Table 1

PCR primers, conditions, Pyrosequencing primers and restriction enzymes

PolymorphismForward primer 5′-3′Reverse primer 5′-3′Annealing temp (°C)Product size (bp)Pyrosequencing primer 5′-3′RFLP Restriction enzyme
ABCB1 1236 C>TTGTGTCTGTGAATTGCCTTGAAGaCCTCTGCATCAGCTGGACTGT65148GCACCTTCAGGTTCAGN/ab
ABCB1 2677 G>T/AATGGTTGGCAACTAACACTGTTAaAGCAGTAGGGAGTAACAAAATAACA50207TCATCTATTTAGTTTGACTCACCTTCN/a
ABCB1 3435 C>TGAGCCCATCCTGTTTGACTGGCATGTATGTTGGCCTCCTTa60250GGTGGTGTCACAGGAAGAN/a
ABCC1 14008 G>AGAGGGCACTTTGGGGCAaTCTTGAAGCGGAGGTCGTG62214ATAAGCCCAGGGTCAN/a
ABCC1 462 C>TGGTAAATTGAGGCTCGGTGGCCCCTCCACTTTGTCCATCTCa64197CACCTTCTCCATCCCN/a
ABCC1 34215 C>GGGGTGCATGTCCCACCTTCGTCTCGAGCCAGCAGCTa64257GTCTCACACATGTGCACTN/a
ABCC2 156231 A>GGCAAGATCCAGGGGACTTGTCCATCGTACAGTACACGAAGGTGAAA55100N/aHhaI
ABCG2 623 T>CCAGTTTATCCGTGGTGTGTCTGGAAAGGACAGCATTTGCTGTGCT55136N/aMboII
CES1 1440 A>TTGGACTTAATGGGGGACGTAGCCATATGGAATCAGCCTTT55200N/aHaeIII
CES1 1525 A>CCCCAAGACGGTGATAGGAGACCAGGAGAGGACAAAATTGC55180N/aMseI
CES2 1647 C>TTGAATGAATGGCGAAGTGAAGCCCAGAGTGACCCTCATAC60354N/aXhoI
CYP3A4 −392 A>GAGGACAGCCCATAGAGACAAGGATCAATGTTACTGGGGAGTCCa55116CCATAGAGACAAGGGCAN/a
CYP3A4 15713 T>CAACAATCCACAAGACCCCTTATCTTCAAATGTACTACAAATCACTGAa55212TTTGGATCCATTCTTTCN/a
CYP3A4 23172 T>CCCCACGTATGTACCACCCAGCATTAGGGTGTGACACAGCAAGA60160N/aNlaIII
CYP3A5 22893 G>ACCCACGTATGTACCACCCAGCaATTAGGGTGTGACACAGCAAGA65176CCAAACAGGGAAGAGAN/a
CYP3A5 30597 G>ATCTTTGGGGCCTACAGCATGaAAAGAAATAATAGCCCACATACTTATTGAGAG62153AGAAACCAAATTTTAGGAAN/a
UGT1A1 (TA)nGTCACGTGACACAGTCAAACaTTTGTTCCTGCCAGAGGTT50100AGGTTGGCCCTCTCCTAN/a
UGT1A1 1456 T>GTCTCCAGCCTTCACAAGGACATTTCCCACCCACTTCTCAA60291N/aBSrI
XRCC1 26304 C>TCTTCTCCCTGCCTCTCCACCTACCCTCCTCCCTCAGAACC66485N/aPvuII
XRCC1 27466 G>ACCTGGATTGCTGGGTCTGAGCCACTCAGCACCACTACC60640N/aPvuI
XRCC1 28152 G>AGCCCCTCAGATCACACCTAATCCCGCTCCTCTCAGTAGTC60593N/aNciI
  • a Biotinylated.

  • b N/a, not applicable.