the Superscript Choice System kit (Invitrogen). Biotinylated cRNA was generated by in vitro transcription using the Bio Array High Yield RNA Transcript Labeling System (Enzo, Farmingdale, NY). The cRNA was purified using RNeasy. cRNA was fragmented according to the Affymetrix protocol, and 15 µg of biotinylated cRNA were hybridized to U95A microarrays (Affymetrix). After scanning, the expression values for each gene were determined using Affymetrix GeneChip software version 4.0 using algorithms that determine whether a gene is absent or present and whether the expression level of a gene in experimental samples are significantly increased or decreased relative to control samples. The fold change score for each transcript was calculated using the average difference values, a measurement describing the hybridization performance of each probe set member to the cRNAs prepared from either DCA or DC4. Our selection of differentially expressed genes was based on the absolute call (Present), average difference call (Increased or Decreased), and fold change score >2.

Semiquantitative RT-PCR.
Total RNA (5 µg) from each sample was used as template for the reverse transcription reaction. cDNA was synthesized using oligodeoxythymidylic acid 18 primer (Invitrogen) and SuperScript II reverse transcriptase (Invitrogen). Oligonucleotides primers for the semiquantitative PCR of human IL-15, IL-2, and IL-1ß were obtained from Ambion (Relative RT-PCR kit; Ambion, Austin, TX). Primers for the semiquantitative PCR of human GAPDH were synthesized by Invitrogen and have the following sequences: (GAPDH-F) CGCTCTCTGCTCCTCCTGTTCG and (GAPDH-R) CCGTTCTCAGCCTTGACGGTGC. PCRs were performed using Platinum TaqDNA Polymerase (Invitrogen) in the presence of 0.5 µM forward and reverse primers as recommended by the manufacturer. The samples were amplified for 10, 20, and 30 cycles at the following conditions: 30 s at 94°C, 30 s at the indicated annealing temperature, and 45 s at 72°C. The annealing temperatures were: 65°C (GAPDH), 61°C (IL-15), 57°C (IL-2), and 59°C (IL-1ß). The best conditions to preserve linear amplification were established as described previously (11) . Electrophoresis of the PCR products was performed on a 2% agarose gel containing 1 µg/ml of ethidium bromide. The images from the ethidium bromide-stained gel were captured with the Kodak DC120 Zoom digital camera, and the light intensity of the bands was quantified using the Kodak Digital Science 1D image analysis software (Eastman Kodak, Rochester, NY). Lymphokine band intensities were normalized to the signal of GAPDH in each sample and plotted for comparison of the relative amounts of transcripts in DCA versus DC4.

Stimulation of Allogeneic T Cells.
Allogeneic PBMCs were prepared from heparinized peripheral blood obtained from normal donors with informed consent and Institutional Review Board approval. PBMCs were cultured with various numbers of irradiated (50 Gy) stimulator cells (either DCA or DC4) at different PBMC:DC ratios using RPMI 1640 supplemented with 10% heat-inactivated FCS (Invitrogen) and antibiotics. In the indicated experiments, a naive T-cell fraction of PBMCs was prepared by positive selection using anti-CD3, followed by CD45RA-coated magnetic microbeads (Miltenyi Biotec Inc., Auburn, CA) according to the manufacturer’s recommendations and used in the mixed lymphocyte cultures. In the indicated MLC experiments, neutralizing mAbs to IL-15, IL-1ß, or an isotype-matched control mAb (1.5 and 10.0 µg/ml; R & D Systems) were added at the initiation of the cultures. Cultures were maintained in a humidified atmosphere at 37°C and 5% CO2. Lymphocyte proliferation was determined by [3H]thymidine incorporation (1 µCi/well) during the final 18 h of the fifth day of culture. Experimental samples were plated in triplicate, harvested, and the radioactivity was measured using a beta scintillation counter (Perkin-Elmer Biosciences, Shelton, CT).

In Vitro Stimulation of Ag-specific CD8 T Cells.
Cryopreserved CD8+ lymphocytes from breast cancer patients were thawed, washed, counted for viability, and resuspended in complete medium. Autologous irradiated DCA or DC4 were loaded for 4 h at 37°C with the synthetic peptide KIFGSFLAF (10 µg/ml; American Peptide Co., Burlingame, CA) corresponding to residues 369–378 of the human HER-2 protein, then washed and seeded into 96-well plates (Corning) at 5 x 105 cells per well in complete AIM V medium supplemented with 10% human AB serum (Sigma, St. Louis, MO). In parallel experiments, DCs were incubated for 2 days with apoptotic HER-2 + SK-BR-3 cells (1:1) before being used as APCs. CD-8+ T cells were added at a 10:1 ratio (T:DC). Cultures were incubated at 37°C in a 5% CO2, humidified atmosphere. After 24 h, IL-2 and IL-7 (2.5 ng/ml and 10 ng/ml, respectively, both obtained from R & D Systems) were added to the culture wells. Cultures were fed on days 3, 5, and 7 with additional medium containing IL-2. After the expansion period, T-cell cultures were rested for an additional 4 days by feeding with medium alone.

ELISPOT Assay.
Nitrocellulose bottom, 96-well plates (Multiscreen HA cellulose; Millipore) were coated overnight at 4°C with antihuman IFN-{gamma} mAb (2 µg/ml, 1-D1K; MABTECH, Stockholm, Sweden), washed with PBS, and blocked with 10% human AB serum. Cultured lymphocytes were seeded at 1 x 103, 5 x 103, and 2 x 104 cells/well. In autologous system experiments, 5 x 104 T2 (HLA-A2 positive) target cells were incubated overnight with 10 µg/ml HER-2 peptide, or T2 cells without peptide were added to wells containing effector lymphocyte populations. In experiments using alloantigens for T-cell activation, irradiated DC4 cells were used as secondary stimulator target cells. T cell-APC cultures were incubated for 20 h in RPMI 1640 with 10% human AB serum at 37°C, followed by washing the plates thoroughly with PBS to remove cells. To detect T lymphocyte-secreted IFN-{gamma}, a detection mAb (0.2 mg/ml, 7-B6-1-biotin; MABTECH) was added to each well. After washing and incubation with streptavidin-alkaline phosphatase (1 µg/ml; MABTECH), a buffered substrate (5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium; Sigma) solution was added to each well and the plate developed at room temperature. After washing, the dark-violet spots were counted under a dissection microscope.

