Table 1

Primer sequences and PCR conditions for methylation-specific PCR

GeneForward primer sequence (5′–3′)Reverse primer sequence (5′–3′)Annealing temperature (°C)Ref. no.
DAP-K ua GGAGGATAGTTGGATTGAGTTAATGTTCAAATCCCTCCCAAACACCAA60 20
m GGATAGTCGGATCGAGTTAACGTCCCCTCCCAAACGCCGA60
E-cadherin u TTAGTTAATTAGTGGTATGGGGGGTGGACCAAACAAAAACAAACACCAAATACA57 21
m TAATTAGCGGTACGGGGGGCCGAAAACAAACGCCGAATACG57
MGMT u GTAGGTTGTTTGTATGTTTGTAACCAATACAAACCAAACA61
m GGTCGTTTGTACGTTCGCGACCGATACAAACCGAACG61
p14 u TTTTTGGTGTTAAAGGGTGGTGTAGTCACAAAAACCCTCACTCACAACAA60 22
m GTGTTAAAGGGCGGCGTAGCAAAACCCTCACTCGCGACGA60
p16 u TTATTAGAGGGTGGGGTGGATTGTCAACCCCAAACCACAACCATAA60 23
m TTATTAGAGGGTGGGGCGGATCGCGACCCCGAACCGCGACCGTAA65
p73 u AGGGGATGTAGTGAAATTGGGGTTTATCACAACCCCAAACATCAACATCCA59 24
m GGACGTAGCGAAATCGGGGTTCACCCCGAACATCGACGTCCG68
RAR β2 u TTGAGAATGTGAGTGATTTGAAACCAATCCAACCAAAACAA58
m TCGAGAACGCGAGCGATTCGGACCAATCCAACCGAAACGA58
RASSF1A u GGTTTTGTGAGAGTGTGTTTAGCACTAACAAACACAAACCAAACA64
m GGGTTTTGCGAGAGCGCGGCTAACAAACGCGAACCG64
  • a u, unmethylated sequence; m, methylated sequence.