Skip to main content
  • AACR Publications
    • Blood Cancer Discovery
    • Cancer Discovery
    • Cancer Epidemiology, Biomarkers & Prevention
    • Cancer Immunology Research
    • Cancer Prevention Research
    • Cancer Research
    • Clinical Cancer Research
    • Molecular Cancer Research
    • Molecular Cancer Therapeutics

AACR logo

  • Register
  • Log in
  • Log out
  • My Cart
Advertisement

Main menu

  • Home
  • About
    • The Journal
    • AACR Journals
    • Subscriptions
    • Permissions and Reprints
    • Reviewing
    • CME
  • Articles
    • OnlineFirst
    • Current Issue
    • Past Issues
    • CCR Focus Archive
    • Meeting Abstracts
    • Collections
      • COVID-19 & Cancer Resource Center
      • Breast Cancer
      • Clinical Trials
      • Immunotherapy: Facts and Hopes
      • Editors' Picks
      • "Best of" Collection
  • For Authors
    • Information for Authors
    • Author Services
    • Best of: Author Profiles
    • Submit
  • Alerts
    • Table of Contents
    • Editors' Picks
    • OnlineFirst
    • Citation
    • Author/Keyword
    • RSS Feeds
    • My Alert Summary & Preferences
  • News
    • Cancer Discovery News
  • COVID-19
  • Webinars
  • Search More

    Advanced Search

  • AACR Publications
    • Blood Cancer Discovery
    • Cancer Discovery
    • Cancer Epidemiology, Biomarkers & Prevention
    • Cancer Immunology Research
    • Cancer Prevention Research
    • Cancer Research
    • Clinical Cancer Research
    • Molecular Cancer Research
    • Molecular Cancer Therapeutics

User menu

  • Register
  • Log in
  • Log out
  • My Cart

Search

  • Advanced search
Clinical Cancer Research
Clinical Cancer Research
  • Home
  • About
    • The Journal
    • AACR Journals
    • Subscriptions
    • Permissions and Reprints
    • Reviewing
    • CME
  • Articles
    • OnlineFirst
    • Current Issue
    • Past Issues
    • CCR Focus Archive
    • Meeting Abstracts
    • Collections
      • COVID-19 & Cancer Resource Center
      • Breast Cancer
      • Clinical Trials
      • Immunotherapy: Facts and Hopes
      • Editors' Picks
      • "Best of" Collection
  • For Authors
    • Information for Authors
    • Author Services
    • Best of: Author Profiles
    • Submit
  • Alerts
    • Table of Contents
    • Editors' Picks
    • OnlineFirst
    • Citation
    • Author/Keyword
    • RSS Feeds
    • My Alert Summary & Preferences
  • News
    • Cancer Discovery News
  • COVID-19
  • Webinars
  • Search More

    Advanced Search

Clinical Trials

Colorectal Tumors Responding to 5-Fluorouracil Have Low Gene Expression Levels of Dihydropyrimidine Dehydrogenase, Thymidylate Synthase, and Thymidine Phosphorylase

Dennis Salonga, Kathleen D. Danenberg, Martin Johnson, Ralf Metzger, Susan Groshen, Denice D. Tsao-Wei, Heinz-Josef Lenz, C. Gail Leichman, Lawrence Leichman, Robert B. Diasio and Peter V. Danenberg
Dennis Salonga
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Kathleen D. Danenberg
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Martin Johnson
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Ralf Metzger
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Susan Groshen
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Denice D. Tsao-Wei
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Heinz-Josef Lenz
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
C. Gail Leichman
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Lawrence Leichman
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Robert B. Diasio
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Peter V. Danenberg
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
DOI:  Published April 2000
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