DC-mediated Killing of Human Tumor Cells.
To determine DC-induced tumor cell death, 5 x 104 U87 tumor cells were incubated with various numbers of DCA or DC4 effector cells for 12 h (E:T ratio 4:1; 20:1). Apoptotic cell death was measured by flow cytometry using FITC-conjugated annexin V and propidium iodide as per the manufacturer’s protocol (Apoptosis Detection kit; R & D Systems). CellQuest software (Becton-Dickinson) was used for the analysis and gating of living, necrotic, and apoptotic populations.

Tumor Cell Uptake by DCs.
Single cell suspensions were prepared from tumor cell cultures (either U87 or SK-BR-3) using EDTA in Ca+2-free PBS. In some experiments the cells were resuspended in phenol red-free RPMI 1640 (Life Technologies, Inc., Grand Island, NY) at a concentration of 5 x 105 cells/ml, and apoptosis was induced by irradiating tumor cells with 10 J/m2 (UVB 254 nm; UV Stratalinker 1800; Stratagene, La Jolla, CA). For the study of tumor cell internalization by DCs, tumor cells (both UVB-irradiated and controls) were stained green with 2 µg/ml DiOC16 (Molecular Probes, Eugene, OR) for 30 min at 37°C in PBS and washed three times in complete medium. A 20-h incubation was performed to allow for the tumor cells to undergo apoptosis. Tumor cells were then cocultured with DCs at two different E:T ratios (1:1 and 1:5). The cells were harvested 6 h later, and DCs were stained with phycoerythrin-labeled anti-CD11C mAb. Two-color flow cytometry was performed to determine the percentage of cells that phagocytosed ATCs, based on the number of double-positive cells. The same experiment was performed at 4°C to assess passive association of tumor and DCs, and passive transfer of DiOC16.


   Results
Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
Discussion
 REFERENCES
 
Immunophenotype of Cultured Cells.
The nonadherent cell populations were harvested after 6 days of culture with GM-CSF and IL-4 or GM-CSF and IFN-{alpha}-2b, and immunophenotyped using a panel of fluorochrome-conjugated mAbs (Fig. 1)Citation . Flow cytometric measurements showed nearly unimodal distributions of many of the cell surface markers studied. Both DCA and DC4 populations lacked the expression of CD14, displayed high expression of CD11B, and were positive for CD11C, HLA-DR Ags, and CD83. This is consistent with the immunophenotype of DCs produced by the methods we have described previously (11 , 18) . Notably, the DCs produced under these conditions have higher expression of CD83 and HLA-DR molecules than those produced using peripheral blood monocytes and GM-CSF plus IL-4 alone, and are similar to the more mature DCs reported by others (19 , 20) . In addition, the surface expression of CD11C and CD80 was up-regulated in IFN-{alpha}-treated cells relative to DC4 cells. Expression of the HLA CLIP, bound within the Ag-binding cleft of HLA-DR, was measured by flow cytometry. DCA showed no detectable HLA-DR-bound CLIP, whereas CLIP was detectable on DC4 similar to levels detected on other APCs (21) . Both cell populations studied contained no CD3-, CD19-, CD20-, or CD56-positive cells (data not shown).



View larger version (31K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 1. Immunophenotype of DCA and DC4. Human myeloid adherent cells were cultured in serum-free medium containing GM-CSF and IFN-{alpha}-2b or GM-CSF and IL-4 for 6 days, and then phenotyped by immunofluorescent flow cytometry. The data are displayed as histograms with cell numbers plotted against fluorescence intensity. The ···· represent the isotype-matched negative control Ab. The ——— represent staining with specific Abs. The expression of MHC CLIP on DCA and DC4 populations was determined by indirect immunofluorescence staining using CerCLIP mAb followed by a FITC-conjugated goat antimouse Ab (———). DCs stained with FITC goat antimouse alone are shown by ----. Results are representative of more than eight independent experiments using aphaeresis material from healthy individuals (n = 2) as well as patients treated for breast cancer (n = 2), multiple myeloma (n = 3), and other malignancies (n = 3).

