Table 2.

Primer sequences used in the pyrosequencing analysis

Pyrosequencing
SenseAntisenseSequencing primer
GSTP1 (1st step)AAGGAGGTTAGGGGTAAAAGTTATACCAAAACCTCCCCAATACGGGGGAGGATGTTAAG
GSTP1 (2nd step)GAGTTAGGGGGAGGATGT5′-Biotin-CCAAAACCTCCCCAATAC
AR (1st step)TAGGAAGTAGGGGTTTTTTAGGGTTAGACCCAACCCACCTCCTTACCT and U-ACCTCCCCTTTCCTTTTCTCCTTGTTTTTTTAAAGTTATTAGGTA
AR (2nd step)GTAGGGGTTTTTTAGGGTTAGAGTTAG5′-Biotin-U
RARβ2 (1st step)AGTTGGGTTATTTGAAGGTTATACCCAAACAAACCCTACTC and U-CCCAAACAAACCCTACTCGGGACACCGCTGATCGTTTA
RARβ2 (2nd step)AAGTAGTAGGAAGTGAGTTGTTTAGA5′-Biotin-U
SPARC (1st step)GGTGTAATTATAGAAGGGAAAGGTTGGGU-CCTATTACCTATCTCTAAACCCCTCCACATT
SPARC (2nd step)AAGGTTGGGAGGGGGTTATATATATTTTAG5′-Biotin-UTTAGGGTAGTTTGAAGGAT
TIMP3 (1st step)GGTGGGTGGGTGTTAGTTGGU-CAAACCCTCCTACCCCTTCTC
TIMP3 (2nd step)GGTTTTGGTTTGGGTTAGAGATA5′-Biotin-UGGTTAGAGATATTTAGTGGTTTA
NKX2-5 (1st step)GAGAGTAGGGTTGGGGAATATGAACCCCTAACCCAATAACAAACT and U-CAATAACAAACTAAATCCCCCTCCTCTAGGTAGTTTTTTTGTATGGTG
NKX2-5 (2nd step)TAAGGTTTTTGGTAGTTTTTTTGTATGG5′-Biotin-U
RT-PCR
ForwardReversePCR size (bp)
SPARC (STD)TGTGCGAGCTGGATGAGAACGATGTACTTGTCATTGTCCAGGTC599
SPARCTGTGCGAGCTGGATGAGAACGTGGCAGGAAGAGTCGAAGG128
TIMP3 (STD)CCAAGGTGGTGGGGAAGAAGAGCGGGAAGGGAGGGAAG547
TIMP3GGGGAAGAAGCTGGTAAAGGAGAGCAGGTACTGGTACTTGTTGAC171
NKX2-5 (STD)GCCGCCTTCAAGCCAGAGGCCCCACCAGCTCCAGAG474
NKX2-5CACGTCCACGCAGGTCAAG (TaqMan probe: CTGGTCCTGCCGCTGCCGCTTG)GCCCCACCAGCTCCAGAG88

NOTE: Primers used in the RT-PCR analysis are also shown, where STD represents the primers used to generate cDNA standards. U represents universal primer sequence—GGGACACCGCTGATCGTTTA.