Skip to main content
  • AACR Publications
    • Blood Cancer Discovery
    • Cancer Discovery
    • Cancer Epidemiology, Biomarkers & Prevention
    • Cancer Immunology Research
    • Cancer Prevention Research
    • Cancer Research
    • Clinical Cancer Research
    • Molecular Cancer Research
    • Molecular Cancer Therapeutics

AACR logo

  • Register
  • Log in
  • My Cart
Advertisement

Main menu

  • Home
  • About
    • The Journal
    • AACR Journals
    • Subscriptions
    • Permissions and Reprints
  • Articles
    • OnlineFirst
    • Current Issue
    • Past Issues
    • CCR Focus Archive
    • Meeting Abstracts
    • Collections
      • COVID-19 & Cancer Resource Center
      • Breast Cancer
      • Clinical Trials
      • Immunotherapy: Facts and Hopes
      • Editors' Picks
      • "Best of" Collection
  • For Authors
    • Information for Authors
    • Author Services
    • Best of: Author Profiles
    • Submit
  • Alerts
    • Table of Contents
    • Editors' Picks
    • OnlineFirst
    • Citation
    • Author/Keyword
    • RSS Feeds
    • My Alert Summary & Preferences
  • News
    • Cancer Discovery News
  • COVID-19
  • Webinars
  • Search More

    Advanced Search

  • AACR Publications
    • Blood Cancer Discovery
    • Cancer Discovery
    • Cancer Epidemiology, Biomarkers & Prevention
    • Cancer Immunology Research
    • Cancer Prevention Research
    • Cancer Research
    • Clinical Cancer Research
    • Molecular Cancer Research
    • Molecular Cancer Therapeutics

User menu

  • Register
  • Log in
  • My Cart

Search

  • Advanced search
Clinical Cancer Research
Clinical Cancer Research
  • Home
  • About
    • The Journal
    • AACR Journals
    • Subscriptions
    • Permissions and Reprints
  • Articles
    • OnlineFirst
    • Current Issue
    • Past Issues
    • CCR Focus Archive
    • Meeting Abstracts
    • Collections
      • COVID-19 & Cancer Resource Center
      • Breast Cancer
      • Clinical Trials
      • Immunotherapy: Facts and Hopes
      • Editors' Picks
      • "Best of" Collection
  • For Authors
    • Information for Authors
    • Author Services
    • Best of: Author Profiles
    • Submit
  • Alerts
    • Table of Contents
    • Editors' Picks
    • OnlineFirst
    • Citation
    • Author/Keyword
    • RSS Feeds
    • My Alert Summary & Preferences
  • News
    • Cancer Discovery News
  • COVID-19
  • Webinars
  • Search More

    Advanced Search

Cancer Therapy: Preclinical

Reovirus as a Viable Therapeutic Option for the Treatment of Multiple Myeloma

Chandini M. Thirukkumaran, Zhong Qiao Shi, Joanne Luider, Karen Kopciuk, He Gao, Nizar Bahlis, Paola Neri, Mark Pho, Douglas Stewart, Adnan Mansoor and Don G. Morris
Chandini M. Thirukkumaran
Authors' Affiliations: 1Department of Oncology, University of Calgary; 2Tom Baker Cancer Center; 3Calgary Laboratory Services, Calgary; and 4Department of Public Health Sciences, School of Public Health, University of Alberta, Alberta, Canada
Authors' Affiliations: 1Department of Oncology, University of Calgary; 2Tom Baker Cancer Center; 3Calgary Laboratory Services, Calgary; and 4Department of Public Health Sciences, School of Public Health, University of Alberta, Alberta, Canada
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Zhong Qiao Shi
Authors' Affiliations: 1Department of Oncology, University of Calgary; 2Tom Baker Cancer Center; 3Calgary Laboratory Services, Calgary; and 4Department of Public Health Sciences, School of Public Health, University of Alberta, Alberta, Canada
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Joanne Luider
Authors' Affiliations: 1Department of Oncology, University of Calgary; 2Tom Baker Cancer Center; 3Calgary Laboratory Services, Calgary; and 4Department of Public Health Sciences, School of Public Health, University of Alberta, Alberta, Canada
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Karen Kopciuk
Authors' Affiliations: 1Department of Oncology, University of Calgary; 2Tom Baker Cancer Center; 3Calgary Laboratory Services, Calgary; and 4Department of Public Health Sciences, School of Public Health, University of Alberta, Alberta, Canada
Authors' Affiliations: 1Department of Oncology, University of Calgary; 2Tom Baker Cancer Center; 3Calgary Laboratory Services, Calgary; and 4Department of Public Health Sciences, School of Public Health, University of Alberta, Alberta, Canada
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
He Gao
Authors' Affiliations: 1Department of Oncology, University of Calgary; 2Tom Baker Cancer Center; 3Calgary Laboratory Services, Calgary; and 4Department of Public Health Sciences, School of Public Health, University of Alberta, Alberta, Canada
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Nizar Bahlis
Authors' Affiliations: 1Department of Oncology, University of Calgary; 2Tom Baker Cancer Center; 3Calgary Laboratory Services, Calgary; and 4Department of Public Health Sciences, School of Public Health, University of Alberta, Alberta, Canada
Authors' Affiliations: 1Department of Oncology, University of Calgary; 2Tom Baker Cancer Center; 3Calgary Laboratory Services, Calgary; and 4Department of Public Health Sciences, School of Public Health, University of Alberta, Alberta, Canada
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Paola Neri
Authors' Affiliations: 1Department of Oncology, University of Calgary; 2Tom Baker Cancer Center; 3Calgary Laboratory Services, Calgary; and 4Department of Public Health Sciences, School of Public Health, University of Alberta, Alberta, Canada
Authors' Affiliations: 1Department of Oncology, University of Calgary; 2Tom Baker Cancer Center; 3Calgary Laboratory Services, Calgary; and 4Department of Public Health Sciences, School of Public Health, University of Alberta, Alberta, Canada
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Mark Pho
Authors' Affiliations: 1Department of Oncology, University of Calgary; 2Tom Baker Cancer Center; 3Calgary Laboratory Services, Calgary; and 4Department of Public Health Sciences, School of Public Health, University of Alberta, Alberta, Canada
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Douglas Stewart
Authors' Affiliations: 1Department of Oncology, University of Calgary; 2Tom Baker Cancer Center; 3Calgary Laboratory Services, Calgary; and 4Department of Public Health Sciences, School of Public Health, University of Alberta, Alberta, Canada
Authors' Affiliations: 1Department of Oncology, University of Calgary; 2Tom Baker Cancer Center; 3Calgary Laboratory Services, Calgary; and 4Department of Public Health Sciences, School of Public Health, University of Alberta, Alberta, Canada
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Adnan Mansoor
Authors' Affiliations: 1Department of Oncology, University of Calgary; 2Tom Baker Cancer Center; 3Calgary Laboratory Services, Calgary; and 4Department of Public Health Sciences, School of Public Health, University of Alberta, Alberta, Canada
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Don G. Morris
Authors' Affiliations: 1Department of Oncology, University of Calgary; 2Tom Baker Cancer Center; 3Calgary Laboratory Services, Calgary; and 4Department of Public Health Sciences, School of Public Health, University of Alberta, Alberta, Canada
Authors' Affiliations: 1Department of Oncology, University of Calgary; 2Tom Baker Cancer Center; 3Calgary Laboratory Services, Calgary; and 4Department of Public Health Sciences, School of Public Health, University of Alberta, Alberta, Canada
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
DOI: 10.1158/1078-0432.CCR-11-3085 Published September 2012
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

Abstract

Purpose: Despite the recent advances made in the treatment of multiple myeloma, the disease still remains incurable. The oncolytic potential of reovirus has previously been shown and is currently in phase III clinical trials for solid tumors. We tested the hypothesis that reovirus can successfully target human multiple myeloma in vitro, ex vivo, and in vivo without affecting human hematopoietic stem cell (HHSC) re-population/differentiation in a murine model that partially recapitulates human multiple myeloma.

