Table 2.

Primer sequences for RT-PCR and MSP

Primer setsSense primerAntisense primerAnneal temperature, °C (no. cycles)Product size (bp)
RT-PCR for clinical prostate samples
S-1B1_RTAACGTACCGGCACTATCACACGACCTGATCCAATTCTGC55 (40)137
S-G3PDHCAATGACCCCTTCATTGACCTGGAAGATGATGGGATTT55 (40)135
RT-PCR for prostate cancer cell lines
L-1B1_RTTACCGGCACTATCACTGACATCTTCGGGTGAGCCAGGATGGAGATGAAGAGAA65 (35)510
AhR_RTCCACAGCAACAGCTGTGTCAGAAGATGCGGATGATGAAGTGGCTGAAGATGTGT65 (35)600
ARNT_RTGCTGGGAGATCAGAGCAACAGCTACAATGTTTCTTTCCAGAGGGACTGCTCACA65 (35)588
L-G3PDHTCCCATCACCATCTTCCACATCACGCCACAGTTTCC60 (35)376
MSP
Pan1GGTTTTTTTATAAAGGGAGGGTTTACTCCAATCATATCCCTAAAC50 (45)308
MS1GTAGGCGCGATTGTGCGTGCTCTCACGACACCTAACACGCG64 (3), 62 (3), 60 (3), 58 (31)118
US1TTTGGTAGGTGTGATTGTGTGTGTCTTCTCACAACACCTAACACACAA60 (40)125
Pan2GTTTAGGGATATGATTGGAGTACTAAAAAAACCTAAAAAAACTAAC50 (45)189
MS2CGTACGTAAAGTTTAGTTTCGTACGAAACGAAACCCGAACGAACGAAACG56 (3), 54 (3), 53 (3), 52 (31)126
US2GGTGTATGTAAAGTTTAGTTTTGTATGACTAACAAAACAAAACAAAACCCAAACAAAACA58 (40)134
MS3TCGATTTTTTAGAAGCGGCGTACGGAAACGAAACCCGAACGAAACG62 (3), 60 (3), 58 (3), 56 (31)144
US3AGTTGATTTTTTAGAAGTGGTGTATGACTAACAAAACAAAACCCAAACAAAACA58 (40)152
Pan5GATTGGAGGTGGTTGTGATGAAGCCACTCCCACTCCAAAATCAAAAC50 (45)256
MS5AGTTTCGAGGTCGGTCGGTGCAACAACGCGACCTAACAAAACG59 (38)106
US5GTAGAGTTTTGAGGTTGGTTGGTGTAAAACAACACAACCTAACAAAACAA61 (32)112
  • NOTE: Underline indicates the CpG sites within the primer sequence.