Table 1

Primers and major amplicons’ identities

AmpliconPrimer FPrimer RSizea (bp)Melting peaka (°C)
TEL-AML1aagcccatcaacctctctcatctggaaggcggcgtgaagc18186 ± 0.5
(TEL, exon 5)(AML1, exon 3)
E2A-PBX1gccacggggcgctggcctcaggtttcacgccttccgctaacag27593.9 ± 0.4
(E2A, exon 12)(PBX1, exon 2)
MLL-AF4agaatcaggtccagagcagagcatgctgagagtcctttgtaggg35883.6 ± 0.3
(MLL, exons 8 to 9)(AF4, exons 5 to 6)
mBCR-ABLacctcacctccagcgaggaggactttccactggccacaaaatcatacagt41892.2 ± 0.3
(BCR, exon 1)(ABL, exon 2)
HPRT gttggatataagccagactttgttgactcaacttgaactctcatcttaggc16480.8 ± 0.3
GAPDH cgggaagcttgtcatcaatggcatggttcacacccatgacg22189.1 ± 0.3
  • a For the major transcript.