Table 1.

Primer and probe sequences for real-time RT-PCR

Target genePrimers (5′-3′)Probe (5′-FAM/TAMRA-3′)
CK19Forward, TCGACAACGCCCGTCTGCCGAACCAAGTTTGAGACGGAACAGG
Reverse, CCACGCTCATGCGCAG
UP IIForward, TGGAGCCCCTCTTCTGTAAGTCATACTCACTGAGGGAACTCTACTCTCTCCCAAACC
Reverse, CAGTGGCTGTCCCCTTCTTC
GAPDHForward, GAAGGTGAAGGTCGGAGTCCAAGCTTCCCGTTCTCAGCC
Reverse, GAAGATGGTGATGGGATTTC