Abstract

We had previously shown that high gene expressions (mRNA levels) of thymidylate synthase (TS; Leichman et al., J. Clin. Oncol., 15: 3223–3229, 1997) and thymidine phosphorylase (TP; Metzger et al., Clin. Cancer Res., 4: 2371–2376, 1998) in pretreatment tumor biopsies could identify tumors that would be nonresponsive to 5-fluorouracil (5-FU)-based therapy. In this study, we investigated the association between intratumoral gene expression of the pyrimidine catabolism enzyme dihydropyrimidine dehydrogenase (DPD) and the response of colorectal tumors to the same 5-FU-based protocol. DPD expressions were measured by quantitative reverse transcription-PCR in 33 pretreatment biopsies of colorectal tumors from patients who went on to receive treatment with 5-FU and leucovorin (LV). The range of DPD gene expression in those tumors that were nonresponsive to 5-FU was much broader than that of the responding tumors. None of the tumors with basal-level DPD expressions above a DPD:β-actin ratio of 2.5 × 10−3 (14 of 33) were responders to 5-FU/LV therapy, whereas those tumors with DPD gene expressions below DPD:β-actin ratio of 2.5 × 10−3 had a response rate of 50%. There was no correlation among DPD, TS, and TP expression values in this set of colorectal tumors, which indicated that these gene expressions are independent variables. All of the tumors that responded to 5-FU therapy (11 of 33) had expression values of all three of the genes, TS, TP, and DPD, below their respective nonresponse cutoff values, whereas, in each of the nonresponding tumors, at least one of these gene expressions was high. The patients with low expression of all three of the genes had significantly longer survival than patients with a high value of any one of the gene expressions. The results of this study show that intratumoral gene expression level of DPD is associated with tumor response to 5-FU and that the use of more than one independent determinant of response permits the identification of a high percentage of responding patients.

INTRODUCTION

5-FU3 has been used for more than 40 years for the treatment of various cancers and remains the standard first-line treatment for colorectal cancer, although the response rate as a single agent is usually less than 20% (1) . Over the years, various strategies have been attempted to increase the antitumor efficacy of 5-FU by modulation of its intracellular metabolism and biochemistry (2) . We have been pursuing another approach for improving therapy with 5-FU by identifying the biochemical response determinants of this drug. If such determinants could be measured in tumors before treatment, patients who are judged unlikely to respond to 5-FU would then have the option to be treated, instead, with another agent to which they might respond, whereas those patients with favorable 5-FU response indices could anticipate a higher than average probability of response. We had previously found that the intratumoral levels of expression of the mRNA for the 5-FU target enzyme TS (3) and the catabolic enzyme TP (4) were predictors of the sensitivity of colorectal tumors to 5-FU-based protocols. TS and TP expression values that were above a certain threshold identified a subset of tumors not responding to 5-FU, whereas expression values below the nonresponse cutoff value number predicted an appreciably higher response rate but did not specifically identify responding tumors. However, we also noted that tumors with both low TS and low TP had a higher response rate than tumors with only one or the other gene expression being low (4) ; that is, by combining response determinants, it was possible to achieve a considerably better response prediction than with just one determinant. This observation suggested that, with yet a third independent response determinant, it might be possible to identify a set of tumors that would have a very high, if not 100%, response rate to 5-FU-based protocols.

In this study, we examined intratumoral DPD expression as a possible additional determinant of the response of colorectal tumors to 5-FU treatment. DPD reduces the 5,6 double bond of uracil (as well as that of 5-FU) and is the rate-limiting enzyme for 5-FU catabolism (5, 6, 7) . DPD activity is highly variable in normal tissues (8) and, thus, by sufficiently influencing the bioavailability of 5-FU, could affect its pharmacokinetics, toxicity, and antitumor activity. DPD levels not only vary among individuals but also within the same individual on a Circadian rhythm basis (9) . Patients with DPD levels within the normal range rapidly eliminate over 80% of administered 5-FU as 2-fluoro-β-alanine, whereas patients who are deficient in DPD retain 5-FU over a much longer half-life and excrete mostly unchanged 5-FU in the urine (10) . In such patients, 5-FU can cause profound toxicity (11) . Because inactivation of 5-FU by DPD seemed to be a mechanism of clinical resistance to 5-FU, vigorous efforts have been made to design inhibitors of DPD. The most successful of these, 5-ethynyluracil, markedly improved the efficacy and therapeutic index of 5-FU in rats (12) . In addition to its role in normal tissue toxicity of 5-FU, DPD expression specifically in tumors has been studied as a possible determinant of tumor response to 5-FU. DPD expression is variable among tumors also, and, in head-and-neck tumors, DPD levels have been inversely associated with response to 5-FU (13) .

