Table 1.

A. Primers used for denaturing high-performance liquid chromatography analysis
ExonForward 5′-3′Reverse 5′-3′
1CAGCCAATCAGCGGTACGGGCGGGCGGGGGCGGCGGGCCGGCGTCCCTCGCAAGTCAGG
2GCGGCCCGCCGCCCCCGCCGAGGGAACCCTCCGAGTCACCCTACTCCGCCCAGGGACAC
3GCGGCCCGCCGCCCCCGCCGGAATGCTCTTGTCTTTAATCTGTCCCCTGGATTAGACAGCGCACTA
4CCTGAAGTATCCGTCTTGAATTGCTCCTTGGTACTTCTCTGCCA
5ATTTGGCAGAAGTACCAACCCATCACTTCTCCTTAGCA
6AGCCTAGGAAGGTGTGGCAGCGGGCGGGGGCGGCGGGCCGGGGTCCAAAGAACCTAAGAGTC
7ACCCAGTCCCAAAGTGCAGCGGGATTGAGCTAATACACATTTGTCC
8GCTAGTGTTCCTGGTCCTGACTCCATGAGCAGTGGTGACACTTAG
9CCAGCCTGGTGACAGTGAGATCAGCTGTGAGGATGCCAGTTTC
10GCGGCCCGCCGCCCCCGCCGTGGCAGAAACCACAGTTACTTCGGGCGGGGGGGTCTTGTACAGACAAATGAC
11GTTGTTTGCTGGTCCTATTCGAACTAGCTAGGAGGTCGAG
12GCGGCCCGCCGCCCCCGCCGTTACTGTTGCCAAGCTGCCACATGGCAGTTGGAGCAAAGTTGCCA
13GCGGCCCGCCGCCCCCGCCGCGGGTGTCTTTAGTTCACTAGCACCAGGAAATAAACCTCCTCCATT
14CTCTCAACACTTGCTCTGTCAGAGATCACCACTGAGCTAC
15TCTATAAACTGAACATAGCCCTGCGGGCGGGGGCGGCGGGCCGCTGAGCTTAGAGATGAGCC
16GCGGCCCGCCGCCCCCGCCGAGGTGTGCCCTTCCTTTCACCGGGCGGGGGCGGCGGGCCGCTGCATCACTAACCAGTCTCT
B. Conditions used for denaturing high-performance liquid chromatography analysis
Exon
Initial T touchdown (15 cycles, 0.5°C/cycle)
Final T (20 cycles)
Extension time
% DMSO
Column temperature
167.360.330566, 68, 68.6
267.360.320566.2, 67.8
363.456.4401060, 60.5
463563058.1, 59.3
564.557.53057.8, 59.3
664.657.64060, 60.5, 64.1
765.258.23061.1
865.958.93058.1, 60.5
965.758.74058.7, 61
1059.752.75054.5, 56.8, 59.8
1161.354.33061, 62
12655840559.9
1363.456.440557.8, 59, 60.5, 62.4
1461.254.23060, 62
1560.753.73058.5, 62.7
1662.555.540559.7, 61, 61.7