Experimental Design: Human myeloma cell lines and ex vivo tumor specimens were exposed to reovirus and oncolysis and mechanisms of cell death were assessed. RPMI 8226GFP+ cells were injected intravenously to non-obese diabetic/severe combined immune deficient (NOD/SCID) mice and treated with live reovirus (LV) or dead virus (DV). Multiple myeloma disease progression was evaluated via whole-body fluorescence and bone marrow infiltration. HHSCs exposed to LV/DV were injected to NOD/SCID mice and re-population/differentiation was monitored.

Results: A total of six of seven myeloma cell lines and five of seven patient tumor specimens exposed to reovirus showed significant in vitro sensitivity. Tumor response of multiple myeloma by LV, but not DV, was confirmed by comparison of total tumor weights (P = 0.05), and bone marrow infiltration (1/6, LV; 5/6, DV). Mice injected with LV- or DV-exposed HHSCs maintained in vivo re-population/lineage differentiation showing a lack of viral effect on the stem cell compartment. Reovirus oncolysis was mediated primarily by activation of the apoptotic pathways.

Conclusions: The unique ability of reovirus to selectively kill multiple myeloma while sparing HHSCs places it as a promising systemic multiple myeloma therapeutic for clinical testing. Clin Cancer Res; 18(18); 4962–72. ©2012 AACR.

This article is featured in Highlights of This Issue, p. 4863

Translational Relevance

This study examines the potential use of the oncolytic virus, the reovirus, as a therapeutic agent for multiple myeloma, a disease for which there is no cure at present despite several new therapeutics being brought to the clinic. This work utilizes human multiple myeloma cell lines, ex vivo patient tumors, and in vivo animal models to ensure that the observations are as clinically relevant to a translational clinical setting. It lays the foundation to support an early-phase clinical trial for multiple myeloma with reovirus.

Introduction

Multiple myeloma is a clonal neoplasm of plasma cells that accounts for approximately 10% of all hematological malignancies (1). The incidence of multiple myeloma has doubled in the last 5 decades (2), with a current actuarial average of 17 years life lost per diagnosis (3). Despite recent advances in the understanding of multiple myeloma biology and the availability of newer therapeutics such as thalidomide, revlimid, and bortezomib, which have improved responses and survival (4), the disease remains incurable and treatment resistance/toxicities associated with these agents ultimately result in patient demise (5, 6). Thus, it is imperative to find novel, more effective, better-tolerated therapeutics for multiple myeloma and of equal importance is the elucidation of these novel therapeutics mechanisms of action.

Oncolytic viruses are a group of therapeutics that exhibit an extensive spectrum of anticancer activity with minimal human toxicity. One such virus, the reovirus, is an ubiquitous, non-enveloped double-stranded RNA virus with negligible pathogenicity in humans (7). The reovirus's extensive preclinical efficacy has been documented by our group and others and it is presently undergoing phase III clinical trial testing for head and neck tumors. The viral sensitivity of a wide array of tumor histologies is possibly mediated via multiple permissive oncogenic signaling pathways that allow the reovirus to target malignancies while sparing normal cells (8–10). Thus, the “oncogenic addiction” of multiple myeloma associated with its survival and proliferation creates an environment conducive to reovirus therapy.

Recently, it has been shown that mutated ras and constitutively active Akt delineate distinctive oncogenic pathways in this malignancy, which independently contributes to multiple myeloma survival (11). Activating mutations in the ras gene family are common in multiple myeloma, with N- and K-ras mutations being the most frequent (12, 13). In addition, multiple other cancer-promoting signaling pathways have been shown to be active in multiple myeloma such as the MEK/ERK, phosphoinositide 3-kinase (PI3K)/Akt, mTOR/p70S6-kinase, and NF-kB pathways (14–16) that may be permissive to reovirus lytic infection, thereby increasing the spectrum of potentially treatable patients. In susceptible tumor cells, reovirus is thought to exploit these activated neoplastic signaling pathways in a p53-independent/-dependent manner (17, 18) and involves NF-kB activation/trafficking (17, 19), autocrine release of the TNF-related apoptosis-inducing ligand (TRAIL; refs. 20, 21), and activation of endoplasmic reticular (ER) stress (22).

To date, only 2 studies have examined the preclinical effects of reovirus on multiple myeloma. Our group has previously shown the ability of the reovirus to purge multiple myeloma successfully during autologous transplantations (23) and Kelly and colleagues (22) have investigated the potential of using reovirus in combination therapy with bortezomib on subcutaneous multiple myeloma tumor established in a murine model as well as in a 5TGM1 syngeneic murine system. Although there is a lack of consensus about the best in vivo preclinical model of multiple myeloma, that is, immunocompetent syngeneic or human xenograft murine model or fetal bone marrow (BM) implant-multiple myeloma xenograft (SCID-hu), a relatively straightforward intravenous/intracardiac approach to the delivery of multiple myeloma should be considered. Subcutaneous models fail to consistently home to the bone marrow (22), and murine multiple myeloma cell lines involved in syngeneic models fail to authentically replicate human genetic lesions/aberrations found in human multiple myeloma. The SCID-hu model, although it mimics the human BM environment, does not produce disseminated disease as seen in advanced human multiple myeloma.

To represent clinical relevance, it is imperative to study the effects of reovirus given systemically on human multiple myeloma in vivo in the BM microenvironment. In this study, we showed the oncolytic potential of the reovirus against a large cohort of human multiple myeloma cell lines (HMCL) and ex vivo patient specimens and provide evidence that intravenous treatment of reovirus is effective in targeting disseminated human multiple myeloma in vivo and that reovirus exposure does not abrogate human hematopoietic stem cell re-population/differentiation in the BM compartment. This is the first report to show the efficacy of reovirus targeting of human multiple myeloma in the BM milieu and human stem cell re-population post-reovirus treatment in an in vivo setting, and thus support the rapid translation of preclincial data to a future phase I clinical trial. In addition to confirming that reovirus orchestrates cells death via apoptosis, we showed for the first time that reovirus infection of multiple myeloma leads to the modulation of autophagy which is of further clinical relevance as understanding mechanisms of reovirus oncolysis of multiple myeloma will lead to optimal use of this therapeutic, especially for the treatment of therapy-resistant disease.