The above-cited studies, along with previous studies showing that DPD and TS levels both were significantly associated with sensitivity to 5-FU (14) , suggested to us that DPD expression could be a useful 5-FU response determinant in colorectal tumors along with TS and TP expression provided that: (a) intratumoral basal DPD level was associated with clinical efficacy of FU; (b) TS, TP, and DPD expressions were independent variables; and (c) there was sufficient variation among individuals in the expression of this gene. Accordingly, we used quantitative RT-PCR to measure DPD expression (relative mRNA levels) in a group of 33 colorectal tumors in which we had already determined TS and TP expressions, and we correlated these expressions with response to 5-FU-based therapy.

MATERIALS AND METHODS

Clinical Methods.

Eligibility criteria for these trial-and-tumor-response-evaluation parameters were described previously in detail (3) . In brief, eligible patients had (a) a diagnosis of disseminated or recurrent colorectal cancer with a measurable lesion accessible for biopsy; (b) a Southwest Oncology Group performance status of 0 to 2 with adequate hematological, hepatic, and renal function; (c) no prior infusional 5-FU; and (d) a lesion that was bidimensionally measurable either by physical or radiological examination. After placement of an indwelling venous access, patients were treated with 5-FU (200 mg/m2/day) as a continuous infusion administered by ambulatory infusion pump (Pharmacia Deltec Cadd pump, Minneapolis, MN) with LV (20 mg/m2) by i.v. push weekly. The initial cycle was given for 4 weeks, followed by a 1-week rest, with subsequent cycles consisting of 3 weeks continuous therapy and a 1-week rest. Response rates and toxicity profiles for this regimen have been published previously (15) .

After two cycles (8 weeks) of treatment, measurable disease was reassessed. Response criteria were the standard definitions used for national cooperative group trials (16) . To be classified as a responder, a tumor had to have a 50% reduction in the sum of the products of the perpendicular diameters of the indicator lesion without growth of other disease or the appearance of new lesions. Those with responses or stable disease were continued on protocol until progression was documented.

Liver metastases represented the most common site of disease on which a biopsy was performed and assessed for response, whereas, in some cases, nodal metastases or peritoneal metastases were the disease sites evaluated. All of the specimens were obtained by core-needle biopsy. This technique uses a coaxial system in which fine-needle aspiration is used to confirm cytological evidence of cancer within moments of the aspiration. The fine needle is withdrawn from a sheath and a core needle is inserted through the sheath without losing position. The core-needle material is used for gene expression analysis. Specimens were examined by pathologists and were not used for analysis unless they were judged to consist of >80% tumor tissue.

Laboratory Methods.

The procedure for RT-PCR quantitation of gene expression has been described in detail previously (17 , 18) . In brief, the method involves isolation of mRNA from each tumor, preparation of cDNA using reverse transcriptase and random hexamers and PCR amplification of the specific cDNA of interest in a range of concentrations that gives rise to a linear curve of the resulting PCR products. An internal standard gene (for example, β-actin) from the same cDNA solution is PCR-amplified separately. We found previously that with β-actin as the reference gene, a good linearity is obtained between gene expression values determined by RT-PCR and protein content determined by immunohistochemistry (19) . Once the concentration ranges for linear amplification are established for the cDNA of the target gene and the reference gene, the ratio of the slopes generates an empirical number proportional to the amount of mRNA of interest in the tissue normalized to total RNA. Gene expression values are reported only if the PCR of serial dilutions of the cDNA solution generates a set of distinct bands with intensities that are linear with the concentration of cDNA. Slopes of the lines are obtained from at least three data points, so that each reported gene expression value represents the average of a minimum of three separate PCR reactions within the linear amplification range. When the initially chosen cDNA concentrations for a particular determination give PCR products clearly outside of the proportional linearity region, the determination is repeated with adjusted cDNA concentrations until the data points are in the linear range, and the correlation coefficient for linearity for a set of at least three consecutive serial dilutions plus the zero point is greater than 0.90. This method has been used by us (3 , 19) as well as by others (20) to quantitate various gene expressions in tumor biopsy specimens. Gene expression values are expressed as a ratio of PCR products of the gene of interest to that of the internal reference gene β-actin.

