Table 1

List of primers used for real-time RT-PCR

Accession numberSequencePositionProduct length
EPO-RNM_000121F: CCTGACGCTCTCCCTCATCC892130
R: GCCTTCAAACTCGCTCTCTGG1,021
sEPO-RX57282F: TGATTGGCTCAGTTCCACCAG66128
R:AGGTTGCTCAGCACACACTC193
EPONM_000799F: GATAAAGCCGTCAGTGGCCTTC54876
R: GGGAGATGGCTTCCTTCTGGG623
HIF-1αNM_001530F: CCAGCAGACTCAAATACAAGAACC2,090138
R: TGTATGTGGGTAGGAGATGGAGAT2,227
FIH-1NM_017902F: TGGCATGAATCCCAGTTGCG99112
R: GCACCACAGGCTCCTCATTC210
  • Abbreviations: F, forward primers; R, reverse primers.