Article Figures & Data
Figures
- Fig. 1.
DNA sequence analysis of the aberrant bands of the p15INK4b gene revealed a C-to-G nucleotide substitution in intron 1 of p15INK4b downstream of exon 1 in case 28.
- Fig. 2.
A, methylation analysis of the p16INK4 gene by MSP. The PCR product (151 bp for U, 150 bp for M) indicates whether the unmethylated (U) or methylated (M) the p16INK4 gene allele is present in that sample. The unmethylated allele was present in all of the samples because of contamination of normal tissue. In cases 13 and 16, only the metastatic site had the methylated p16INK4 gene allele. Both the primary and metastatic sites of case 8 had the methylated p16INK4 gene allele. P, primary site; M, metastatic site; N, normal site. B, the DNA sequence of the unmethylated band in case 8. C, the DNA sequence of the methylated band in case 8.
- Fig. 3.
Immunohistochemistry of p16INK4 of the cases that had a hypermethylated p16INK4 promoter region at only the metastatic site. A and B, p16INK4 markedly positive immunostaining in the primary sites of a adenocarcinoma (case 13; A) and a squamous cell carcinoma (case 16; B) and strong p16INK4 nuclear reactivity in most tumor cells. C, p16INK4 mildly positive staining in the primary site of an adeno-squamous cell carcinoma (case 14) and strong p16INK4 nuclear reactivity in some tumor cells. D and E, p16INK4 staining in a small cell carcinoma (case 27). The nuclei of primary lung cancer cells were mildly stained for p16INK4 (D), but the cancer cells of the metastatic site were negative for p16INK4 (E).
Tables
- Table 1
%Patient characteristics and results of p16INK4 methylation and p53 mutation
Pt Histology Age Sex Meta site CT Effect p16 Methyla Prim p16 Methyl Meta p53 mut Prim p53 mut Meta 1 adeno 57 M Liver + MR un un − − 2 adeno 40 F Lung + NE ND ND − − 3 adeno 49 M Liver + PD un un − − 4 adeno 60 F Liver + PR un un − − 5 adeno 61 M Liver + NE ND ND − − 6 adeno 74 M Muscle − un un + + 7 adeno 65 F Lung + NC un Methyl − − 8 adeno 63 M Pleura + NC Methyl Methyl − − 9 adeno 52 M Pleura + NE un un − − 10 adeno 47 M Pancreas + NE un un + + 11 adeno 74 F Lung + NC un un − − 12 adeno 60 M Liver − un un + + 13 adeno 74 F Lung + PR un Methyl − − 14 ad-sq 64 M Liver − un Methyl − − 15 sq 70 M Lung + PD un un + + 16 sq 69 M Lung + NC un Methyl − − 17 sq 58 M Lung + PR Methyl Methyl + + 18 sq 82 F Liver − NC un un + + 19 sq 74 M Lung + NC un Methyl − − 20 sq 71 M Liver + NC un Methyl − − 21 sq 80 M Bronchus + MR un un − − 22 sq 64 M Lung + PD un Methyl − − 23 sq 57 F Subcuta + NC un un − − 24 small 77 M Lung + NE un un + + 25 small 80 M Liver + PR un un + + 26 small 48 M Spleen + PD un un + + 27 small 62 M Liver + PR un Methyl − − 28 small 53 M Liver + PR un un − − 29 small 48 F Liver + PR un un − − -
a Methyl, methylated; un, unmethylated; adeno, adenocarcinoma; sq, squamous cell carcinoma; ad-sq, adeno-squamous cell carcinoma; CT, chemotherapy; Effect, response to chemotherapy; Prim, Primary; Meta, Metastasis; mut, mutation; PR, partial response; MR, minor response; NC, no change; PD, progressive disease; NE, not evaluated; ND, not done.
-
- Table 2
%Sequence of PCR primers used for amplification of the indicated exons in p16INK4 and p15INK4b
Exon Sense (5′-3′) Antisense (5′-3′) p15 Exon1 TTAAGTTTACGGCCAACGGTGGAT TGTACAAATCTATTTTCATCGCGATCTA Exon2 TCTTTAAATGGCTCCACCTGCCTT TCCCCGGGTTGGCAGCCTTCATCGA p16 Exon1 CGGAGAGGGGAGAGCAG TGCAAACTTCGTCCTCCAGAGTC Exon2 TTAGGACACCTGGGGTTGTGTG TGGAAGCTCTCAGGGTACAAATTC
Volume 6, Issue 11