Materials and Methods

Cell lines

RPMI 8226, U266, MM1S, and H929 were obtained from the American Type Culture Collection (ATCC, Virginia). OPM2 was obtained from the German collection of microorganisms and cell cultures (Braunschweig, Germany). KMS-11, INA-6, and RPMI 8226 GFP+ cells were kindly provided by Drs. Irene Ghobrial (Dana Farber Cancer Institute, Boston, MA), Renate Burger (University of Erlangen-Nuernberg, Erlangen, Germany), and Linda Pilarsky (University of Alberta, Canada), respectively. RPMI 8226, U266, MM1S, H929, KMS11, and OPM2 were maintained in RPMI1640 medium (Gibco BRL) containing 10% FBS. In addition, the medium was supplemented with either G148 (100 μg/mL), interleukin 6 (IL-6; 2.5 ng/mL), or 0.05 mmol/L 2-mercaptoethanol for RPMI 8226 GFP+, INA-6, and H929 cells, respectively. Multiple myeloma primary tumor cells were obtained from BM aspirate/biopsies. Diagnosis was based on histopathology, immunohistochemistry, and immunophenotype. All procedures involving patients were approved by the Conjoint Health Research Ethics Board, University of Calgary, Calgary, Alberta, Canada.

Reovirus

Reovirus serotype 3 (strain Dearing) was propagated in L929 cells and purified as previously described (10). Human multiple myeloma cells lines (HMCL) grown to subconfluence were infected with either no virus (NV), live reovirus (LV), or UV-inactivated reovirus (dead reovirus, DV) at a multiplicity of infection (MOI) of 40 plaque-forming units (PFU)/cell for 24, 48, and 72 hours. Reovirus cytotoxicity was monitored using the WST-1 (4-[3-(4-Iodophenyl)-2-(4-nitrophenyl)-2H-5-tetrazolio]-1,3-benzene disulfonate) assay (24). Similarly, patient BM samples that were found to contain more than 3% multiple myeloma cells were washed in PBS and cultured in RPMI1640 medium containing 20% FBS and antibiotics and exposed to 40 or 100 MOI of LV or DV for 24 hours. The higher reovirus MOI was used as the marrow samples were not enriched for the multiple myeloma cells, thus diluting the effective concentration of reovirus.

Flow cytotmetric analysis of apoptosis and autophagy

HMCLs were infected with either 40 MOI of DV, LV, or NV for 24, 48, and 72 hours and harvested. Following centrifugation, the cell pellets were washed in PBS twice before subsequent staining with propidium iodide (PI)/RNase A or Annexin-V-Alexa Fluor 488 (A13201; Invitrogen)/7AAD (A07704; Beckman Coulter) as previously described (10). Flow cytometric analysis was carried out to assess DNA fragmentation and phosphatidyl serine expression using a Navios flow cytometer (Beckman Coulter) and FCS Express software (De Novo Software).

For caspase inhibition, cells were pretreated with Z-VAD-FMK-001 (R&D systems), 50 μmol/L for 1 hour before infection with reovirus. Harvested cells were stained for rabbit anti-active caspase 3 V450 (Becton Dickinson Biosciences) using Beckman Coulter's IntraPrep intracellular staining kit according to the manufacturer's instructions. Autophagy was detected using the Cyto-ID Autophagy detection kit (ENZ-51031-k200; Enzo Life Sciences) in NV-, DV-, or LV-treated RPMI 8226 cells at 0, 24, and 48 hours. An autophagy inhibitor, 3-MA (SC-205596; Santa Cruz), was added to cells at 10 mmol/L for 1 hour before infection with reovirus. To identify vesicles colocalizing with LC3-II, a marker of autophagosomes, 1 × 106 cells were centrifuged and resuspended in 1 mL of Assay Buffer. Then, 0.5 mL of a 1:2,000 dilution of the Cyto-ID Green Detection Reagent was added to the cell suspension, and the mixture was incubated at 37°C for 30 minutes in the dark and analyzed immediately in the LFL1 detector.

Apheresis product and reovirus effects on human CD34+ stem cells

All apheresis products (AP) used in the present study were obtained from patients registered at the Tom Baker Cancer Centre, Calgary, Canada, after informed consent. AP cells were washed in PBS and treated with ammonium chloride for 10 minutes to induce lysis of red blood cells. Mononuclear cells resuspended in Robosep buffer (cat # 20104; Stem Cell Technologies) were depleted of lineage-committed cells using the Robosep automated immunomagnetic cell-separation system (cat # 20000; Stem Cell Technologies). The RoboSep progenitor enrichment antibody cocktail (Catalog # 18056; Stem Cell Technologies) was used to enrich for CD34+ cells. The isolated cells were seeded at a density of 2 to 3 × 103/mL in StemSpan SFEM (Stem Cell Technologies) containing cytokines and growth factors (23) and then incubated in the presence of LV or DV (40 MOI) for 72 hours at 37°C in a humidified incubator with 5% CO2. Harvested cells were assayed for viability and purity (CD34+ and CD45+ cells) using flow cytometry as previously described (23). We have previously shown no significant difference between DV and NV treatments (23, 25) in different tumors as well as CD34+ stem cells and AP. Therefore, DV was selected as the most stringent control for all reovirus experiments.

PCR for detection of human “Alu” sequences

To confirm “human cell” re-population in vivo, DNA was isolated from mouse blood and BM using QIAamp DNA mini kits (Qiagen) and PCR was carried out against human-specific “Alu” primers (AAGTCGCGGCCGCTTGCAGTGAGCCGAGAT; ref. 26). The PCR product was separated in 2% agarose gels containing ethidium bromide and “human Alu” bands were visualized.

Animals

Six- to 8-week-old female severe combined immune deficient/non-obese diabetic (SCID/NOD) mice were purchased from Jackson Laboratories, Bar Harbor, Maine. The animals were housed in a biocontainment animal facility and provided food and water ad libitum. All procedures were reviewed and approved by the University of Calgary Animal Care Committee.

Evaluation of reovirus efficacy in human multiple myeloma under in vivo settings

Twelve SCID/NOD mice were sublethally irradiated (1.25 Gy total body γ-irradiation from a 137Cs source) and administered an intraperitoneal injection of 50 μL of anti-asialo GM1 antibody for elimination of natural killer (NK) cells. Mice were injected with 2.5 × 106 RPMI 8226-GFP+ cells via tail vein for tumor establishment. On day 7, mice in 2 groups were given a single injection of either LV or DV (1 × 107 PFU) intravenously. Animals were assessed for weight loss, grooming performance, and signs of visible tumor 3 times per week. On day 35, when animals exhibited greater than 20% weight loss or required euthanasia, all animals were sacrificed and assessed for multiple myeloma disease prevalence.

Sacrificed animals were subjected to whole-body fluorescence imaging for detection of GFP+ multiple myeloma lesions in the skeleton and subcutaneous tissues. Liver, spleen, lung, brain, heart, small, and large intestines were analyzed for metastatic deposits by GFP fluorescence. Femurs from animals were flushed in PBS + 10% FBS and the collected BM cells were analyzed for GFP +/CD38+/138+ staining.