For RT-PCR quantitation of DPD, the following primers were designed based on the sequence of the DPD gene (GenBank accession no. U20938): DPD-1740F, T7-GGTCTTGCTAGCGCAACTCC (“T7” designates the T7 RNA polymerase clamping sequence TAATACGACTCACTATAGGGAGA attached to the 5′ end), and DPD-1989R, CCTTTAGTTCAGTGACACTTTGA. These primers were designed to give an amplicon of 250 bp, spanning positions 1740 to 1989 of the genomic sequence. β-actin primers BA67 and BA68 were described previously (17) . The PCR reaction was performed as described previously (17 , 18) , except that cycling conditions were modified to be optimal for the DPD primers. The cycling conditions for DPD amplification were 15 s at 96°C, 30 s at 65°C, and 30 s at 72°C for 31 cycles.

Statistical Methods.

To evaluate the association of DPD with response and with survival, DPD was categorized into a low and a high value. To determine this cutoff value, the maximally selectedχ 2 method of Miller and Halpern (21 , 22) was adapted. For each observed DPD value, patients were classified as falling below or equal to that value, or above that value. The Pearson χ2 test statistic was used to compare the response rates of the two resulting groups of patients (below or equal to the value versus above the value). The DPD value that yielded the largestχ 2 test statistic (the maximalχ 2 statistic) was selected as the optimal cut-point. To determine the P-value associated with the maximal χ2 statistic, we performed 2000 bootstrap-like simulations. For each simulation, a randomly selected DPD value was drawn (with replacement) from the set of observed DPD values and assigned to each of the observed responses; the maximal χ2 test statistic was calculated based on this set of randomly matched DPD values and responses. The corrected P-value was calculated as the proportion of the 2000 simulated maximal statistics that was larger than the original maximal χ2 test statistic; the calculated corrected value was 0.033, compared with the uncorrected P of 0.0041. This analysis was repeated using the log-rank test to compare survival. For this analysis, the calculated corrected value was 0.03, compared with the uncorrected P of 0.0015. These corrected Ps account for the fact that all of the possible DPD values were examined before selecting the optimal cut-point. In both analyses, the optimal DPD cut-point was 2.5. The rest of the analysis was descriptive, and P-values were calculated to reflect the magnitude of associations rather than to perform formal testing. The cutoff values for TS and TP expressions were based on the highest level in the group of responders (therefore, no patient with a TS ≥ 4.1 or a TP ≥ 18 was a responder). To examine the joint association of TS, TP, and DPD with either response or survival, the 2×2×2 = 8 groups of patients were examined. The group of patients with TS ≤ 4, TP ≤ 18, and DPD ≤ 2.5, was the largest (n = 11 patients) and also identified a subset with a longer survival; the outcome of this subset was compared with the others. To evaluate the association with response, the two-sided Fisher’s exact test was used; the Spearman correlation was used to evaluate the association between DPD and TS; the log-rank test was used to measure the association between TS, TP, and DPD, and survival. The Ansari-Bradley test was used to compare the responders and nonresponders in terms of the variability of DPD gene expression (23) .

RESULTS

Relative DPD mRNA content was determined by quantitative RT-PCR (17 , 18) in biopsy specimens from 33 colorectal cancer patients analyzed previously for TS expression levels (3) . Tumors were categorized as either responding or not responding to a regimen of 5-FU and LV (see“ Materials and Methods” for definition of clinical response criteria). Fig. 1⇓ shows the distributions of DPD:β-actin PCR product ratios (henceforth termed“ expressions” for convenience) for the two groups. The range of DPD expressions among the responding tumors was relatively narrow (0.60 × 10−3 to 2.5 × 10−3, 4.2-fold) compared with that of the nonresponders (0.2 × 10−3 to 16 × 10−3, 80-fold). This difference in the range of gene expression between the responding and nonresponding groups was significant (P = 0.019, Ansari-Bradley rank test), as was the lack of responding tumors with DPD expressions> 2.5 × 10−3 (Table 1)⇓ . A total of 22 tumors had DPD expressions < 2.5 × 10−3 with a corresponding response rate of 50% (11 of 22).

Fig. 1.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 1.

DPD gene expressions in 33 colorectal tumors grouped according to response (>50% tumor shrinkage) or nonresponse (<50% tumor shrinkage).

