Table 1.

Sequence of primers and probes used in the TaqMan qRT-PCR

PrimersFinal concentration (nmol/L)
bcr-e1400GCAAGACCGGGCAGATCT
bcr-b2400ACAGCATTCCGCTGACCAT
abl-a2400NEDR-CGAGCGGCTTCACTCAGA
abl 10-F50AGAGCTGCAGAGCACAGAGACA
abl 11-R50GCTCTTTTCGAGGGAGCAATG
TaqMan probes
    bcrabl-2a2006FAMR-CCTGAGGCTCAAAGTCAGATGCTACTGG-TAMRA
    abl 1011-P100VIC-ATGGTCCAGAGGATCGCTCTCTCCCT-TAMRA