Table 2.

Primers used for EGFR and β-catenin mutation screening and analysis of EGFR, Fascin, and β-catenin gene expression

Gene symbolExonForward primer 5′–3′Reverse primer 3′–5′TemplateFragment length (bp)
EGFR17tgttcctccacctcattccaactgctttccagcatggtgaDNA250
18actgctttccagcatggtgaacaactgctaatggcccgtt214
19atgtggcaccatctcacaattgtgccagggaccttacctt220
20atgcgaagccacactgacgtacctttgcgatctgcacaca229
21atgatctgtccctcacagcatgacctaaagccacctcctt216
22tgcctcatctctcaccatcccaagccagcttggcctcagtacaa150
23tcattcatgatcccactgccttagtcactcacacttgaccatga202
24tggaagtgtcgcatcaccaaagggactcttcccaatggaa236
25tacgggccattctaatagcctacagcttgagagagagagaga244
26tgaggcacaccacctgcattagccatagtggagagctgta180
27ttccctcatttcctcctgcaagcaggactgtttccagaca160
28 Iatgggatggtgctttgctgatgtcgaatgtgctgttgaca238
28 IIaaccccgagtatctcaacactccgtggtcatgctccaata238
β-Catenin3gatttgatggagttggacatggtgttcttgagtgaaggactgagDNA218
EGFRvIII1–8gggctctggaggaaaagaaacttcctccatctcatagctgtcDNA894 (wt)
93 (del)
EGFR21–22gaaaacaccgcagcatgtcatgccatccacttgataggcacDNA111
DNA1,003
FascinatggacctgtctgccaatcaacgccactcgatgtcaaagtcDNA189
DNA271
β-CateningtggaatgcaagctttaggatctgaacccagaagctgaaccDNA154
DNA238
B2MtgtctttcagcaaggactgggatgctgcttacatgtctcgcDNA148
DNA775
CDK4ctatgggacagtgtacaagggatatgtccttaggtcctggcDNA262
DNA420