View this table:
  • View inline
  • View popup
Table 1

Summary of response data for tumors with different expressions of DPD and TS genes

For tumor response prediction, it was of interest to determine the relationship between these gene expressions. For example, if TS and DPD were coregulated, there would be little or no additional benefit for response prediction from measuring two gene expressions, whereas if the genes were independently regulated, some portion of the low-TS patients might be identified as nonresponders by their high DPD expression. A plot of DPD against TS expressions (Fig. 2)⇓ showed no correlation between the expressions of these genes (r2, 0.01), with a number of low-DPD tumors having high TS and high-TS tumors having low DPD expressions. As Fig. 3⇓ further shows, only 1 of 12 tumors falling within the area designated by the nonresponse cutoff values of TS and DPD (i.e., having both low TS and low DPD) was a nonresponder to 5-FU/LV, but this one tumor (Fig. 3⇓ , tumor 152) had a TP expression value above its cutoff. Thus, all of the responding tumors could be identified by low expression values of DPD, TS, and TP (Fig. 3)⇓ . The response data are summarized in Table 1⇓ .

Fig. 2.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 2.

DPD expressions plotted against TS expressions in the same set of 33 colorectal tumors. The values for TS expression were obtained from a previously published study (3) . The dotted lines indicate the nonresponse cutoff values for each gene expression.

Fig. 3.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 3.

DPD, TS, and TP expressions in tumors grouped according to response or no response to 5-FU treatment. The gene expression values shown on the ordinate were normalized with respect to the highest value on each group. The numbers on the X-axis are identification numbers for each of the tumor specimens.

Longer periods of survival have been observed for colorectal cancer patients whose tumors respond to chemotherapy (24) . In the present study also, survival for those patients with DPD values below the nonresponse threshold of DPD < 2.5 × 10−3 was significantly longer than for those patients with DPD above this value (Fig. 4⇓ , upper panel). The greatest increase in survival was observed for the group of patients with all of the three genes, DPD, TS, and TP below the respective nonresponse cutoff values (Fig. 4⇓ , lower panel).

Fig. 4.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 4.

Survival (Kaplan-Meier) plots indicating probability of survival for patients with DPD expressions above or below the nonresponse cutoff[ DPD:β-actin = 2.5 × 10−3 (upper panel)]; and for patients with DPD, TS, and TP expressions either above or below their respective nonresponse cutoff values (DPD:β-actin = 2.5 × 10−3; TS:β-actin = 4.1 × 10−3; and TP:β-actin = 18 × 10−3 (lower panel)].

DISCUSSION

In this study, we have shown a significant correlation between DPD expression levels in colorectal tumors, response to 5-FU, and patient survival. The pattern of DPD expressions as a function of response or nonresponse resembled that of TS and TP expressions determined previously (3 , 4) in that: (a) the range of gene expressions among the nonresponders was considerably broader than among the responders; and (b) there was a cutoff value of DPD expression (DPD:β-actin, 2.5 × 10−3) above which there were no 5-FU-responsive tumors, whereas the set of tumors with expressions below the cutoff value comprised both responders and nonresponders. Thus, low DPD expressions do not uniformly identify responding tumors but do predict a high response rate of 50%. However, because TS and DPD gene expressions are independently regulated (as indicated by the lack of correlation between them in Fig. 2⇓ ), 10 of these low-DPD tumors could be positively identified as nonresponders by TS expression values >4.1 × 10−3 (the nonresponse cutoff value for TS expression). Thus, tumors having both TS < 4.1 × 10−3 and DPD < 2.5 × 10−2 in this group of patients had a 92% response rate. Adding TP expression as a third determinant allowed all of the responders in this group of tumors to be identified by low expression of all of the three genes (Fig. 3)⇓ . These data show how combining more than one independent response determinant can increase predictive power for clinical outcome.

It is striking to see in Fig. 3⇓ that the patterns of expression of TS, DPD, and TP vary over a wide range and are different in every one of the nonresponding tumors. This almost chaotic variation of gene expressions among the individual tumors of the nonresponding group compared with the responding group, suggests that the transition from a drug-sensitive tumor to one that is insensitive is accompanied or preceded by a substantial degradation of the ability of the tumor cells to regulate their gene expressions.