Human stem cell re-populating ability in vivo

Sixteen NOD/SCID mice were sublethally irradiated and treated with anti-asialo GM1 antibody as described above. Animals were divided into 3 groups, and the first 2 groups (n = 6) were administered 200 μL of LV- or DV-treated CD34+ stem cells (1–5 × 106, isolated from patient AP) mixed with 2 × 105 of AP cells that have been impaired for proliferation through irradiation (2 Gy; carrier cells) via the tail vein. The 3rd group (n = 4) was given only carrier cells (2 × 105). To prevent reovirus-related morbidity and inflammatory vasculitis in the extremities seen in immunocompromised animals beyond day 30 (never seen in nude mice or immunocompetent mice), all animals were treated with purified polyclonal rabbit antireovirus serum (100 μg, tail vein) on days 14, 21, and 28. Body weights and grooming abilities of animals were recorded. On days 25 and 40, 3 animals in each group were subjected to cardiac puncture, and peripheral blood was collected in tubes containing heparin (Sigma-Aldrich). Femurs and tibia were removed from the sacrificed mice and BM cells were flushed out into saline and combined for each mouse. Using a CD45/LSS gating strategy and a CD19 gate, harvested BM and blood were immunophenotyped by flow cytometry with the following 2- and 5-color antibody combinations: CD45/CD34, CD8/CD4/CD45/CD16+56/CD3, Kappa/Lambda/CD19/CD5/CD20, and CD64/CD13/CD45/CD33/CD16 (Beckman Coulter).

Statistical Analysis

All analyses were carried out using the statistical software program R (Boston, MA; ref. 27). For the WST assay experiments, 3 independent experiments were carried out with each cell line in triplicate. The resulting colorimetric readings were averaged and background readings were subtracted to provide the corresponding number of viable cells. The data is presented as the mean with their 95% confidence intervals (CI).

To assess reovirus treatment on multiple myeloma tumor, harvested tumor from DV- and LV-treated animals was subjected to an exact Wilcoxon Mann–Whitney Rank Sum test, a nonparametric, robust alternative to the 2 sample t-test, appropriate when data may be non-normally distributed. To explore the significance of reovirus-induced DNA fragmentation and annexin V expression, we calculated 2-factor Analysis of Variance (ANOVA) models within each of the 3 cell lines. Levene's test for variance homogeneity based on the median values was used to check this assumption.

To confirm caspase and autophagy activation during reovirus infection of multiple myeloma, DV- and LV-treated multiple myeloma cells with and without caspase and autophagy inhibitors were also compared using their mean and 95% CIs, with planned t-test comparisons for specific questions of interest.

Results

Reovirus sensitivity of HMCLs and ex vivo specimens

All HMCLs displayed significant sensitivity toward reovirus, showing less than 12% viability at 72 hours, except for OPM2 (Fig. 1A). Reovirus sensitivity could not be correlated with immunoglobulin H (IgH) translocations or ras mutational status of HMCLs (Supplementary Table S1). Interestingly, the only reovirus-resistant HMCL, OPM2, harbored a PTEN mutation.

Figure 1.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 1.

A, HMCL cells were cultured in the presence of live (LV) or dead (DV) reovirus (40 MOI) and vialbility assesed via the WST assay at 48 and 72 hours. Data represent the mean ± 95% CI of 3 independent experiments. B, effect of reovirus on multiple myeloma (MM) patient specimens. Patient MM tumor from bone marrow aspirates was cultured in the presence of LV or DV. After 24 hours of virus exposure, cell viability (CD 138+56+) was assessed using flow cytometry. C, representative flow cytometric scatterplots of a reovirus sensitive, moderately sensitive, and resistant patients.

When reovirus sensitivity on ex vivo patient-derived tumor was investigated, 5 out of 7 patient multiple myeloma cells exhibited reovirus sensitivity, highlighting its potential to be used as a systemic therapeutic (Fig. 1B). It was difficult to grow the ex vivo tumor in RPMI medium beyond 48 hours and, therefore, only data for 24 hours are presented. Supplementary Table S2 presents data indicating that reovirus sensitivity does not correlate with the prognostic characteristics of the 7 patient tumors [individual t(4:14), 13q(-) and TP53]. Flow cytometric scatterplots representative of sensitive, moderately sensitive, and resistant patients are shown in Fig. 1C.

Reovirus oncolysis is mediated through apoptosis

To investigate the mechanism of reovirus-mediated cell death, RPMI8226, NCI-H929, U266, and OPM2 cells were treated with DV or LV and assessed for apoptosis. All 3 reovirus-sensitive HMCLs exposed to LV showed significantly elevated features of apoptosis compared with DV-treated cells (i.e., membrane phosphatidyl serine flipping and DNA fragmentation). Significant temporal changes on DNA fragmentation with LV treatment were seen in all 3 HMCLs (F-tests for interaction; P-values < 0.01; Fig. 2A) and in annexin V binding in U266 cells (P < 0.006; Fig. 2B). Significant differences were seen between LV and DV at all time points in RPMI8226 and NCI-H929 cells (F-tests for treated cells; P < 0.0001); these collective results confirm the presence of reovirus oncolysis.

Figure 2.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 2.

HMCLs were exposed to 40 MOI of LV or DV for 24, 48, and 72 hours and apoptosis was assayed. A, DNA fragmentation assessed by PI inorporation using flow cytometry. B, AnnexinV and 7AAD expression in DV- and LV-treated HMCLs. C, Annexin V expression by flow cytometry for the multiple myeloma (MM) cell lline U266.

Figure 2C represents flow cytometric analysis of U266 apoptosis with nearly 90% of the LV-treated cells showing annexin V and 7-AAD positivity by 72 hours. In significant contrast to these HMCLs, no evidence of any apoptotic activity was detected in reovirus-resistant OPM2 when treated with either LV or DV (data not shown). To confirm that reovirus-induced apoptosis is mediated via terminal caspase 3, multiple myeloma cells were treated with caspase inhibitor Z-VAD-FMK-001 and DNA fragmentation was assessed. As depicted in Figs. 3A and B, treatment with Z-VAD-FMK-001 led to a significant downregulation of fragmented DNA in the sub-G0/G1 peak in LV-treated cells at 24 hours (t-test P = 0.0012).

Figure 3.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 3.

A and B, caspase inhibition leads to inhibition of DNA fragmentation caused by reovirus. RPMI 8226 cells were pretreated with Z-VAD-FMK-001, 50 μmol/L for 1hour before infection with 40 MOI of DV, LV, or No virus (NV) for 0 and 24 hours. Harvested cells were assayed for DNA fragmentation using flow cytometry. Flow cytometric scatterplots (A), % DNA fragmentation, mean (n = 3) ± SE (B). C, reovirus infection modulates autophagy in human meyloma. RPMI 8226 cells were infected with 40 MOI of DV or LV for 0, 24, and 48 hours. Harvested cells were stained with Cyto-ID and assayed for LC3-II colocalization to the autophagosomes by using flow cytometry. D, 3-MA treatment suppresses reovirus-induced autophagy in human meyloma. RPMI 8226 cells were pretreated with 10 mmol/L of autophagy inhibitor 3-MA for 1 hour before infection with 40 MOI of DV, LV, or No virus (NV) for 0, 24, and 48 hours. Harvested cells were stained with Cyto-ID and assayed for LC3-II expression using flow cytometry. Bars represent percentage changes in median channel fluorescence relative to the NV controls, mean (n = 3) ± SE.

