Table 1.

Primer and probe sequences and PCR conditions

TargetPrimer and probe sequences
Forward sequenceReverse sequenceProbe sequence
HPV16 E6CTGCGACGTGAGGTATATGACTTTACATACAGCATATGGATTCCCATCTCTTTTCGGGATTTATGC
HPV18 E6AAACCGTTGAATCCAGCAGAAGTCGTTCCTGTCGTGCTCGTTGCAGCACGAATGG
PCR conditions
Melting timeAnneal/Extension time
HPV16 E695°C 15 s61°C 60 s
HPV18 E695°C 15 s60°C 60 s