Table 2

Sequences of primers, probe, and calibration oligonucleotide

Intron-spanning primersForwardExon 25′-GCGTGGACAATGGCTACTCA-3′
ReverseExon 35′-CCGCTTTTCTGTCTGGTTCC-3′
Dual-labelled fluorescent probeExon 35′-(FAMa)TGATTTGATGGAGTTGGACATGGCCA (TAMRAb)-3′
Oligonucleotide for calibration5′-ATCCAGCGTGGACAATGGCTACTCAAGCTGA TTTGATGGAGTTGGACATGGCCATGGAACCA GACAGAAAAGCGCTGTT-3′
  • a 6-carboxyfluorescein.

  • b 6-carboxytetramethylrhodamine.