Table 1.

Primer list

NameSequenceModificationTarget
Primers for exon amplification from plasma DNA
 exon19Tag119delTCCCGCGAAATTAATACGACAAGTTAAAATTCCCGTCGCTATC
Tag219delGCTGGAGCTCTGCAGCTAGACCCCCACACAGCAAAG
 exon20Tag1T790MTCCCGCGAAATTAATACGACGCATCTGCCTCACCTCCAC
Tag2T790MGCTGGAGCTCTGCAGCTAAGCAGGTACTGGGAGCCAAT
 exon21Tag1L858RTCCCGCGAAATTAATACGACAGCCAGGAACGTACTGGTGA
Tag2L858RGCTGGAGCTCTGCAGCTATGCCTCCTTCTGCATGGTAT
Primers for emulsion PCR
Tag1 (forward)TCCCGCGAAATTAATACGAC
Tag2 (reverse)GCTGGAGCTCTGCAGCTA
Hybridization probes for detection of beads with successful amplification
 exon1919del_BEAM_PE_bAGCAAAGCAGAAACTCACATC5′ biotin
 exon20T790M_BEAM_PE_bCGGACATAGTCCAGGAG5′ biotin
 exon21L858R_BEAM_PE_bATGCCTCCTTCTGCATGGTAT5′ biotin
Hybrizationprobe for BEAMing
 exon1919del_35_49_647GGAGATGTTTTGATAGCG5′ Alexa647exon 19 E746-A750del
19del_36_50_647CGGAGATGTCTTGATAGC5′ Alexa647exon 19 E746-A750del
19del_40_57_647TGGCTTTCGATTCCTTGA5′ Alexa647exon 19 L747-S752del.P753S
19del_AATTCC_647TGTTGCTTCTCTTGGAATT5′ Alexa647exon 19 E746-L747del.IP
19del_36_55_T_647GCTTTCGGAACCTTGATAG5′ Alexa647exon 19 L747-S752del. E746V
19del_35_53_ACT_647GGAGAAGTTTTGATAGCG5′ Alexa647exon 19 K745-E749del.A750K
19del_39_56_CAG_647TTTCGGCTGTTCCTTGAT5′ Alexa647exon 19 L747-T751del.S752Q
19del_39_48_C_647GAGATGTTGGTTCCTTGAT5′ Alexa647exon 19 L747-E749del.A750P
19del_WT_488TGTTGCTTCTCTTAATTCC5′ Alexa488exon 19 wild-type control
 exon20T790M_Mut_BNA_647atgagctgcAtgatgag5′ Alexa647T790M mutation
T790M_WT_BNA_488tgagctgcGtgatgag5′ Alexa488Wild-type control for T790M
 exon21L858R_Mut_LNA_647gtttggccCgcccaaaat5′ Alexa647L858R mutation
L858R_WT_LNA_488gtttggccAgcccaaaat5′ Alexa488Wild-type control for L858R
T2582A_Mut_647cacccagcTgtttggcc5′ Alexa647T2582A mutation
T2582A_WT_488cacccagcAgtttggcc5′ Alexa488Wild-type control for T2582A