Table 1

Specific primers for HOX genes

GenePrimers
Annealing temperature (°C)Size (bp)Intron
SenseAntisense
HOXA1ATGAACTCCTTCCTGGAATACGTACTCTCCAACTTTCC48655+
HOXA2ACAGCGAAGGGAAATGTAAAAGCGGGCCCCAGAGACGCTAA54102
HOXA3TGCAAAAAGCGACCTACTACGACGTCGGCGCCCAAAG51126
HOXA4TGCATGCGAGCCACGTCCTTTGACCTGGCGCTCAGACAA52391+
HOXA5TGCGCAAGCTGCACATAAGTCATGTTGAAGTGGAACTCCTTCTCCAGC56112+
HOXA6GATGCAGCGCATGAACTCCTGCGTGGGCTGCGTGGAATTGATGAGC58250+
HOXA7CAAAATGCCGAGCCGACTTTAGCCGGACGCAAAGGG58146
HOXA9CAGCCAACTGGCTTCATGCGCACTCGTCTTTTGCTCGGTC53229
HOXA10AGAGCAGCAAAGCCTCGCCGGAGAAGGGACGCTGCGGCTAATCTCTAGGCG62198+
HOXA11ACCCGCAAAAAGCGCTGCGAGCATGCAGGACAGTTG50114
HOXA13GGGAGAAAGAAGCGCGTGCGTCGTGGCTGATATCCG53114
HOXB1CCTTCTTAGAGTACCCACTCTGGCATCTCCAGCTGCCTCCTT52826+
HOXB2TCCTCCTTTCGAGCAAACCTTCCAGTGGAATTCCTTCTCCAGTTCC52353+
HOXB3AGTACAAGAAGGACCAGAAGGCTGGAGTGTAAGGCGTTCATG50120
HOXB4GTGCAAAGAGCCCGTCGTCTACCCGTGTCAGGTAGCGGTTGTAGTG56161+
HOXB5GTTCCACTTCAACCGCTACCTGTCCTTCTTCCACTTCATGC52122
HOXB6GGCGAGGCCGCCAGACATACACTCGGCCTGTTTTTCTTCC52236
HOXB7AGAGTAACTTCCGGATCTATCTGCTTCAGCCCTGTCTT48274+
HOXB8AGCCTCCTTGTGCAATTGGTAACAATTGCCCACAGC48300
HOXB9GAGCAGGGCAAAGAGTAACTTTCTCCTGACACCTAG48250
HOXB13CTGGAACAGCCAGATGTGTTTTGGCGAGAACCTTCTTCTC50300+
HOXC4GAAGGAGAAGGATCGAGATCGGACCTGACTTTGGTGTTGGG53124
HOXC5TGGATGACCAAACTGCACATGAGCCAAGTTGTTGGCGATCTCTATGCG54149+
HOXC6CACCTTAGGACATAACACACAGACCCACTTCATCCGGCGGTTCTGGAACC58317+
HOXC8GCAACTCCCTTGAAGTTTCGTGGGGGAAGTCCAAAGGTAATA51172
HOXC9ACGAGGAAGAAGCGCTGCCCCGAGAACCCGGGCCACCTCATA60133
HOXC10CTACCGCCTGGAACAACCTGTTGGATGGTCTTGCTAATCTCCAGGCG54662+
HOXC11GTGTATATCAACAAAGAGAAGCGGGATAGAGGGTCCAGGAGGTTCCGG54322
HOXC12TAATCTCCTGAATCCCGGGTTTTGGGTAGGACAGCGAAGGC52124
HOXC13TCCCTAGCTCGCTGCCTCTGGTTCACGTTGTGCGACAGG53478
HOXD1CGACCCCCATCCCTATCTAGACTGGAACTCGGAAGCCAACTAAA52115
HOXD3CATCAGCAAGCAGATCTTCCAGCGGTTGAAGTGGAATTCC50187+
HOXD4TGGATGAAGAAGGTGCACGACTTCATCCTCCGGTTCTGG50220+
HOXD8GGATACGATAACTTACAGAGACTAGAGTTTGGAAGCGACTGT48219+
HOXD9GATGAGCAAGGAGAAATGCCAGTCGCTGGAGAGTTTCTGG52140
HOXD10TACTCCAACCAGCAATTGGCCTCGGATTCGATTCTCTCGG52233
HOXD11CTTCGACCAGTTCTACGAGCAGACGGTCTCTGTTCAGT50457+
HOXD12AGCAGGCTAAGTTCTATGCGCAATCTGCTGCTTCGTGTAG50380+
HOXD13AGAATGGAGAACGAGTATGCCCGGTTCTGAAACCAAATGG48114