Table 1A

Continued

Forward primer sequenceReverse primer sequenceProbe sequence (5′ with 6FAM and 3′ with BHQ1)
ACGGGCGTTTTCGGTAGTTCCGAACCTCCAAAATCTCGACGACTCTAAACCCTACGCACGCGAAA
CGTTCGCGGCGTCGGCGCATACGTCCCTAACGACCGCAACCGTTTCCGCCCTAACTA
TCGGCGTTATTACGTGTGTTTTTTCCAACCACTACCAACCACCCCTCCGCTACCCAAACTAATCGACGAA
GGTTGGGTTTAGTTTTTGCGTTGCGACGAACCGCGAAACCACGCGCGATCGAACCACTCT
CGGGAGGTAGACGGGCGCAACCCCAAACCGATAAAAAAAAGGGCGAGTTTTTTCGTCGGTTCG
CGTTGGAGAATTTGATCGTCGCCCGTAACCCTCGCGCAAAGTTTAAGAAGTTTAAGTTGAAGTTGTTGTCGGTGTCG
TCGTCGTCGTTTCGGTTAGTTTCCCTCCGAAACGCTATCGCGACCATAAACGCCAACGCCG
GGATTCGCGGGTATAGACGTTCGAAATCCGCGCGAAACCCAATCCCTCCGCCACGTAAAA
TCGTATTTCGGGATTCGGTCAACTAAACGCAAACCCCGCACGACGCCGAAAACAACCGAAATCTACA
CGTTGGCGAGTTATGAGCGTTTACCGCCCGCAACCTCTCGCGTAAATTTGAGTTATTTTTGAGCGTGGA
ATTGAGTTGCGGGAGTTGGTACACGCTCCAACCGAATACGCCCTTCCCAACGCGCCCA
GCGGAATTACGACGGGTAGAACTCCATAACCCTCCGACGACGCCCAAAAACTTCCCGACTCCGTA
TGGTGATGGAGGAGGTTTAGTAAGTAACCAATAAAACCTACTCCTCCCTTAAACCACCACCCAACACACAATAACAAACACA
TCTAACAATTATAAACTCCA-ACCACCAAGGGAAGATGGGATAGAAGGGAATATCCTTCATTCTAACCCAATACCTATCCCACCTCTAAA