Table 1.

Summary of bisulfite PCR and pyrosequencing primers

Gene or lociBisulfite PCR primersSequencing primersAnnealing temperature (cycles)
CHFRaForward55°C (48)
AGGGTATTTTTTGAAAGTGAAAGGTTTTTTGAAAGTGAAAGG
Reverse-Universal
GGGACACCGCTGATCGTTTATCCTACTTCACCCTCTTAAAACC
ID4Forward58°C (48)
TTTTTGGGTATATATTAGTTTGGTTGGAGTGTTTTTTTTATTG
Reverse-Universal
GGGACACCGCTGATCGTTTAAATCTAAAATAACCAACCAATCA
RECKForward55°C (48)
GTTGGGTTATAATAAAGAGTTTTGTTATAATAAAGAGTTTTGGT
Reverse-Universal
GGGACACCGCTGATCGTTTACCCCCTACCTCACAATATTTC
MINT1bForward56°C (3)
GGTTTTTTGTTAGAGTTTGTATTTTTTAGTAAAAATTTTTTGGG54°C (4)
Reverse-Universal52°C (5)
GGGACACCGCTGATCGTTTAATTAATCCCTCTCCCCTCTAAACTT50°C (36)

NOTE: For those with the Universal-tailed primer, the following additional primer is added: Universal (5′-Biotin) GGGACACCGCTGATCGTTTA.

  • aComplement sequence was used for designing PCR and sequencing primers.

  • bTouchdown PCR was used for MINT1 amplification.