 
Identification of Differentially Expressed Genes.
The Affymetrix oligonucleotide arrays used in these experiments detects 12625 gene products, among which 46.5% were expressed in the DC4 and 50% in DCA. RNA transcript levels for different genes were assessed by using Affymetrix software. The relative abundance of a particular mRNA was expressed as the "average difference." This was calculated from the difference in fluorescence intensity given by a labeled RNA sample when hybridized to oligonucleotide probe set members built to match a particular gene sequence versus the intensity when hybridized to oligonucleotide probes mismatched by one base. To get an overall impression of the differences in gene expression between the different types of DCs, we plotted the log base 2 values for average differences obtained for each gene in DCA versus DC4 (Fig. 2)Citation . Many of the specific transcripts measured in DCs were distributed along the diagonal line of "identity" indicating that cell culture, RNA isolation, reverse transcription for probe preparations, and hybridization conditions were reproducible. Differences in intensity scores >2-fold are likely to reflect real differences in gene expression. This comparison analysis showed that 793 genes (6%) were increased (>2-fold) in the IFN-{alpha} treated cells and 893 (7%) were decreased (less than one-half) relative to DC4. The overall correlation coefficient was 0.78. A partial list of the differentially expressed genes characterized by transcript profiling is presented in Table 1Citation . The level of mRNA specific for inflammatory chemokine receptors, typically expressed by immature DCs (CCR1 and CCR2), was increased in DCA versus DC4; the expression of CXCR1 (IL-8R{alpha}) and CCR3 (CCRL2) was unchanged (data not shown). Transcript levels for receptors for lymphoid chemokines like CCR4, CCR7, and CXCR4, of which the expressions are known to be up-regulated on DC maturation, were either not detected, not changed, or decreased. Additionally, inflammatory chemokines such as RANTES, I-309, MIP-1 {alpha} and ß, MIP-2 {alpha} and ß, Nap-2, and MCP-1 were shown to be increased in IFN-{alpha}-treated cells, whereas MCP-4 and MPIF-1 were down-regulated. Lymphoid chemokine genes were either equally expressed in both culture conditions (TARC, MDC, MIF, IL-8, and PARC, data not shown) or not detected (ELC and MIG; data not shown). Increased quantities of transcripts for IL-1, IL-6, and IL-15 were detected in DCA, whereas IL-12, IL-10, and IL-13 transcripts were not detected in either DC subset (data not shown). The presence of increased message for IL-1ß and IL-15 in DCA relative to DC4 was confirmed by semiquantitative RT-PCR (Fig. 3)Citation . Higher levels of expression of the genes encoding the receptors for these ILs (IL-15, IL-1, and IL-6), as well as for IL-7 R and IL-8 R, were found in DCA relative to DC4. Genes involved in Ag uptake (CD32{alpha} and CD64; data not shown) were equally expressed in both DCs, with the exception of mRNAs encoding CD32 ß, DEC-205, and Fc-{xi} receptor, which were down-regulated.



View larger version (32K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 2. Pair-wise comparison of gene expression in DCA and DC4. Comparison of expression data were performed by XY-scatterplot analysis of log base 2-transformed cRNA hybridization intensity data. Expression profiles were obtained from myeloid-adherent cells cultured in GM-CSF and IL-4 or with GM-CSF and IFN-{alpha}. Each point represents the normalized expression of an individual gene within both mRNA populations. The ——— represents the predicted line of identity. The ---- indicate the thresholds of >2-fold or less than one-half expression ratios. Results are from a representative profiling experiment in a series of two.

 

View this table:
[in this window]
[in a new window]

  		Table 1 Gene expression changes in DCs cultured with GM-CSF + IFN-{alpha}-2b versus GM-CSF + IL-4

 


View larger version (55K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 3. Relative levels of transcripts for IL-15, IL-1ß, and IL-2 in DCA and DC4. Total mRNA from the same DCA and DC4 samples used in transcript profiling experiments were reverse transcribed and analyzed for content of specific transcripts for IL-15, IL-1ß, IL-2, and GAPDH using a semiquantitative PCR assay. The amount of amplified products were measured and normalized to the signal of GAPDH. Data are representative from two repeat determinations.

 
Comparison of the levels of transcripts for HLA-DM in DCA with DC4 showed a modest increase, whereas the levels of the HLA-DM inhibitor, HLA-DO, remained unchanged. We wondered whether the change in the balance of HLA-DM and HLA-DO might result in more release of the CLIP from HLA class II molecules on DCA. Immunofluorescent flow cytometry analysis demonstrated that there was indeed a decrease in the amount of HLA-DR-bound CLIP on the cell surface of DCA (Fig. 1)Citation .

Increased levels of transcripts for the proteasome activator hPA28, TAP-2, HLA-E, the lysosomal trafficking regulator, LYST, and CD-1E were also found in DCA, whereas no changes in expression were discovered for HLA-DR, HLA-DP, CD1A, CD1B, CD1C, CD1D, LAMP1 and 2, HLA-A, HLA-C, and HLA-G (data not shown). IFN-{alpha} treated DCs also displayed increased amount of transcripts for costimulatory and adhesion molecules (CD80, integrin {alpha} 7, and ICAM-3) and decreased expression of integrin {alpha} E, integrin {alpha} 6B, and integrin ß 5. Furthermore, the expression of six members of the TNF family, all involved in the induction of apoptosis, TNF-{alpha}, TRAIL, CD30 ligand, homologous to limphotoxins, exhibits inductible expression and completes with HSV glycoprotein D for HVEM on T-cells, TWEAK, and Fas were found increased in DCA. Transcripts for members of the toll-like receptor family pathway (TLR 2 and 3, and MyD88), involved in microbial lipopeptide and double-stranded RNA recognition, were increased in DCA. No T- or B-cell lineage-specific transcripts were detected in these arrays (e.g., CD3, CD7, or CD19).

Effect of DCA and DC4 on T-Lymphocyte Activation, Proliferation, and Maturation.
Both immunofluorescence and transcript profiling analysis of DCA and DC4 showed significant alterations in the levels of transcripts for costimulatory molecules (e.g., CD80), as well as quantitative differences in several cytokines driving CD4 and CD8 T-cell differentiation (e.g., IL-1ß, IL-6, and IL-15). To begin to understand the functional consequences of these differences, we performed several semiquantitative measurements of T-cell development and acquisition of effector function after interaction with either population of DCs. First we compared the ability of irradiated DCA and DC4 to stimulate allogeneic T-cell responses in a one-way mixed lymphocyte reaction. DCAs were significantly more active than DC4s in inducing the proliferation of allogeneic PBMCs at intermediate responder:stimulator ratios (Fig. 4)Citation .



View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 4. Comparison of stimulation of allogeneic PBMC by DCA and DC4. Irradiated DCA or DC4 cells were cultured with fixed numbers of allogeneic PBMCs at the indicated ratio. After 5 days of culture, proliferation was determined by [3H]thymidine incorporation assay. The results from two experiments are shown using PBMCs from two different individuals and DCs cultured from two different individuals; bars, ±SE of triplicate determinations. Significance of the difference between mean values of proliferation for DCA and DC4 was calculated by the method of Student. The P for the difference in means at the peak of proliferation is shown.