This study also shows that, because response of colorectal tumors to chemotherapy is associated with a significant survival benefit (24) , measuring these gene expressions not only can predict response to 5-FU but also can identify patients with a better survival prognosis. If these results can be confirmed in a clinical trial with a larger set of patients, data on TS, DPD, and TP expressions in tumors would permit more rational decisions on whether or not to proceed with 5-FU-based therapy as first-line treatment. If the 5-FU response indices seem unfavorable, the alternative drug CPT-11 is now available for treatment of colorectal cancer patients. Preliminary results show that tumors with TS expression levels that would put them into the group not expected to respond to 5-FU, or indeed have already been treated and have failed 5-FU, do respond to CPT-11 (25) . If patients destined for 5-FU failure can be identified before the start of treatment, benefits will of course be gained by avoiding the toxicity associated with the drug, but, moreover, it is possible that patients will be more likely to respond to CPT-11 when it is given as primary therapy, compared with its use after 5-FU failure. Thus, the assignment of patients for either 5-FU or CPT-11 treatment by taking into consideration their TS, DPD, or TP levels may provide a way of achieving a substantial increase in the overall response rate to chemotherapy using currently available agents.

Footnotes

  • The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

  • ↵1 Supported by USPHS Grants U01 CA 60108, RO1 CA 39629, RO1 CA60859, and P30 CA 14089. R. M. was supported by Dr. Mildred Scheel Stiftung, Bonn, Germany.

  • ↵2 To whom requests for reprints should be addressed, at University of Southern California/Norris Comprehensive Cancer Center CRL-204, 1303 North Mission Road, Los Angeles, CA 90033. Phone: (213) 224-7788; Fax: (213) 224-7679; E-mail: pdanenbe{at}hsc.usc.edu

  • ↵3 The abbreviations used are: 5-FU, 5-fluorouracil; TS, thymidylate synthase; DPD, dihydropyrimidine dehydrogenase; LV, leucovorin; RT, reverse transcription; TP, thymidine phosphorylase.

  • Received July 21, 1999.
  • Revision received January 12, 2000.
  • Accepted January 19, 2000.