Reovirus modulates autophagy induction in multiple myeloma

Although apoptosis induction was prominent in reovirus-infected HMCLs, complete reovirus oncolysis could not be attributable to this process. We, therefore, examined autophagy involvement post-reovirus infection of myeloma. Autophagy activity was similar in DV- and LV-treated RPMI 8226 cells at 0 hours (Fig. 3C). Autophagy induction was evident at 24 hours in LV-treated cells and, at 48 hours, this was more pronounced with a distinctive shift in median channel fluorescence of stained cells with Cyto-ID. To confirm the autophagy process, we treated RPMI 8226 cells with autophagy inhibitor 3-MA and verified autophagy activity post virus infection. Distinct temporal increases in autophagy induction were evident in LV-treated cells in comparison to DV-treated cells (Fig. 3D). Treatment with 3-MA considerably downregulated this increase in autophagy caused by LV, resulting in a 4-fold reduction by 48 hours, thus indicating that autophagy might also contribute to cell death.

Intravenous reovirus treatment successfully targets disseminated human multiple myeloma

To explore whether intravenous reovirus treatment would target disseminated human multiple myeloma in a mouse model, animals in 2 groups with established disease were treated with a single intravenous injection of DV or LV. All of the 6 mice injected with DV showed symptoms of malignancy (weight loss, neurological deficits, etc.) beyond days 20 and, therefore, all animals were sacrificed at day 35. Multiple GFP + multiple myeloma lesions were seen in 5 out of 6 DV-treated mice (Fig. 4A), with the majority of lesions seen in the axial skeleton, skull, and plasmacytoma-like lesions. In contrast, 4 of the 6 mice treated with LV appeared to be disease free with no visible GFP+ lesions detected. Comparison of total tumor weights between the 2 groups of mice showed significant differences (P = 0.05, exact Mann–Whitney Rank Sum test; Fig. 4B). Mouse BM analyzed for GFP+/CD38+/CD138+ multiple myeloma cells showed tumor in 5 of 6 DV-treated mice and only in 1 LV-treated mouse (Table 1). Figure 4C presents the flow cytometric scatterplots of 2 mice from each group that showed the highest amount of tumor burden in BM. The tumor burden seen in DV-treated mouse was >10-fold than that of the only LV-treated mouse detected with human multiple myeloma in BM. These mice were treated only with a single injection of reovirus and, if multiple LV injections were given, complete eradication of disease would be anticipated.

Figure 4.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 4.

Systemic reovirus treatment targets disseminated human myeloma in vivo. RPMI 8226-GFP cells were injected into sublethally irradiated NOD/SCID mice and treated with a single intravenous injection of DV of LV (1 × 107 PFU). A, sacrificed mice were monitored for whole-body fluorescene of GFP+ multiple myeloma (MM) lesions. B, tumor collected from animals were analyzed for statistical differences, mean (n = 6) ± SE. C, bone marrow collected from mice was anlyzed for GFP+ MM cells by flow cytometry.

View this table:
  • View inline
  • View popup
Table 1.

Reovirus treatment abrogates human multiple myeloma dissemination in mouse bone marrow or in vivo

Reovirus exposure of human CD34+ hematopoietic stem cells does not abrogate re-population/differentiation in mice

Mice of both groups (DV- or LV-treated) showed human stem cell re-population at 25 to 30 days post infusion (Fig. 5A). In addition, DV- or LV-treated stem cells showed lineage differentiation in mouse BM. As lymphoid differentiation preceeds myeloid differentiation, the majority of differentiated cells were noted to be of the myeloid lineage as expected. In significant contrast to LV- or DV-treated stem cells-infused mice, no human stem cells were seen in mouse BM in recipients that received carrier cells alone (Figs. 5A and 5B). To further confirm the presence of human cells, DNA was extracted from mouse BM and blood. PCR conducted against human “Alu” sequences confirmed human cell re-population only in animals that received DV- or LV-treated stem cells. (Fig. 5C).

Figure 5.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 5.

Reovirus treatment does not abrogate hematopoitic engraftment in mice. Human CD34+ stem cells were isolated from AP and treated with LV or DV up to 72 hours. 1 to 5 × 106 CD34+cells were mixed with carrier cells and injected into sublethally irradiated SCID/NOD mice. A, mouse bone marrow was harvested and analyzed for human hematopoitic stem cells enumeration using flow cytometry. B, evidence of differentiation by flow cytometric immunophenotyping carried out on leukocyte populations from representative animals treated with carrier cells, DV or LV treatment. C, DNA was extracted from blood and BM of animals that received human CD34+ stem cells treated with DV or LV or from mice that received only carrier cells. PCR was carried out for human “Alu” sequences.

Discussion

The present study evaluated reovirus as a viable option for systemic therapy of human multiple myeloma. The broad-spectrum activity of reovirus on HMCLs was confirmed under in vitro conditions where 6 of the 7 HMCLs showed sensitivity to reovirus. Four of these harbored ras mutations, but this alone was not predictive of virus oncolysis, as U266 and KMS11 were ras wild type. Interestingly, only OPM2 harbored a PTEN mutation and was reovirus resistant. Testing of 3 reovirus-sensitive HMCLs confirmed that cell death is manifested through apoptosis (annexin V expression and DNA fragmentation) and corroborate our previous findings with breast and prostate cancer (10, 17). Inhibition of caspase 3 with Z-VAD-FMK-001 significantly reduced DNA fragmentation induced by reovirus confirming the active role of caspase 3 in reovirus-induced apoptosis.

The novel finding that reovirus infection of multiple myeloma leads to significant induction of autophagy, a catabolic process involved in routine turnover of proteins and intracellular organelles is of interest (28). Reovirus infection of RPMI8226 cells lead to a time-dependent increase in autophagy and this was suppressed by 3-MA, a specific inhibitor of autophagy. Although autophagy could serve a dual purpose, either to protect against cancer or contribute to cancer by promoting the survival of nutrient-starved cells (29), many studies have indicated its role as a pro-death pathway post treatment (30–35). Several lines of evidence indicate that ER stress leads to autophagy (36–38), and recent studies have highlighted a prominent role between autophagic cell death induced by Akt–mTOR signaling triggered by ER stress (37, 38). Recently, Kelly and colleagues (22) showed that reovirus infection of multiple myeloma leads to ER–stress-induced apoptosis. Therefore, it is plausible to hypothesize that viral replication within multiple myeloma, in addition to induction of apoptosis, also promotes auotphagic cell death initiated via a signaling mechanism of the ER stress pathway.

