Table 1.

Primer sequences, fragment sizes, PCR conditions with [MgCl2], and the annealing temperature and the conditions of the single-strand conformation polymorphism analysis

ExonPrimer (5′-3′)Size (bp)PCR conditionsSSCP conditions
1AGTCGCTGCAACCATCCA3191.5 mmol/L MgCl2, 56°C10%, 79:1, without glycerol, 22°C, 70 V, 19 h
CTAAGAGAGTGACAGAAAGGTA10%, 79:1, without glycerol, 4°C, 75 V, 19 h
2TGACCACCTTTTATTACTCCA3201.5 mmol/L MgCl2, 57°C10%, 29:1, 10% glycerol, 22°C, 80 V, 21 h
AGTATCTTTTTCTGTGGCTTA10%, 49:1 10% glycerol, 22°C, 80V, 21 h
3ATAGAAGGGGTATTTGTTGGA2881.5 mmol/L MgCl2, 58°C10%, 29:1, 10% glycerol, 22°C, 80 V, 21 h
CCTCACTCTAACAAGCAGATA10%, 49:1 10% glycerol, 22°C, 80V, 21 h
4ATTCAGGCAATGTTTGTTAG1602.0 mmol/L MgCl2, 52°C10%, 79:1, without glycerol, 4°C, 75 V, 16 h
CAACATAGTACAGTACATTC10%, 79:1, without glycerol, 22°C, 65 V, 16 h
5GCAACATTTCTAAAGTTACCTA3611.5 mmol/L MgCl2, 55°C10%, 29:1, 10% glycerol, 22°C, 80 V, 21 h
CTGTTTTCCAATAAATTCTCA10%, 49:1 10% glycerol, 22°C, 80V, 21 h
6CTTCTCTTTTTTTTCTGTCC1921.5 mmol/L mmol/L MgCl2, 56°C10%, 79:1, without glycerol, 4°C, 75 V, 16 h
AAGGATGAGAATTTCAAGCA10%, 79:1, without glycerol, 22°C, 65 V, 16 h
7ATCGTTTTTGACAGTTTG2601.5 mmol/L MgCl2, 57°C10%, 79:1, without glycerol, 4°C, 75 V, 20 h
CCCAATGAAAGTAAAGTACA10%, 79:1, without glycerol, 22°C, 75 V, 20 h
8.1CAGATTGCCTTATAATAGTC1952.0 mmol/L MgCl2, 51°C10%, 79:1, without glycerol, 4°C, 75 V, 17 h
TCCTGGTATGAAGAATGTAT10%, 79:1, without glycerol, 22°C, 65 V, 17 h
8.2AGGACAAAATGTTTCACTTTTGG1571.5 mmol/L MgCl2, 54°C10%, 79:1, without glycerol, 4°C, 75 V, 17 h
GTAAGTACTAGATATTCCTTGTC10%, 79:1, without glycerol, 22°C, 65 V, 17 h
8.3GAAATCGATAGCATTTGCAG1791.5 mmol/L MgCl2, 54°C10%, 79:1, without glycerol, 4°C, 75 V, 16 h
ATACATACAAGTCACCAACC10%, 79:1, without glycerol, 22°C, 65 V, 16 h
9AGATGAGTCATATTTGTGGG1491.5 mmol/L MgCl2, 55°C10%, 79:1, without glycerol, 4°C, 75 V, 18 h
ATGATCAGGTTCATTGTCAC10%, 29:1, 10% glycerol, 22°C, 80 V, 18 h
10CAGTTCAACTTCTGTAACAC1651.5 mmol/L MgCl2, 54°C10%, 79:1, without glycerol, 22°C, 65 V, 17 h
ATGGTGTTTTATCCCTCTTG10%, 29:1, 10% glycerol, 22°C, 85 V, 17 h
  • NOTE: The PCR programs included an initial denaturation of 95°C and 35 cycles of the program 95°C for 35 seconds, annealing temperature for 40 seconds, 72°C for 40 seconds. A final step of 72°C for 5 minutes was added. Single-strand conformation polymorphism conditions indicate the ratio of acrylamide to bisacrylamide.

    Abbreviation: SSCP, single-strand conformation polymorphism.