 
Gene profiling and RT-PCR experiments both demonstrated that DCA expressed higher levels of transcripts for IL-1 ß and IL-15 than DC4. To determine the relative roles of IL-15 and IL-1ß in the enhanced proliferative responses mediated by DCA, we repeated the mixed lymphocyte reaction cultures substituting a naive T-cell population (CD3+ and CD45RA+) for total PBMC as allogeneic responders and irradiated DCA or DC4 as stimulator cells. In these cultures neutralizing Abs to IL-1ß or IL-15 were added at the initiation of culture. Neutralization of IL1ß or IL-15 (at 10 µg/ml) significantly depressed the T-cell proliferative response in cultures with DCA (Fig. 5Citation , top panel). Isotype matched control Abs had no effect on allogeneic T-cell proliferation. This effect was not observed in cultures of T cells stimulated by DC4 (Fig. 5Citation , bottom panel) or when unseparated CD3+ lymphocytes (i.e., mixtures of CD45RO and CD45RA) were used (data not shown). After secondary allogeneic challenge, cultured T cells that had been primed with DCA showed a greater frequency of IFN-{gamma}-producing cells than cultures primed by DC4 (data not shown).



View larger version (19K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 5. Effect of neutralizing Abs to IL-1ß and IL-15 on naive allogeneic T-cell stimulation by DCA and DC4. Varying numbers of irradiated DCA or DC4 were added to cultures of allogeneic CD3+, CD45RA+ lymphocytes. At the initiation of culture, neutralizing mAbs to IL-1ß (10 µg/ml), IL-15 (10 µg/ml), or control isotype-matched mAbs were added. Proliferation was determined on the fifth day of culture by [3H]thymidine incorporation assay. Results are presented as a stimulation index where the proliferative response to allostimulation is shown relative to the thymidine incorporation of T cells alone. Cryopreserved DCs were used in these experiments. Data obtained from three independent experiments using DCs from three individuals. Top panel, DCA. Bottom panel, DC4. Significance of the difference between mean values of proliferation in the presence or absence of neutralizing Abs was calculated by the method of Student. The P for the difference in means at the peak of proliferation is shown; bars, ±SD.

 
IFN-{alpha}-treated DCs Induce Apoptotic Cell Death of Tumor Cells.
As shown in Table 1Citation IFN-{alpha}-treated DCs express a higher amount of transcripts for TNF-{alpha}, TRAIL, CD30L, herpes virus entry mediator, and TWEAK than DC4. Because this group of proteins have been described previously to be involved in the induction of apoptosis, we compared the cytotoxic activity of DCA and DC4 toward a TRAIL-sensitive (death receptor 5-positive) human glioma tumor cell line (22) using an apoptotic cell death assay. The presence of phosphatidylserine on the outer leaflet of target cell membranes was measured with annexin V-FITC, and necrotic cells were enumerated by propidium iodide uptake (23) . Flow cytometric measurements revealed that a significantly higher percentage of U87 glioma cells became apoptotic when incubated with DCA compared with DC4 (20:1 E:T ratio; mean value from two experiments of 19% versus 33%; P = 0.03 by paired Student’s t test; Fig. 6Citation ). In control experiments, apoptotic cell death of DC4, DCA, or of the tumor cell line alone was determined. As shown in Fig. 6Citation , there was little apoptotic death in DC4 or DCA cell populations.



View larger version (46K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 6. Induction of apoptosis by DCA and DC4. U87 glioma cells (5 x 104) were incubated with DC effector cells for 12 h (E:T ratio 4:1 and 20:1). Cells were stained with FITC-conjugated annexin V and propidium iodide, and analyzed by flow cytometry. Tumor cells and DCs were discriminated on the basis of forward and side scatter. DCA and DC4 samples (without glioma cells) are included as controls to measure their contribution to the apoptotic population captured in the analysis gate The percentage of apoptotic cells (FITC-annexin V-positive and propidium iodide-negative) within the analysis gate is indicated in the bottom right quadrant. Dot plot data shown is from one of the three separate experiments.

 
Increased Uptake of ATCs by DCA.
The ability of DCA and DC4 to uptake tumor cells was evaluated using a flow cytometry-based assay (24) . We first compared the efficiency of DCA and DC4 in internalizing apoptotic U87 glioma cells. After induction of apoptosis by UVB irradiation, ATCs were cocultured for 6 h with either DCA or DC4 at two DC:tumor cells ratios, 1:1 (data not shown) and 1:5. A significant increase in the percentage of CD11C and DiOC16 double-positive cells (Fig. 7B)Citation , at both cell ratios, was seen in experiments with DCA relative to DC4 (3–5-fold increase; P < 0.05 by paired Student’s t test). To assess whether DCAs were able to internalize living tumor cells (presumably after inducing apoptosis), living unirradiated tumor cells were coincubated with DCA and DC4. Again, DCA showed greater uptake of tumor cells relative to DC4 (Fig. 7CCitation ; 2–5-fold increase; P < 0.01 by paired Student’s t test). The same series of experiments was also performed at 4°C to show that the uptake of tumor cells was inhibited at low temperature, indicating an active uptake rather than a tight association of DCs with U87 cells (Fig. 7, B and C)Citation . Similar results showing that increased uptakes of SK-BR-3 cells by DCA relative to DC4 were also obtained using this assay (data not shown).



View larger version (27K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 7. Internalization of tumor cells by DCs. U87 cells were stained green with DiOC16 for 30 min at 37°C in PBS. Five x 105 tumor cells/well were irradiated with 10 J/m2 (UVB 254 nm) and incubated for 20 h to allow cells to undergo apoptosis. In separate experiments unirradiated tumor cells were separately cultured with DCs (E:T ratio 1:5). The cells were harvested 6 h later; DCs were stained with phycoerythrin-labeled anti-CD11C Ab (FL2) and analyzed by flow cytometry. Y-axis measurements are the fluorescent intensity of CD11C. X-axis measurements are the fluorescent measurement of DiOC16. Results are representative from a series of three experiments.