Analysis of reovirus-treated multiple myeloma ex vivo tumors revealed that reovirus sensitivity is not restricted to multiple myeloma cancer cell lines in vitro. Further, 5 of the 7 samples showed sensitivity to reovirus, highlighting the applicability of this virus as a possible systemic therapeutic strategy. A more robust assessment of reovirus efficacy is to examine its ability to target disseminated multiple myeloma under in vivo conditions. All DV-treated mice showed signs of disease and required euthanasia due to tumor burden; however, 5 of the 6 mice treated with LV maintained health for the duration of the experiment (35 days). Mice treated with DV showed evidence of GFP+ lesions in bone including the appendicular and axial skeletons, mimicking the osteotropic nature of multiple myeloma in patients. Mice showing hind-leg paralysis was likely due to vertebral bone lesions and spinal cord involvement, which was the primary reason for euthanization. In addition to the multiple myeloma tumor detected in the bodies of animals, multiple myeloma tumor homing to the bone marrow milieu was confirmed with human multiple myeloma detection in 5 of the 6 mice subjected to DV treatment. In comparison, a single injection of 1 × 107 PFU of reovirus was able to target bone marrow infiltration of multiple myeloma in 5 of the 6 mice, highlighting its potential as a systemic agent. We hypothesize that multiple injections of reovirus would completely irradicate disease, but our NOD/SCID/irradiated/NK cell-depleted model does not support multiple reovirus injections due to development of vasculitis beyond day 25.

Another important objective of this study was to prove that reovirus treatment does not abrogate human stem cell re-population and differentiation in vivo. Previously, we have shown negligible adverse effects of reovirus on purified CD34+ human stem cells or AP under in vitro conditions (23, 25). Human stem cells isolated from AP, treated with LV for 3 days, and transplanted into NOD/SCID mice showed similar re-population and lineage differentiation in comparison to the DV controls. In contrast, control mice that received only carrier cells did not show human stem cell engraftment. Flow cytometric analysis of mouse bone marrow showed distinct CD45 + leukocyte and CD45+34+ human stem cell clusters in all DV- or LV-treated mice. The CD45+34+ stem cells were viable as shown by the lack of staining with the viability dye, 7-AAD. CD45-positive cells in the CD45dim (Blast), monocyte (Mono), and granulocyte (Gran) regions showed mainly myeloid lineage commitment on the basis of their co-expression of CD13 and CD33. Additional myelomonocytic lineage-associated markers, including CD64 and CD4dim, were expressed on CD13/33+ cells in the monocyte and granulocyte regions. Cells in the lymphocyte gate (Lymp) did not show expression of any antigens other than CD45, confirming that myeloid differentiation precedes lymphoid differentiation.

To further confirm that cells of human origin were present in mice, DNA extracted from blood and BM of LV- and DV-treated mice was subjected to PCR to detect human specific “Alu” sequences. Indications of “Alu” sequences were identified only in mice that received human CD 34+ cells (irrespective of their treatment) and not in control mice or commercially available mouse DNA, further confirming the capability of the reovirus as a successful systemic agent to treat human multiple myeloma.

The reovirus fulfils many of the attributes of a viable treatment option for multiple myeloma: selective targeting of disease without affecting the stem cell compartment, enhanced efficacy, and relative ease of manufacturing and storage. Reovirus is not associated with toxicities in immunocompetent animals nor in the over 560 patients treated with reovirus to date.

In conclusion, this study represents the first utilization of reovirus as a clinically relevant systemic agent for the treatment of human multiple myeloma that could lead to rapid bench-to-bedside translation. In an era where a personalized approach to medicine is sought, multiple myeloma may represent a malignancy where bone marrow aspirates could easily be withdrawn from patients and tested for reovirus sensitivity before initiating a treatment regimen. In addition, this study constitutes a framework for the possible extension of these findings to other hematological malignancies as well.

Disclosure of Potential Conflicts of Interest

No conflicts of interest were disclosed.

Authors' Contributions

Conception and design: C. M. Thirukkumaran, D. Morris

Development of methodology: C. M. Thirukkumaran, Z. Q. Shi, J. Luider, D. Morris

Acquisition of data: C. M. Thirukkumaran, Z. Q. Shi, J. Luider, N. J. Bahlis, P. Neri, D. Stewart, A. Mansoor, D. Morris

Analysis and interpretation of data: C. M. Thirukkumaran, Z. Q. Shi, K. Kopciuk, H. Gao, N. J. Bahlis, P. Neri, D. Morris

Writing, review, and/or revision of the manuscript: C. M. Thirukkumaran, Z. Q. Shi, J. Luider, K. Kopciuk, D. Stewart, A. Mansoor, D. Morris

Administrative, technical, or material support: C. M. Thirukkumaran, Z. Q. Shi, M. Pho, A. Mansoor

Study supervision: C. M. Thirukkumaran, D. Morris

Grant Support

This study was financially supported by grants to DM and CMT from the Alberta Cancer Research Institute (grant number 51797906058).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Acknowledgments

The authors acknowledge the Southern Alberta Bone Marrow Transplant Unit and the Apheresis Unit/Blood Bank of the Foothills Medical Centre for their support of this study.

Footnotes

  • Note: Supplementary data for this article are available at Clinical Cancer Research Online (http://clincancerres.aacrjournals.org/).

  • Received December 2, 2011.
  • Revision received June 8, 2012.
  • Accepted June 13, 2012.
  • ©2012 American Association for Cancer Research.

