Table 3.

Forward and reverse primers used for PCR amplification and the sequencing primer used for pyrosequencing reactions

GeneAnnealing temp, °CForward primerReverse primerSequencing primer
HIF3A56.1GGTAGGAGTTTTGGGAATTGG*-CCACCCCTACAATCCCTAAGGGTGAGAGTTAAGA
HAAO56.1AGGTTTGGGGTTTATTTTGAAT*-TAAAAATCCCAACACCTAAAAACACTTTTAGATGGGAAAGTTAAATT
RARβ56.1GTGTTTTTAAAATGAGTAGGGGAGGACCATTCTCTATTCTACAATTTAAAACTTACTTATTTGAGGAGGTTTAGTTTGGAA
GSTP157.5*-AGGGAGTAAATAGATAGTAGGAAGAGCCTCTCCCCTACCCTATAAAAATCCCAACCATCTTAAAAAATTTC
CRIP159.2TGTTTTAAGTGTAATAAGGAGGTGTAT*-ACAAAAACCTCCACCCTCAATAAGGAGGTGTATT
RUNX357.5Hs_RUNX3_01_PM00000112
HS3ST259.2GATTATAGGGGAGGGA11111GGAGAA*-ACACTTACCTATATTACAACTTCCTATACGGGA11111GGAGAAG
FLNC59.2Hs_FLNC_03_PM00127330
RASGRF256.1*-AAGTAGAAGAGTATATTTTGGTAGAGAACACCCCCTATACCTAACCTTTCTAACAAACCCCACTTCCTAAATAAAAAAA
PHLDA357.5GGGGTTTTATGGAGTGTTAAGTAATTAGT*-AACAACCCAAACCTTCTAACTTTTGAAGTTTAATATGTAATTGGTG
TNFRSF10D59.2*-ATGGTGGTTAGGTTGGTTTTTAACACTAAACTACCCCAAAAAAAATTCCAACCTCAAAAAACCAC
ZNF13557.5GGI I I I I 1 AG 11 GAG 1A1 AG 1 GAG IGGG*-CCTAAAAAAACCCCTTTTTCTCCGTATAGTGAGTGGGG
BCL11B57.5ATATTAATTAGGGTAGAGGAGGAGGT*-ATAATAAACTCCCTCTAAAACAAATACTAGATGTAGGGGTAATGTTT
POU3F359.2*-GGGGTAGGGTTGTGATTTATTGAAAACCCCTCCTCTATCAAAATAATCCAAACCAAAACCACTTCATACAAAAAAC

NOTE: Annealing temperature used for PCR amplification is shown. RUNX3 and FLNC PyroMark assays were obtained from Qiagen.

*Indicates the PCR primer with biotinylation.