 
DCAs Induce Increased Ag-specific CD 8+ T-Cell Responses.
Transcript profiling characterization of DCA overall showed up-regulation of many genes that, acting in concert, could result in enhanced Ag presentation and T-cell effector function. To test this hypothesis, we prepared DCA and DC4 from the CD34-negative fraction of aphaeresis products from two breast cancer patients who were HLA-A*0201-positive. At the same time CD8+ T cells were isolated for later use. At the end of the DC culture period, we prepared apoptotic cells from the HER-2/neu-overexpressing cell line SK-BR-3 (25) . DCs were cultured with apoptotic SK-BR-3 cells for 2 days and then used for priming autologous CD8+ lymphocytes. In some cultures we substituted tumor cells with a synthetic peptide corresponding to residues 369–378 of the HER-2 oncoprotein. Cultured T cells were expanded with IL-2 and -7. Ag-specific T-cell effector frequencies were measured at the end of the culture period using an IFN-{gamma} ELISPOT assay. Although the effector frequencies were low (~0.1%) we were able to detect enhanced HER-2 peptide-specific HLA-A2-restricted T-cell responses when DCAs were used as APCs and when apoptotic cells were used as a source of Ag (Fig. 8)Citation . HER-2 Ag-specific T-cell responses were generally lower in the T-cell population obtained from a patient whose tumor did not express HER.



View larger version (39K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 8. Stimulation of Ag-specific CD 8+ T-cell responses by DCA and DC4. DCA and DC4 cells were cultured from aphaeresis products of two breast cancer patients. DCs were then loaded with apoptotic SK-BR-3 cells or synthetic HER-2 tumor Ag peptide. Autologous CD8+ T cells were added to the cultures. Responding T cells were expanded with additional IL-2 and IL-7. After 12 days the frequency of HER-2 peptide-specific T cells was determined by IFN-{gamma}-specific ELISPOT assay. Wells containing T cells alone showed no significant signal. Results are representative from two repeat experiments using cells from two donors. Bars, ±SE from triplicate measurements. Significance of the difference between mean values of the frequency IFN-{gamma}-producing cells was calculated by the method of Student.

 

   Discussion
Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
REFERENCES
 
Although the in vivo relevance of DCA remains to be established, it is tempting to postulate that certain manifestations of autoimmunity (26) or the antitumor effects associated with IFN-{alpha} therapy are related to the patterns of gene expression and functional activity of DCA described in this and similar studies (12, 13, 14, 15, 16, 17) .

On the basis of the expression levels of a series of chemokines, cytokines, and receptors, this study reveals that IFN-{alpha}-treated DCs share many characteristics of mature DCs, yet retain expression of many genes associated with an immature phenotype (Table 1)Citation . Compared with DC4, DCAs express more transcripts for inflammatory chemokine receptors responsible for DC migration to inflamed tissues and reduced quantities of lymphoid chemokine receptors that drive DC migration to the lymph nodes (10) . The pattern of inflammatory chemokine transcripts in DCA was typical of DCs found in peripheral tissues (i.e., MIP-1 {alpha} and ß, MIP-2 {alpha} and ß, Nap-2, I-309, and MCP-1). Such inflammatory chemokines are responsible for the recruitment of immature DCs, macrophages, granulocytes, and effector/memory T cells to the site of inflammation (27 , 28) .

DCA are also characterized by augmented expression of typically DC maturation-induced genes such as pro-IL-1 ß (29) , a soluble factor that is involved in mediation of inflammatory responses in innate immunity as well as in adaptive immunity, acting as a costimulator or growth factor driving T-cell expansion after activation. DCAs were also shown to have increased levels of mRNA for IL-1-ß converting enzyme isoform ß, IL-6, and IL-15. The combination of augmented levels of transcripts for these growth factors, all characterized previously to be active in supporting naive T-cell proliferation (30, 31, 32) suggested that DCAs might also be more effective than DC4s in supporting naive T-cell proliferation. Our experiments using neutralizing Abs to IL-1ß and IL-15 demonstrate the role of these cytokines in the proliferative responses driven by DCA. We were unable to detect expression of IL-12 p35 and p40 subunits in either DC population, suggesting that the proliferative effects of IL-12 were subordinate to the actions of IL-1ß and IL-15. Transcript profiling of DCA also demonstrated increased levels of transcripts for several IL-receptors, additionally supporting the concept of autocrine activation of DCA mediated by IL-15, IL-6, and IL-1ß (17 , 33) .

Immature myeloid lineage DCs are characterized by their proficiency in Ag capture. After maturation-induction, Ag capture proficiency is exchanged for enhanced capacity of Ag presentation and T-cell activation (7) . In this context, our molecular and functional data suggest that DCAs share characteristics of both immature and mature DCs. The expression of a large group of genes involved in Ag uptake was similar in DCA and DC4 populations. However, we did detect a modest increase in transcripts encoding two subunits of HLA-DM (HLA-DMA and HLA-DMB), a complex that catalyzes not only the release of the invariant chain remnant, CLIP, but other low-stability peptides, resulting in the favored binding of high-stability peptides (34) . As a consequence of higher HLA-DM expression, we observed that the amount of CLIP bound to cell surface MHC-II molecules of DCA was reduced relative to DC4.

