Table 2

Quantitative PCR validation of selected nine transcripts in saliva (n = 64)

Gene symbolPrimer sequence (5′ to 3′)Validated*P valueMean fold increase
DUSP1 F: CCTACCAGTATTATTCCCGACGYes0.0392.60
R: TTGTGAAGGCAGACACCTACAC
H3F3A F: AAAGCACCCAGGAAGCAACYes0.0115.61
R: GCGAATCAGAAGTTCAGTGGAC
IL1B F: GTGCTGAATGTGGACTCAATCCYes0.0055.48
R: ACCCTAAGGCAGGCAGTTG
IL8 F: GAGGGTTGTGGAGAAGTTTTTGYes0.00024.3
R: CTGGCATCTTCACTGATTCTTG
OAZ1 F: AGAGAGAGTCTTCGGGAGAGGYes0.0092.82
R: AGATGAGCGAGTCTACGGTTC
S100P F: GAGTTCATCGTGTTCGTGGCTGYes0.0034.88
R: CTCCAGGGCATCATTTGAGTCC
SAT F: CCAGTGAAGAGGGTTGGAGACYes0.0052.98
R: TGGAGGTTGTCATCTACAGCAG
GADD45B F: TGATGAATGTGGACCCAGACNo0.116
R: GAGCGTGAAGTGGATTTGC
RGS2 F: CCTGCCATAAAGACTGACCTTGNo0.149
R: GCTTCCTGATTCACTACCCAAC
  • NOTE. qPCR were performed to validate the microarray findings on an enlarged sample size including saliva from 32 patients with OSCC and 32 matched control subjects. Nine potential salivary mRNA biomarkers were selected from the 17 candidates shown in Table 1<$REFLINK> . Seven of them were validated by qPCR (P < 0.05). Sample includes 32 saliva from OSCC patients and 32 from matched normal subjects.

  • * Wilcoxon’s Signed Rank test: if P< 0.05, validated (Yes); if P ≥ 0.05, not validated (No).