Table 1.

Primer sequences for qPCR

GeneFwdRev
RPLP0TAAACCCTGCGTGGCAATCTTGTCTGCTCCCACAATGAAA
GREB1GGTTCTTGCCAGATGACAATGGCTTGGGTTGAGTGGTCAGTTTC
ESR1GAGTATGATCCTACCAGACCCTTCCCTGATCATGGAGGGTCAAATC
IGFBP3CACAGATACCCAGAACTTCTCCCAGGTGATTCAGTGTGTCTTCC
CCNG2GTTTGGATCGTTTCAAGGCGCCTCTCCACAACTCATATCTTCAC
PGRTCGCCTTAGAAAGTGCTGTCGCTTGGCTTTCATTTGGAACG
MYCGCTGCTTAGACGCTGGATTTGAGTCGTAGTCGAGGTCATAGT