Our functional studies demonstrate that myeloid DCs treated with IFN-{alpha}-2b acquire cytotoxic activity similar to other effectors of innate immunity. Previous reports have demonstrated that IFN-stimulated lymphoid cells (T cells and natural killer cells) can express TRAIL and kill TRAIL-sensitive target cells (35) . Other investigators have shown that IFN-stimulated human monocytes and DCs can mediate cellular apoptosis in TRAIL-sensitive tumor cell targets. In one study, DCs were cultured with IFN-{gamma}, IFN-{alpha}, GM-CSF, and CD40L or lipopolysaccharide (36) ; in other studies CD-34+ progenitor-derived DCs (cultured with GM-CSF and TNF-{alpha}) and peripheral blood monocyte-derived DCs (cultured in GM-CSF plus IL-4) were maturation-induced with IFN-ß (37) . Under the conditions used in this study (without additional maturation factors), we found that DCAs express high levels of transcripts encoding TRAIL and four additional members of the TNF family involved in the induction of programmed cell death, TNF-{alpha}, CD-30 Ligand, herpes virus entry mediator, and TWEAK. According to the gene expression pattern, we found that DCAs were more effective than DC4s in inducing apoptosis in TRAIL-susceptible tumor cell lines.

We compared the capacity of DCA and DC4 to phagocytose ATCs. As shown by flow cytometric measurements, DCAs more readily internalized ATCs than DC4s. When live tumor cells were substituted for ATCs in culture, this activity was retained. Consonant with these observations, we found that DCAs were more effective than DC4 APCs in generating a HER-2-specific CTL response when ATCs were used as an Ag source.

Overall our results demonstrate that IFN-{alpha}-treated DCs have a mixed immature-mature phenotype, efficiently take-up apoptotic cells and Ags, and readily stimulate T-lymphocyte activation and proliferation. These characteristics, coupled with the cytotoxic activity of DCA and increased expression of members of toll-like receptor family, support the concept that innate immune responses can be channeled by DCs to support the adaptive immunity. It has been proposed that the exchange of Ag uptake and processing capacity for efficient Ag presentation and T-cell priming during DC maturation is a regulatory mechanism preventing T-cell autoreactivity. Our results suggest that DC maturation in the presence of IFN-{alpha}-2b partially uncouples this exchange and that DCs with this phenotype may be useful in tumor immunotherapy.

Clinical DC-based tumor immunotherapy has mainly focused on the use of tumor-associated Ag-derived peptides for the induction of antitumor cytotoxic T lymphocytes. The alternative strategy, in which whole tumor cells or various tumor preparations are taken-up and presented by DCs to T cells, potentially resulting in polyvalent immunization of the host to multiple (unknown) tumor-associated Ags, is also under study (38) . DCs pulsed with necrotic or ATCs, or possibly introduced into the tumor bed, could represent an alternative to peptide-based DC immunotherapy protocols, particularly where tumor-associated Ags are unknown, and IFN-{alpha} might represent a potent factor to be used for the production of DCs used in this latter approach, although certainly to be used with caution.


   FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by grants from the USPHS, NIH 1 K23 RR16078 (to K. P. P.), the Herbert Irving Cancer Center, and the Octoberwoman Foundation. Back

2 To whom requests for reprints should be addressed, at Medical Oncology, BB 20–13, 650 West 168th Street, New York, NY 10032. Phone: (212) 305-7363; Fax: (212) 305-7348; E-mail: peh1{at}columbia.edu Back

3 The abbreviations used are: DC, dendritic cell; GM-CSF, granulocyte macrophage colony-stimulating factor; GMP, good manufacturing procedure; PBMC, peripheral blood mononuclear cell; IL, interleukin; Ag, antigen; APC, antigen presenting cell; mAb, monoclonal antibody; Ab, antibody; CLIP, class II-associated invariant chain peptide; RT-PCR, reverse transcription-PCR; ELISPOT, enzyme-linked immunospot GAPDH, glyceraldehyde-3-phosphate dehydrogenase; TNF, tumor necrosis factor; TRAIL, tumor necrosis factor-related apoptosis-inducing ligand; TWEAK, tumor necrosis factor-like weak inducer of apoptosis; ATC, apoptotic tumor cell. Back

Received 12/23/02; revised 2/18/03; accepted 2/20/03.