References

  1. 1.↵
    1. Palumbo A,
    2. Attal M,
    3. Roussel M
    . Shifts in the therapeutic paradigm for patients newly diagnosed with multiple myeloma: maintenance therapy and overall survival. Clin Cancer Res 2011;17:1253–63.
    OpenUrlAbstract/FREE Full Text
  2. 2.↵
    1. Turesson I,
    2. Velez R,
    3. Kristinsson SY,
    4. Landgren O
    . Patterns of multiple myeloma during the past 5 decades: stable incidence rates for all age groups in the population but rapidly changing age distribution in the clinic. Mayo Clin Proc 2010;85:225–30.
    OpenUrlCrossRefPubMed
  3. 3.↵
    1. Ludwig H,
    2. Bolejack V,
    3. Crowley J,
    4. Blade J,
    5. Miguel JS,
    6. Kyle RA,
    7. et al.
    Survival and years of life lost in different age cohorts of patients with multiple myeloma. J Clin Oncol 2010;28:1599–605.
    OpenUrlAbstract/FREE Full Text
  4. 4.↵
    1. Anderson KC
    . The 39th David A. Karnofsky Lecture: bench-to-bedside translation of targeted therapies in multiple myeloma. J Clin Oncol 2012;30:445–52.
    OpenUrlAbstract/FREE Full Text
  5. 5.↵
    1. Kumar L,
    2. Verma R,
    3. Radhakrishnan VR
    . Recent advances in the management of multiple myeloma. Natl Med J India 2010;23:210–8.
    OpenUrlPubMed
  6. 6.↵
    1. Mitsiades CS,
    2. Davies FE,
    3. Laubach JP,
    4. Joshua D,
    5. San MJ,
    6. Anderson KC,
    7. et al.
    Future directions of next-generation novel therapies, combination approaches, and the development of personalized medicine in myeloma. J Clin Oncol 2011;29:1916–23.
    OpenUrlAbstract/FREE Full Text
  7. 7.↵
    1. Fields BN,
    2. Knipe DM
    1. Tyler KL,
    2. Fielsd BN
    . Reoviruses. In: Fields BN, Knipe DM , editors. Fields virology. Philadelphia: Lippincott-Raven; 1996. p1597–623.
  8. 8.↵
    1. Strong JE,
    2. Coffey MC,
    3. Tang D,
    4. Sabinin P,
    5. Lee PW
    . The molecular basis of viral oncolysis: usurpation of the Ras signaling pathway by reovirus. EMBO J 1998;17:3351–62.
    OpenUrlAbstract/FREE Full Text
  9. 9.↵
    1. Norman KL,
    2. Hirasawa K,
    3. Yang AD,
    4. Shields MA,
    5. Lee PW
    . Reovirus oncolysis: the Ras/RalGEF/p38 pathway dictates host cell permissiveness to reovirus infection. Proc Natl Acad Sci USA 2004;101:11099–104.
    OpenUrlAbstract/FREE Full Text
  10. 10.↵
    1. Thirukkumaran CM,
    2. Nodwell MJ,
    3. Hirasawa K,
    4. Shi ZQ,
    5. Diaz R,
    6. Luider J,
    7. et al.
    Oncolytic viral therapy for prostate cancer: efficacy of reovirus as a biological therapeutic. Cancer Res 2010;70:2435–44.
    OpenUrlAbstract/FREE Full Text
  11. 11.↵
    1. Steinbrunn T,
    2. Stühmer T,
    3. Gattenlöhner S,
    4. Rosenwald A,
    5. Mottok A,
    6. Unzicker C,
    7. et al.
    Mutated RAS and constitutively activated Akt delineate distinct oncogenic pathways, which independently contribute to multiple myeloma cell survival. Blood 2011;117:1998–04.
    OpenUrlAbstract/FREE Full Text
  12. 12.↵
    1. Portier M,
    2. Moles JP,
    3. Mazars GR,
    4. Jeanteur P,
    5. Bataille R,
    6. Klein B,
    7. et al.
    p53 and RAS gene mutations in multiple myeloma. Oncogene 1992;7:2539–43.
    OpenUrlPubMed
  13. 13.↵
    1. Liu P,
    2. Leong T,
    3. Quam L,
    4. Billadeau D,
    5. Kay NE,
    6. Greipp P,
    7. et al.
    Activating mutations of N- and K-ras in multiple myeloma show different clinical associations: analysis of the Eastern Cooperative Oncology Group Phase III Trial. Blood 1996;88:2699–706.
    OpenUrlAbstract/FREE Full Text
  14. 14.↵
    1. Younes H,
    2. Leleu X,
    3. Hatjiharissi E,
    4. Moreau AS,
    5. Hideshima T,
    6. Richardson P,
    7. et al.
    Targeting the phosphatidylinositol 3-kinase pathway in multiple myeloma. Clin Cancer Res 2007;13:3771–5.
    OpenUrlAbstract/FREE Full Text
  15. 15.↵
    1. Cirstea D,
    2. Hideshima T,
    3. Rodig S,
    4. Santo L,
    5. Pozzi S,
    6. Vallet S,
    7. et al.
    Dual inhibition of akt/mammalian target of rapamycin pathway by nanoparticle albumin-bound-rapamycin and perifosine induces antitumor activity in multiple myeloma. Mol Cancer Ther 2010;9:963–75.
    OpenUrlCrossRef
  16. 16.↵
    1. Bazzi M,
    2. Badros A
    . Multiple myeloma: implementing signalling pathways and molecular biology in clinical trials. Cancer Biol Ther 2010;10:830–8.
    OpenUrlCrossRefPubMed
  17. 17.↵
    1. Thirukkumaran C,
    2. Shi ZH,
    3. Spurrell J,
    4. Thirukkumaran P,
    5. Morris D
    . Breast cancer oncolysis by reovirus is mediated through upregulation of PUMA and NF-kB proteins of the apoptotic signalling pathway [abstract]. In: Proceedings of the 98th Annual Meeting of the American Association for Cancer Research; 2007 Apr 14-18; Los angeles, CA: AACR;2007. Abstract nr 1929.
  18. 18.↵
    1. Pan D,
    2. Pan LZ,
    3. Hill R,
    4. Marcato P,
    5. Shmulevitz M,
    6. Vassilev LT,
    7. et al.
    Stabilisation of p53 enhances reovirus-induced apoptosis and virus spread through p53-dependent NF-kappaB activation. Br J Cancer 2011;105:1012–22.
    OpenUrlCrossRefPubMed
  19. 19.↵
    1. Connolly JL,
    2. Rodgers SE,
    3. Clarke P,
    4. Ballard DW,
    5. Kerr LD,
    6. Tyler KL,
    7. et al.
    Reovirus-induced apoptosis requires activation of transcription factor NF-kappaB. J Virol 2000;74:2981–9.
    OpenUrlAbstract/FREE Full Text
  20. 20.↵
    1. Clarke P,
    2. Meintzer SM,
    3. Gibson S,
    4. Widmann C,
    5. Garrington TP,
    6. Johnson GL,
    7. et al.
    Reovirus-induced apoptosis is mediated by TRAIL. J Virol 2000;74:8135–9.
    OpenUrlAbstract/FREE Full Text
  21. 21.↵
    1. Clarke P,
    2. Meintzer SM,
    3. Spalding AC,
    4. Johnson GL,
    5. Tyler KL
    . Caspase 8-dependent sensitization of cancer cells to TRAIL-induced apoptosis following reovirus infection. Oncogene 2001;20:6910–9.
    OpenUrlCrossRefPubMed
  22. 22.↵
    1. Kelly KR,
    2. Espitia C,
    3. Mahalingam D,
    4. Oyajobi BO,
    5. Coffey M,
    6. Giles FJ,
    7. et al.
    Reovirus therapy stimulates endoplasmic reticular stress, NOXA induction, and augments bortezomib-mediated apoptosis in multiple myeloma. Oncogene 2011;1–16.
  23. 23.↵
    1. Thirukkumaran CM,
    2. Luider JM,
    3. Stewart DA,
    4. Cheng T,
    5. Lupichuk SM,
    6. Nodwell MJ,
    7. et al.
    Reovirus oncolysis as a novel purging strategy for autologous stem cell transplantation. Blood 2003;102:377–87.
    OpenUrlAbstract/FREE Full Text
  24. 24.↵
    1. Cejkova S,
    2. Rocnova L,
    3. Potesil D,
    4. Smardova J,
    5. Novakova V,
    6. Chumchalova J,
    7. et al.
    Presence of heterozygous ATM deletion may not be critical in the primary response of chronic lymphocytic leukemia cells to fludarabine. Eur J Haematol 2009;82:133–42.
    OpenUrlCrossRefPubMed
  25. 25.↵
    1. Thirukkumaran CM,
    2. Luider JM,
    3. Stewart DA,
    4. Alain T,
    5. Russell JA,
    6. Auer IA,
    7. et al.
    Biological purging of breast cancer cell lines using a replication-competent oncolytic virus in human stem cell autografts. Bone Marrow Transplant 2005;35:1055–64.
    OpenUrlCrossRefPubMed
  26. 26.↵
    1. Nelson DL,
    2. Ledbetter SA,
    3. Corbo L,
    4. Victoria MF,
    5. Ramirez-Solis R,
    6. Webster TD,
    7. et al.
    Alu polymerase chain reaction: a method for rapid isolation of human-specific sequences from complex DNA sources. Proc Natl Acad Sci U S A 1989;86:6686–90.
    OpenUrlAbstract/FREE Full Text
  27. 27.↵
    R: A Language and Environment for Statistical Computing [program]. 2.11 version. Vienna: R Foundation for Statistical Computing, 2011.
  28. 28.↵
    1. Liu YL,
    2. Yang PM,
    3. Shun CT,
    4. Wu MS,
    5. Weng JR,
    6. Chen CC
    . Autophagy potentiates the anti-cancer effects of the histone deacetylase inhibitors in hepatocellular carcinoma. Autophagy 2010;6:1057–65.
    OpenUrlCrossRefPubMed
  29. 29.↵
    1. Levin B
    . Cell biology: autophagy and cancer. Nature 2007;446:745–7.
    OpenUrlCrossRefPubMed
  30. 30.↵
    1. Ikeda H,
    2. Hideshima T,
    3. Fulciniti M,
    4. Perrone G,
    5. Miura N,
    6. Yasui H,
    7. et al.
    PI3K/p110{delta} is a novel therapeutic target in multiple myeloma. Blood 2010;116:1460–8.
    OpenUrlAbstract/FREE Full Text
  31. 31.↵
    1. Liu KS,
    2. Liu H,
    3. Qi JH,
    4. Liu QY,
    5. Liu Z,
    6. Xia M,
    7. et al.
    SNX-2112, an Hsp90 inhibitor, induces apoptosis and autophagy via degradation of Hsp90 client proteins in human melanoma A-375 cells. Cancer Lett 2012;318:180–8.
    OpenUrlCrossRefPubMed
  32. 32.↵
    1. Acharya BR,
    2. Bhattacharyya S,
    3. Choudhury D,
    4. Chakrabarti G
    . The microtubule depolymerizing agent naphthazarin induces both apoptosis and autophagy in A549 lung cancer cells. Apoptosis 2011;16:924–39.
    OpenUrlCrossRefPubMed
  33. 33.↵
    1. Yang YF,
    2. Wu CC,
    3. Chen WP,
    4. Chen YL,
    5. Su MJ
    . Prazosin induces p53-mediated autophagic cell death in H9C2 cells. Naunyn Schmiedebergs Arch Pharmacol 2011;384:209–16.
    OpenUrlCrossRefPubMed
  34. 34.↵
    1. Duan WJ,
    2. Li QS,
    3. Xia MY,
    4. Tashiro S,
    5. Onodera S,
    6. Ikejima T
    . Silibinin activated p53 and induced autophagic death in human fibrosarcoma HT1080 cells via reactive oxygen species-p38 and c-Jun N-terminal kinase pathways. Biol Pharm Bull 2011;34:47–53.
    OpenUrlCrossRefPubMed
  35. 35.↵
    1. Liu WT,
    2. Lin CH,
    3. Hsiao M,
    4. Gean PW
    . Minocycline inhibits the growth of glioma by inducing autophagy. Autophagy 2011;7:166–75.
    OpenUrlCrossRefPubMed
  36. 36.↵
    1. Oh SH,
    2. Lim SC
    . Endoplasmic reticulum stress-mediated autophagy/apoptosis induced by capsaicin (8-methyl-N-vanillyl-6-nonenamide) and dihydrocapsaicin is regulated by the extent of c-Jun NH2-terminal kinase/extracellular signal-regulated kinase activation in WI38 lung epithelial fibroblast cells. J Pharmacol Exp Ther 2009;329:112–22.
    OpenUrlAbstract/FREE Full Text
  37. 37.↵
    1. Appenzeller-Herzog C,
    2. Hall MN
    . Bidirectional crosstalk between endoplasmic reticulum stress and mTOR signaling. Trends Cell Biol 2012;1–9.
  38. 38.↵
    1. Qin L,
    2. Wang Z,
    3. Tao L,
    4. Wang Y
    . ER stress negatively regulates AKT/TSC/mTOR pathway to enhance autophagy. Autophagy 2010;6:239–47.
    OpenUrlCrossRefPubMed
PreviousNext
Back to top
Clinical Cancer Research: 18 (18)
September 2012
Volume 18, Issue 18
  • Table of Contents
  • Table of Contents (PDF)
  • About the Cover

