Table 1

Oligonucleotide primers for HER-2 PCR

PCRPrimerSequence 5′–3′Product (bp)
1stSense (Her-2-A)5′TCC TCC TCG CCCTCTTGC 3′330
Antisense (Her-2-B)5′GCGGGTCTCCATTGTCTA 3′
2ndSense (Her-2-C)5′AGCCGCGAGCACCCAAGT 3′147
Antisense (Her-2-D)5′ACCTGCTGAACTGGTGTATGCA 3′
  • GenBank accession no. M11730.