References

  1. ↵
    Moertel C. G. Chemotherapy for colorectal cancer. N. Engl. J. Med., 330: 1136-1142, 1994.
    OpenUrlCrossRefPubMed
  2. ↵
    Soros G. A., Grogan L. M., Allegra C. J. Preclinical and clinical aspects of biomodulation of 5-fluorouracil. Cancer Treat. Rev., 20: 11-49, 1994.
    OpenUrlCrossRefPubMed
  3. ↵
    Leichman C. G., Lenz H-J., Leichman L., Danenberg K., Baranda J., Groshen S., Boswell W., Metzger R., Tan M., Danenberg P. V. Quantitation of intratumoral thymidylate synthase expression predicts for disseminated colorectal cancer response and resistance to protracted infusion 5-fluorouracil and weekly leucovorin. J. Clin. Oncol., 15: 3223-3229, 1997.
    OpenUrlAbstract
  4. ↵
    Metzger R., Danenberg K. D., Leichman C. G., Salonga D., Schwartz E. L., Wadler S., Lenz H-J., Groshen S., Leichman L., Danenberg P. V. High basal level gene expression of thymidine phosphorylase (platelet-derived endothelial cell growth factor) in colorectal tumors is associated with non-response to 5-fluorouracil. Clin. Cancer Res., 4: 2371-2376, 1998.
    OpenUrlAbstract/FREE Full Text
  5. ↵
    Naguib F. N. M., El Kouni A. M., Cha S. Enzymes of uracil catabolism in normal and neoplastic human tissues. Cancer Res., 45: 5405-5412, 1985.
    OpenUrlAbstract/FREE Full Text
  6. ↵
    Lu Z., Zhang R., Diasio R. B. Purification and characterization of dihydropyrimidine dehydrogenase from human liver. J. Biol. Chem., 267: 17102-17109, 1992.
    OpenUrlAbstract/FREE Full Text
  7. ↵
    Johnson M. R., Wang K., Tillmanns S., Albin N., Diasio R. B. Structural organization of the human dihydropyrimidine dehydrogenase gene. Cancer Res., 57: 1660-1663, 1997.
    OpenUrlAbstract/FREE Full Text
  8. ↵
    Heggie D., Sommadossi J. P., Cross D. S., Huster W. J., Diasio R. B. Clinical pharmacokinetics of 5-fluorouracil and its metabolites in plasma, urine, and bile. Cancer Res., 47: 2203-2206, 1987.
    OpenUrlAbstract/FREE Full Text
  9. ↵
    Grem J. L., Yee L. K., Venzon D. J., Takimoto C. H., Allegra C. J. Inter- and intra-individual variation in dihydropyrimidine dehydrogenase activity in peripheral blood mononuclear cells. Cancer Chemother. Pharmacol., 40: 117-125, 1997.
    OpenUrlCrossRefPubMed
  10. ↵
    Harris B. E., Song R., He Y. J., Soong S. J., Diasio R. B. Relationship between dihydropyrimidine dehydrogenase activity and plasma drug levels in cancer patients receiving 5-fluorouracil by protracted continuous infusion. Cancer Res., 50: 197-201, 1990.
    OpenUrlAbstract/FREE Full Text
  11. ↵
    Lyss A. P., Lilenbaum R. C., Harris B. E., Diasio R. B. Severe 5-fluorouracil toxicity in a patient with decreased dihydropyrimidine dehydrogenase activity. Cancer Investig., 11: 239-240, 1993.
    OpenUrlPubMed
  12. ↵
    Cao S., Rustum Y. M., Spector T. 5-Ethynyluracil modulation of the efficacy and therapeutic index in rats bearing advanced colorectal carcinoma. Cancer Res., 54: 1507-1510, 1994.
    OpenUrlAbstract/FREE Full Text
  13. ↵
    Etienne M. C., Cheradame S., Fischel J. L., Formento P., Dassonville O., Renee N., Schneider M., Thyss A., Demard F., Milano G. Response to fluorouracil therapy in cancer patients: the role of intratumoral dihydropyrimidine dehydrogenase activity. J. Clin. Oncol., 13: 1663-1670, 1995.
    OpenUrlAbstract/FREE Full Text
  14. ↵
    Beck A., Etienne M. C., Cheradame S., Fischel J. L., Formento P., Renee N., Milano G. A role for dihydropyrimidine dehydrogenase and thymidylate synthase in tumor sensitivity to 5-fluorouracil. Eur. J. Cancer, 30: 1517-1522, 1994.
  15. ↵
    Leichman C. G., Leichman L., Spears C. P., Rosen P. J., Jeffers S., Groshen S. Prolonged continuous infusion of fluorouracil with weekly bolus leucovorin: a Phase II study in patients with disseminated gastrointestinal cancers. J. Natl. Cancer Inst., 85: 41-44, 1993.
    OpenUrlAbstract/FREE Full Text
  16. ↵
    Green S., Weiss G. R. Southwest Oncology Group standard response criteria, endpoint definitions, and toxicity criteria. Investig. New Drugs, 10: 239-253, 1992.
    OpenUrlCrossRefPubMed
  17. ↵
    Horikoshi T., Danenberg K. D., Stadlbauer T. H. W., Volkenandt M., Shea L. L. C., Aigner K., Gustavsson B., Leichman L., Frösing R., Ray M., Gibson N. W., Spears C. P., Danenberg P. V. Quantitation of thymidylate synthase, dihydrofolate reductase, and DT-diaphorase gene expression in human tumors using the polymerase chain reaction. Cancer Res., 52: 108-116, 1992.
    OpenUrlAbstract/FREE Full Text
  18. ↵
    Lenz H-J., Hill C., Danenberg K. D., Leichman L. L., Priest D. G., Danenberg P. V. Rapid quantitative PCR for determination of relative gene expressions in tissue specimens. PCR Methods Appl., 4: 305-309, 1995.
    OpenUrlPubMed
  19. ↵
    Johnston P. G., Lenz H-J., Leichman C. G., Danenberg K. D., Allegra C. J., Danenberg P. V., Leichman L. Thymidylate synthase gene and protein expression correlate and are associated with response to 5-fluorouracil in human colorectal and gastric tumors. Cancer Res., 55: 1407-1412, 1995.
    OpenUrlAbstract/FREE Full Text
  20. ↵
    Kuo, D. Y-S., Mallick, S., Shen, H-J., DeVictoria, C., Jones, J., Fields, A. L., Goldberg, G. L., Runowicz, C. D., and Horwitz, S. B. Clin. Cancer Res., 2: 1981–1992, 1996.
  21. ↵
    Miller R., Siegmund D. Maximally selected χ2 statistics. Biometrics, 38: 1011-1016, 1982.
    OpenUrlCrossRef
  22. ↵
    Halpern J. Maximally selected χ2 statistics for small samples. Biometrics, 38: 1017-1023, 1982.
    OpenUrlCrossRef
  23. ↵
    Hoolander, M., and Wolfe, N. A. Statistical Methods. New York: John Wiley & Sons, 1973.
  24. ↵
    Graf W., Pählman L., Bergström R., Glimelius B. The relationship between an objective response to chemotherapy and survival in advanced colorectal cancer. Br. J. Cancer, 70: 559-563, 1994.
    OpenUrlPubMed
  25. ↵
    Saltz L., Danenberg K., Paty P., Kelsen D., Kemeny N., Salonga D., Park J. M., Danenberg P. High thymidylate synthase activity does not preclude activity of CPT-11 in colorectal cancer (CRC). Proc. Am. Soc. Clin. Oncol., 17: 1080 1998.
    OpenUrl
PreviousNext
Back to top
April 2000
Volume 6, Issue 4
  • Table of Contents