   REFERENCES
Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 

  1. Dowding C., Gordon M., Guo A. P., Maison D., Osterholz J., Siczkowski M., Goldman J. Potential mechanisms of action of interferon-{alpha} in CML. Leuk. Lymphoma, 11: 185-191, 1993.
  2. Wetzler M., Kantarjian H., Kurzrock R., Talpaz M. Interferon-{alpha} therapy for chronic myelogenous leukemia. Am. J. Med., 99: 402-411, 1995.[CrossRef][Medline]
  3. Kirkwood J. M., Ibrahim J. G., Sosman J. A., Sondak V. K., Agarwala S. S., Ernstoff M. S., Rao U. High-dose interferon alfa-2b significantly prolongs relapse-free and overall survival compared with the GM2-KLH/QS-21 vaccine in patients with resected stage IIB-III melanoma: results of intergroup trial E1694/S9512/C509801. J. Clin. Oncol., 19: 2370-2380, 2001.[Abstract/Free Full Text]
  4. Biron C. A. Interferons {alpha} and ß as immune regulators-a new look. Immunity, 14: 661-664, 2001.[CrossRef][Medline]
  5. Minasian L. M., Motzer R. J., Gluck L., Mazumdar M., Vlamis V., Krown S. E. Interferon alfa-2a in advanced renal cell carcinoma: treatment results and survival in 159 patients with long-term follow-up. J. Clin. Oncol., 11: 1368-1375, 1993.[Abstract/Free Full Text]
  6. Vial T., Descotes J. Clinical toxicity of the interferons. Drug Saf., 10: 115-150, 1994.[Medline]
  7. Banchereau J., Briere F., Caux C., Davoust J., Lebecque S., Liu Y. J., Pulendran B., Palucka K. Immunobiology of dendritic cells. Annu Rev Immunol, 18: 767-811, 2000.[CrossRef][Medline]
  8. Liu Y. J. Dendritic cell subsets and lineages, and their functions in innate and adaptive immunity. Cell, 106: 259-262, 2001.[CrossRef][Medline]
  9. Sallusto F., Palermo B., Lenig D., Miettinen M., Matikainen S., Julkunen I., Forster R., Burgstahler R., Lipp M., Lanzavecchia A. Distinct patterns and kinetics of chemokine production regulate dendritic cell function. Eur. J. Immunol., 29: 1617-1625, 1999.[CrossRef][Medline]
  10. Sallusto F., Palermo B., Hoy A., Lanzavecchia A. The role of chemokine receptors in directing traffic of naive, type 1 and type 2 T cells. Curr. Top. Microbiol. Immunol., 246: 123-128, 1999.[Medline]
  11. Moschella F., Maffei A., Catanzaro R. P., Papadopoulos K. P., Skerrett D., Hesdorffer C. S., Harris P. E. Transcript profiling of human dendritic cells maturation-induced under defined culture conditions: comparison of the effects of tumour necrosis factor {alpha}, soluble CD40 ligand trimer and interferon {gamma}. Br. J. Haematol., 114: 444-457, 2001.[CrossRef][Medline]
  12. Montoya M., Schiavoni G., Mattei F., Gresser I., Belardelli F., Borrow P., Tough D. F. Type I interferons produced by dendritic cells promote their phenotypic and functional activation. Blood, 99: 3263-3271, 2002.[Abstract/Free Full Text]
  13. Luft T., Pang K. C., Thomas E., Hertzog P., Hart D. N., Trapani J., Cebon J. Type I IFNs enhance the terminal differentiation of dendritic cells. J. Immunol., 161: 1947-1953, 1998.[Abstract/Free Full Text]
  14. Santini S. M., Lapenta C., Logozzi M., Parlato S., Spada M., Di Pucchio T., Belardelli F. Type I interferon as a powerful adjuvant for monocyte-derived dendritic cell development and activity in vitro and in Hu-PBL-SCID mice. J. Exp. Med., 191: 1777-1788, 2000.[Abstract/Free Full Text]
  15. McRae B. L., Nagai T., Semnani R. T., van Seventer J. M., van Seventer G. A. Interferon-{alpha} and -ß inhibit the in vitro differentiation of immunocompetent human dendritic cells from CD14(+) precursors. Blood, 96: 210-217, 2000.[Abstract/Free Full Text]
  16. Lehner M., Felzmann T., Clodi K., Holter W. Type I interferons in combination with bacterial stimuli induce apoptosis of monocyte-derived dendritic cells. Blood, 98: 736-742, 2001.[Abstract/Free Full Text]
  17. Mattei F., Schiavoni G., Belardelli F., Tough D. F. IL-15 is expressed by dendritic cells in response to type I IFN, double- stranded RNA, or lipopolysaccharide and promotes dendritic cell activation. J. Immunol., 167: 1179-1187, 2001.[Abstract/Free Full Text]
  18. Maffei A., Ayello J., Skerrett D., Papadopoulos K., Harris P., Hesdorffer C. A novel closed system utilizing styrene copolymer bead adherence for the production of human dendritic cells. Transfusion, 40: 1419-1420, 2000.[CrossRef][Medline]
  19. Romani N., Reider D., Heuer M., Ebner S., Kampgen E., Eibl B., Niederwieser D., Schuler G. Generation of mature dendritic cells from human blood. An improved method with special regard to clinical applicability. J. Immunol. Methods, 196: 137-151, 1996.[CrossRef][Medline]
  20. Reddy A., Sapp M., Feldman M., Subklewe M., Bhardwaj N. A monocyte conditioned medium is more effective than defined cytokines in mediating the terminal maturation of human dendritic cells. Blood, 90: 3640-3646, 1997.[Abstract/Free Full Text]
  21. Harris P. E., Maffei A., Colovai A. I., Kinne J., Tugulea S., Suciu-Foca N. Predominant HLA-class II bound self-peptides of a hematopoietic progenitor cell line are derived from intracellular proteins. Blood, 87: 5104-5112, 1996.[Abstract/Free Full Text]
  22. Choi C., Kutsch O., Park J., Zhou T., Seol D. W., Benveniste E. N. Tumor necrosis factor-related apoptosis-inducing ligand induces caspase- dependent interleukin-8 expression and apoptosis in human astroglioma cells. Mol. Cell. Biol., 22: 724-736, 2002.[Abstract/Free Full Text]
  23. Wu M., Das A., Tan Y., Zhu C., Cui T., Wong M. C. Induction of apoptosis in glioma cell lines by TRAIL/Apo-2l. J. Neurosci. Res., 61: 464-470, 2000.[CrossRef][Medline]
  24. Hoffmann T. K., Meidenbauer N., Dworacki G., Kanaya H., Whiteside T. L. Generation of tumor-specific T-lymphocytes by cross-priming with human dendritic cells ingesting apoptotic tumor cells. Cancer Res., 60: 3542-3549, 2000.[Abstract/Free Full Text]
