Table 2.

A. Intron-skipping CCNE variant–specific primers used for real-time PCR
GeneSpecificityAssay-on-Demand kit (Applied Biosystems)Exon boundary spanned according product insert
CCNE1*All variantsHs00233356_m14-5
CCNE2*Variant 2Hs00180319_m17-8
Gene
Specificity
Forward primer sequence 5′→3′
Reverse primer sequence 5′→3′
Product size (bp)
CCNE1All variants except variant E1Lexon 1, variant 2 TGCCACCCGGGTCCACAGexon 3, variant 2 GCACGTTGAGTTTGGGTAAAC271
CCNE1Wild type and E1L not E1S or E1Texon 7 CTTCACAGGGAGACCTTTTACexon 9 CATTCAGCCAGGACACAATAG274
CCNE1Variant E1T specificexon 7 CTTCACAGGGAGACCTTTTACexon 10 → 8 GAGATCCAACAGCTTCATAATC237
CCNE1§Variant E1S specificexon 6 → 8 GGATTGGTTAATGCAGGAAATCexon 10 GAAATTCAAGGCAGTCAACATC290
CCNE2Variant 1 + 2exon 8 TACGTCACTGATGGTGCTTGexon 10 TACGTCACTGATGGTGCTTG267
B. PCR traces of wild type and CCNE variants in primary breast tumors and cell lines
CCNE1
CCNE2
All variants (×10−2)
All variants, except E1L (×10−3)
Wild type + E1L, no E1S or E1T (×10−1)
Variant E1T (×10−3)
Variant E1S (×10−6)
Variant 1 + 2 (×10−1)
Variant 1 + 2 (×10−2)
LNN primary breast tumors4.411.141.312.532.137.947.67
Primary fibroblast strain7.090.840.770.8917.860.110.12
EAHY-926 endothelial cells11.602.501.281.1411.790.410.45
MDA-MB-2314.581.040.550.1562.212.251.16
MCF79.422.290.834.9535.241.100.71
ZR75.111.364.741.390.9419.011.461.31
T47-D12.691.070.610.830.150.561.20
EVSA-T13.411.861.143.2011.701.861.96
CAMA-125.205.521.665.249.911.921.68
MDA-MB-43540.101.790.871.811.180.271.26
SKBR-341.175.761.451.710.020.100.29
  • NOTE: In our initial screening, we compared CCNE1 and CCNE2 mRNA transcript levels of the various variants (A) in a set of 185 primary tumors from breast cancer patients and various cultured cell lines (B). Note that due to different assay conditions, absolute values of the CCNE's can only be compared within a gene assay. The assay designed to detect specifically the CCNE1S variant required >35 rounds of amplification for any product formation in our tumor material and was therefore considered too insensitive for reliable SYBR-based real-time PCR measurement. For the CCNE2 assay aimed to specifically detect the variant lacking part of the cyclin box (variant 2), correlation with the CCNE2 assay designed to detect both variants was highly significant (rs = 0.92, P < 0.001, n = 185), indicating that this splice variant did not play a role of significant importance. We, therefore, continued with the CCNE2 assay able to detect both variants and the CCNE1 assay able to detect (a) all CCNE1 variants and compared results with the CCNE1 assays able to detect; (b) all variants except variant E1L,: (c) all variants except variant E1S and E1T; and (d) the CCNE1T variant–specific assay.

  • * Assay done with Taqman probes in Universal PCR-master-mixture (Applied Biosystems).

  • Assay done in Brilliant SYBR Green PCR-master-mixture (Stratagene).

  • Assay done in SYBR-green PCR-master-mixture (Applied Biosystems).

  • § Assay done in Platinum SYBR Green qPCR SuperMix-UDG (Invitrogen).