Microsatellite Instability Is Uncommon in Breast Cancer

DOI: Published April 1999

Article Figures & Data

Download figure
Open in new tab
Download powerpoint
Fig. 1.
Absence of mismatch repair errors in breast cancer samples. In A, two examples of microsatellite amplifications are demonstrated in which an unexpected band was seen in the tumor sample of the original reaction (arrows). Repeat reactions failed to show same unexpected bands. Normal (N; germ line) and tumor-derived (T) DNA samples are shown. Sample B140 was amplified with primers for the D5S419 marker, and sample B109 was amplified with primers for the D5S404 marker. In B, representative amplifications of BAX and IGFIIR genes in breast cancer samples are shown. Controls consist of DNA from colorectal cancers with MSI and show frameshift mutations

Table 1

Breast cancer samples studied for mismatch repair errors

Tissue samples are classified according to histology.
Breast cancer tissues	No. of samples studied for MSI	No. of samples studied for intragenic single/trinucleotide instability
Infiltrating ductal	154	20
Ductal carcinoma in situ	62	0
Infiltrating lobular	11	11
Mucinous (colloid)	22	22
Medullary	8	8
Breast cancer cell lines		30
Total	267	91

Table 2

Microsatellite markers used in amplifications of breast cancer samples

Markers highlighted in bold have been designated to comprise a diagnostic panel to evaluate colorectal cancers for MSI (45) , and underlined markers have been reported in other studies to show MSI in breast cancers.
Chromosome no.	Microsatellite markers	Total number of markers	Total number of reactions
1	D1S500, D1S507, D1S243, D1S305, SPTA1, D1S318, D1S117, D1S158, D1S162, D1S188, D1S228, BAT40	12	1062
2	D2S123, BAT26	2	240
4	BAT25	1	120
5	D5S393, D5S404, D5S415, D5S421, D5S429, D5S656	6	360
6	D6S252, D6S268, D6S287, D6S270, D6S292, D6S250, D6S310, D6S314, D6S311, D6S420, D6S473, D6S255, D6S442, D6S305, D6S264, D6S297	16	2613
8	D8S133, D8S137, D8S255, D8S259, D8S261, D8S262, D8S264, D8S298, D8S503, D8S504, D8S518, D8S540, D8S549, D8S560, D8S1715, D8S1991	16	934
9	D9S104, D9S162, D9S157, D9S156, D9S161, D9S200, D9S169, D9S171, D9S736, D9S816, D9S1747, D9S1748, D9S1749, D9S1751, D9S1752, D9S2230	16	1410
11	D11S1324, D11S904, D11S902, D11S988, D11S29, D11S35, D11S528, INT2, D11S911, D11S917	10	1186
13	D13S260, D13S263, D13S155, D13S284	4	460
16	D16S541, D16S415, D16S265, D16S402, D16S413, D16S420, D16S515, D16S514, D16S511, D16S520	10	596
17	D17S513, CHRNB1, TP53, D17S786, D17S122, THRA1, D17S579, D17S588, D17S736, D17S926, D17S250	11	1636
Total		104	10617

Table 3

Primers used for amplification of intragenic simple nucleotide repeats

Gene	Repeat	PCR product (bp)	Primers (5′-3′)
E2F4	(AGC)_n	167	ACAGTGGTGAGCTCAGTTCACTC
			AAAGGAGGTAGAAGGGTTGGGTC
TGF-βRII	poly(A)₁₀	140	ACAGTTTGCCATGACCCCAAG
			TCATTGCACTCATCAGAGCTACAGG
IGFIIR	poly(G)₈	110	GCAGGTCTCCTGACTCAGAA
			GAAGAAGATGGCTGTGGAGC
BAX	poly(G)₈	94	ATCCAGGATCGAGCAGGGCG
			ACTCGCTCAGCTTCTTGGTG