  25. van de Vijver M. J., Mooi W. J., Wisman P., Peterse J. L., Nusse R. Immunohistochemical detection of the neu protein in tissue sections of human breast tumors with amplified neu DNA. Oncogene, 2: 175-178, 1988.[Medline]
  26. Blanco P., Palucka A. K., Gill M., Pascual V., Banchereau J. Induction of dendritic cell differentiation by IFN-{alpha} in systemic lupus erythematosus. Science (Wash. DC), 294: 1540-1543, 2001.[Abstract/Free Full Text]
  27. Iellem A., Colantonio L., Bhakta S., Sozzani S., Mantovani A., Sinigaglia F., D’Ambrosio D. Inhibition by IL-12 and IFN-{alpha} of I-309 and macrophage-derived chemokine production upon TCR triggering of human Th1 cells. Eur. J. Immunol., 30: 1030-1039, 2000.[CrossRef][Medline]
  28. Tomiyama H., Matsuda T., Takiguchi M. Differentiation of human CD8(+) T cells from a memory to memory/effector phenotype. J. Immunol., 168: 5538-5550, 2002.[Abstract/Free Full Text]
  29. Gardella S., Andrei C., Lotti L. V., Poggi A., Torrisi M. R., Zocchi M. R., Rubartelli A. CD8(+) T lymphocytes induce polarized exocytosis of secretory lysosomes by dendritic cells with release of interleukin-1ß and cathepsin D. Blood, 98: 2152-2159, 2001.[Abstract/Free Full Text]
  30. Joseph S. B., Miner K. T., Croft M. Augmentation of naive. Th1 and Th2 effector CD4 responses by IL-6, IL-1 and TNF. Eur. J. Immunol., 28: 277-289, 1998.[CrossRef][Medline]
  31. Ge Q., Palliser D., Eisen H. N., Chen J. Homeostatic T cell proliferation in a T cell-dendritic cell coculture system. Proc. Natl. Acad. Sci. USA, 99: 2983-2988, 2002.[Abstract/Free Full Text]
  32. Niedbala W., Wei X., Liew F. Y. IL-15 induces type 1 and type 2 CD4+ and CD8+ T cells proliferation but is unable to drive cytokine production in the absence of TCR activation or IL-12/IL-4 stimulation in vitro. Eur. J. Immunol., 32: 341-347, 2002.[CrossRef][Medline]
  33. Luft T., Jefford M., Luetjens P., Hochrein H., Masterman K. A., Maliszewski C., Shortman K., Cebon J., Maraskovsky E. IL-1 ß enhances CD40 ligand-mediated cytokine secretion by human dendritic cells (DC): a mechanism for T cell-independent DC activation. J. Immunol., 168: 713-722, 2002.[Abstract/Free Full Text]
  34. Denzin L. K., Sant’Angelo D. B., Hammond C., Surman M. J., Cresswell P. Negative regulation by HLA-DO of MHC class II-restricted antigen processing. Science (Wash. DC), 278: 106-109, 1997.[Abstract/Free Full Text]
  35. Kayagaki N., Yamaguchi N., Nakayama M., Eto H., Okumura K., Yagita H. Type I interferons (IFNs) regulate tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) expression on human T cells: a novel mechanism for the antitumor effects of type I IFNs. J. Exp. Med., 189: 1451-1460, 1999.[Abstract/Free Full Text]
  36. Fanger N. A., Maliszewski C. R., Schooley K., Griffith T. S. Human dendritic cells mediate cellular apoptosis via tumor necrosis factor-related apoptosis-inducing ligand (TRAIL). J. Exp. Med., 190: 1155-1164, 1999.[Abstract/Free Full Text]
  37. Liu S., Yu Y., Zhang M., Wang W., Cao X. The involvement of TNF-{alpha}-related apoptosis-inducing ligand in the enhanced cytotoxicity of IFN-ß-stimulated human dendritic cells to tumor cells. J. Immunol., 166: 5407-5415, 2001.[Abstract/Free Full Text]
  38. Berard F., Blanco P., Davoust J., Neidhart-Berard E. M., Nouri-Shirazi M., Taquet N., Rimoldi D., Cerottini J. C., Banchereau J., Palucka A. K. Cross-priming of naive CD8 T cells against melanoma antigens using dendritic cells loaded with killed allogeneic melanoma cells. J. Exp. Med., 192: 1535-1544, 2000.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Clin. Cancer Res.Home page
J. M. Zimmerer, G. B. Lesinski, A. S. Ruppert, M. D. Radmacher, C. Noble, K. Kendra, M. J. Walker, and W. E. Carson III
Gene Expression Profiling Reveals Similarities between the In vitro and In vivo Responses of Immune Effector Cells to IFN-{alpha}
Clin. Cancer Res., September 15, 2008; 14(18): 5900 - 5906.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
J. M. Zimmerer, A. M. Lehman, A. S. Ruppert, C. W. Noble, T. Olencki, M. J. Walker, K. Kendra, and W. E. Carson III
IFN-{alpha}-2b-Induced Signal Transduction and Gene Regulation in Patient Peripheral Blood Mononuclear Cells Is Not Enhanced by a Dose Increase from 5 to 10 Megaunits/m2
Clin. Cancer Res., March 1, 2008; 14(5): 1438 - 1445.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
M. D. Hyrcza, C. Kovacs, M. Loutfy, R. Halpenny, L. Heisler, S. Yang, O. Wilkins, M. Ostrowski, and S. D. Der
Distinct Transcriptional Profiles in Ex Vivo CD4+ and CD8+ T Cells Are Established Early in Human Immunodeficiency Virus Type 1 Infection and Are Characterized by a Chronic Interferon Response as Well as Extensive Transcriptional Changes in CD8+ T Cells
J. Virol., April 1, 2007; 81(7): 3477 - 3486.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
A. Maffei, Z. Liu, P. Witkowski, F. Moschella, G. D. Pozzo, E. Liu, K. Herold, R. J. Winchester, M. A. Hardy, and P. E. Harris
Identification of Tissue-Restricted Transcripts in Human Islets
Endocrinology, October 1, 2004; 145(10): 4513 - 4521.
[Abstract] [Full Text] [PDF]

Home page
 JNCI J Natl Cancer InstHome page
G. B. Lesinski, S. V. Kondadasula, T. Crespin, L. Shen, K. Kendra, M. Walker, and W. E. Carson III
Multiparametric Flow Cytometric Analysis of Inter-Patient Variation in STAT1 Phosphorylation Following Interferon Alfa Immunotherapy
J Natl Cancer Inst, September 1, 2004; 96(17): 1331 - 1342.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moschella, F.
Right arrow Articles by Harris, P. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moschella, F.
Right arrow Articles by Harris, P. E.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online