Sign up for alerts

View this article with LENS

Open full page PDF
Article Alerts
Sign In to Email Alerts with your Email Address
Email Article

Thank you for sharing this Clinical Cancer Research article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Colorectal Tumors Responding to 5-Fluorouracil Have Low Gene Expression Levels of Dihydropyrimidine Dehydrogenase, Thymidylate Synthase, and Thymidine Phosphorylase
(Your Name) has forwarded a page to you from Clinical Cancer Research
(Your Name) thought you would be interested in this article in Clinical Cancer Research.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Citation Tools
Colorectal Tumors Responding to 5-Fluorouracil Have Low Gene Expression Levels of Dihydropyrimidine Dehydrogenase, Thymidylate Synthase, and Thymidine Phosphorylase
Dennis Salonga, Kathleen D. Danenberg, Martin Johnson, Ralf Metzger, Susan Groshen, Denice D. Tsao-Wei, Heinz-Josef Lenz, C. Gail Leichman, Lawrence Leichman, Robert B. Diasio and Peter V. Danenberg
Clin Cancer Res April 1 2000 (6) (4) 1322-1327;

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Share
Colorectal Tumors Responding to 5-Fluorouracil Have Low Gene Expression Levels of Dihydropyrimidine Dehydrogenase, Thymidylate Synthase, and Thymidine Phosphorylase
Dennis Salonga, Kathleen D. Danenberg, Martin Johnson, Ralf Metzger, Susan Groshen, Denice D. Tsao-Wei, Heinz-Josef Lenz, C. Gail Leichman, Lawrence Leichman, Robert B. Diasio and Peter V. Danenberg
Clin Cancer Res April 1 2000 (6) (4) 1322-1327;
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Jump to section

  • Article
    • Abstract
    • INTRODUCTION
    • MATERIALS AND METHODS
    • RESULTS
    • DISCUSSION
    • Footnotes
    • References
  • Figures & Data
  • Info & Metrics
  • PDF
Advertisement

Related Articles

Cited By...

More in this TOC Section

  • Abstract B32: RADIANCE: An open-label, nonrandomized, prospective biomarker study to assess analytic concordance between noninvasive testing and tissue testing for EGFR T790M mutation detection in patients with non-small cell lung cancer
  • Abstract B33: Expansion study of pegylated arginine deiminase (ADI-PEG20), pemetrexed, and cisplatin in patients with ASS1-deficient non-squamous non-small cell lung cancer (TRAP)
  • Abstract B34: Safety and activity of the IL-15/sIL-15Rα complex ALT-803 in combination with the anti-PD1 mAb nivolumab in metastatic non-small cell lung cancer
Show more Clinical Trials
  • Home
  • Alerts
  • Feedback
  • Privacy Policy
Facebook  Twitter  LinkedIn  YouTube  RSS

Articles

  • Online First
  • Current Issue
  • Past Issues
  • CCR Focus Archive
  • Meeting Abstracts

Info for

  • Authors
  • Subscribers
  • Advertisers
  • Librarians

About Clinical Cancer Research

  • About the Journal
  • Editorial Board
  • Permissions
  • Submit a Manuscript
AACR logo

Copyright © 2021 by the American Association for Cancer Research.

Clinical Cancer Research
eISSN: 1557-3265
ISSN: 1078-0432

Advertisement