Table 1

Sequences of antisense oligonucleotides used in this study

OligomerLengthSequence (5′-3′)aComments
G313918TCTCCCAGCGTGCGCCATPhosphorothioate, targeted to bcl-2 initiation codon
G412618TCTCCCAGCATGTGCCATPhosphorothioate, G3139 variant with single base mismatch at each CpG motif
200920AATCCTCCCCCAGTTCACCCPhosphorothioate, no CpG motifs, targeted to bcl-2 coding region
G423218TCTCCCAGCbGTGCbGCCATPhosphorothioate, G3139 variant with cytosine C5-methyl at each CpG

  • a Bold italic represent mismatched bases.

  • b 5-methyl-deoxycytidine.