Sign up for alerts

View this article with LENS

Open full page PDF
Article Alerts
Sign In to Email Alerts with your Email Address
Email Article

Thank you for sharing this Clinical Cancer Research article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Reovirus as a Viable Therapeutic Option for the Treatment of Multiple Myeloma
(Your Name) has forwarded a page to you from Clinical Cancer Research
(Your Name) thought you would be interested in this article in Clinical Cancer Research.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Citation Tools
Reovirus as a Viable Therapeutic Option for the Treatment of Multiple Myeloma
Chandini M. Thirukkumaran, Zhong Qiao Shi, Joanne Luider, Karen Kopciuk, He Gao, Nizar Bahlis, Paola Neri, Mark Pho, Douglas Stewart, Adnan Mansoor and Don G. Morris
Clin Cancer Res September 15 2012 (18) (18) 4962-4972; DOI: 10.1158/1078-0432.CCR-11-3085

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Share
Reovirus as a Viable Therapeutic Option for the Treatment of Multiple Myeloma
Chandini M. Thirukkumaran, Zhong Qiao Shi, Joanne Luider, Karen Kopciuk, He Gao, Nizar Bahlis, Paola Neri, Mark Pho, Douglas Stewart, Adnan Mansoor and Don G. Morris
Clin Cancer Res September 15 2012 (18) (18) 4962-4972; DOI: 10.1158/1078-0432.CCR-11-3085
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Jump to section

  • Article
    • Abstract
    • Introduction
    • Materials and Methods
    • Results
    • Discussion
    • Disclosure of Potential Conflicts of Interest
    • Authors' Contributions
    • Grant Support
    • Acknowledgments
    • Footnotes
    • References
  • Figures & Data
  • Info & Metrics
  • PDF
Advertisement

Related Articles

Cited By...

More in this TOC Section

  • Targeting HER2 with Osimertinib in NSCLC
  • Combined VEGF/EGFR Inhibition
  • Radiotherapy with IDO1/PD-1 Blockade Treats Advanced GBM
Show more Cancer Therapy: Preclinical
  • Home
  • Alerts
  • Feedback
  • Privacy Policy
Facebook  Twitter  LinkedIn  YouTube  RSS

Articles

  • Online First
  • Current Issue
  • Past Issues
  • CCR Focus Archive
  • Meeting Abstracts

Info for

  • Authors
  • Subscribers
  • Advertisers
  • Librarians

About Clinical Cancer Research

  • About the Journal
  • Editorial Board
  • Permissions
  • Submit a Manuscript
AACR logo

Copyright © 2021 by the American Association for Cancer Research.

Clinical Cancer Research
eISSN: 1557-3265
ISSN: 1078-0432

Advertisement