Table 1.

β-Tubulin gene primers

PrimerSequence (5′-3′)UsePrimer siteSize (bp)
Exon 1 forwardGTCATGACGTCACCGGGCAPCRIntron310
Exon 1 reverseAATGTGCCACCCGGCCAIntron
Exon 1 sequence forwardGTCCCCGGGTATAAAAGACCSequencingNANA
Exon 1 sequence reverseGCACCCTCGGTCCCAACCCCSequencingNANA
Exon 4 forwardGCCAGTCTAAGACCAGTCCTACCPCRIntron704
Exon 4 reverseAACATCTGCTGGGTGAGCTCExon
Exon 4 sequence forwardATGTTCACTTTCCCTCTGGCSequencingNANA
Exon 4 sequence forward 2ACCCTCTCTGTCCACCAGCTSequencingNANA
Exon 4 sequence reverseGTACTGCTGGCTGCCCCGGCSequencingNANA
Exon 4 sequence reverse 2TCTGACACCTTGGGTGAGGGSequencingNANA
Exon 4 forward 2GCAGATGCTCAACGTGCAPCRExon574
Exon 4 reverse 2AGTGAGAACACAGACCACAAGGIntron
Exon 4 sequence forward 3AAGACGGCCGTGTGCGACATSequencingNANA
Exon 4 sequence reverse 3GCACGATTGATCTGAGAAGTSequencingNANA
  • Abbreviation: NA, not available.