Table 1.

Primers and probes used in the real-time PCR

TargetPrimers/probesSequence (5′→3′)Position* (exon)Size (bp)Concentration (nmol/L)
TP53ForwardCGTCTGGGCTTCTTGCATTC328-347 (4)106300
ReverseAAGACCTGCCCTGTGCAGC415-433 (5)
ProbeFAM-CTGTGACTTGCACGTACTCCCCTGCC-VIC362-387100
p21ForwardCTGGAGACTCTCAGGGTCGAAA401-422 (2)101300
ReverseGAGGAAGCCTAATCCGCC483-501 (3)
ProbeFAM-CGGCAGACCAGCATGACAGATTTCTACCA-VIC427-455100
AblForwardAGCCATGGAGTACCTGGAGAAG1,047-1,068 (6)70300
ReverseTTCTCCCCTACCAGGCAGTTT1,101-1,121 (7)
ProbeFAM-AAACTTCATCCACAGAGATCTTGCTGCCC-VIC1,071-1,09875
  • * p53 Genbank accession no. AY838896, p21 Genbank accession no. AF497972, and Abl Genbank accession no. U07563.