Table 1

Sequences of PCR primers and fluorogenic probes used in quantitative PCR

GenePrimer/probeSequence
β-Gus (22)β-Gus-FCTCATTTGGAATTTTGCCGATT
β-Gus-RCCGAGTGAAGATCCCCTTTTTA
β-Gus probeFAM-TGAACAGTCACCGACGAGAGTGCTGG-TAMRA
MMP-1 (21) MMP-1-FGAGGGTCAAGCAGACATCATGA
MMP-1-RCAAGATTTCCTCCAGGTCCATC
MMP-1 probeFAM-TGTCAGGGGAGATCATCGGGACAA-TAMRA
MMP-2 (23) MMP-2-FTTCCTGGGCAACAAATATGAGA
MMP-2-RTGGTCGCACACCACATCTTT
MMP-2-probeFAM-AGCGCCGGCCGCAGTGA-TAMRA
MMP-9 (23) MMP-9-FCCCTGGAGACCTGAGAACCA
MMP-9-RAACCATAGCGGTACAGGTATTCCT
MMP-9-probeFAM-TCTCACCGACAGGCAGCTGGCA-TAMRA
  • NOTE. All probes were labeled with 3′ TAMRA quencher dye.