Table 2.

The list of primers and restriction enzymes for the SNP-PCR-RFLP analyses at the PTEN locus

Ref. SNP#Restriction enzymeFwd primer (5′-3′)Rvs primer (5′-3′)
rs1903858HindIIITTTCTGCAGGAAATCCCATAGCTAGCCAGCTCTTAAATCTGACTTCC
rs1234225PvuIIAACAAATGTTGAAAGGTGCTCAAATGATGGTGTTCCACAGGTGTCT
rs10490920NcoITCAAGAAGTCCAAGAGCATTAGACAAGACAAGCCACCTAA
rs2735343HhaIAGTGGAGACAGACTGACCTGCTGTAGACATCAATGCTTGG
rs701848HaeIIITCCTACATGTGCTTTATTGATTTGCTTTGAAGACACCAAATTTCTGGA
rs1234224AsiI;SsiIGCAAGTGTCGGGAAGTGTAACCCCACTGTGCTCTCTATCCCACC
rs34421660No enzymeAGAAAGTGACTCTGATTTACCTAATATTGCTCCTGTTGAAACCT

Note that SNP rs34421660 is an insertion/deletion of 32-bp and it does not require restriction enzyme digestion to differentiate the 2 alleles.