Table 1

Primer sequence, annealing temperature, and product size for MSP assays

CpG statusGeneForward primer (5′→3′)Reverse primer (5′→3′)Annealing temperature (°C)Product size (bp)*
MCDKN2AGGTTACGGTCGCGGTTCGCTAAATCGACCTCCGACCG65.1143
UGTTATGGTTGTGGTTTGGGGTTGCCACCTAAATCAACCTCCAACCA65.1146
MMGMTTTTCGACGTTCGTAGGTTTTCGCGCACTCTTCCGAAAACGAAACG62.0121
UTTTGTGTTTTGATGTTTGTAGGTTTTTGTAACTCCACACTCTTCCAAAAACAAAACA62.0133
MMLH1CGGATAGCGATTTTTAACGCCCTAAAACGACTACTACCCG58.5120
UAATGAATTAATAGGAAGAGTGGATAGTTCTCTTCATCCCTCCCTAAAACA57.5136
  • NOTE. M, methylated; U, unmethylated.

  • * All of the primers were modified with a 20 bp GC-rich tail (5′-GCGGTCCCAAAAGGGTCAGT-3′) at their 5′ end.